BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Jun 28, 2025; 31(24): 104437
Published online Jun 28, 2025. doi: 10.3748/wjg.v31.i24.104437
miR-10a-5p and miR-10b-5p restore colonic motility in aged mice
Gain Baek, Rajan Singh, Se Eun Ha, Hayeong Cho, Sesh Padmanabhan, Vachan Vishwanath, Seungil Ro, Department of Physiology and Cell Biology, University of Nevada School of Medicine, Reno, NV 89557, United States
Min Seob Kim, Dahyun Seon, Jisong You, Moon Young Lee, Department of Physiology, Wonkwang University, Iksan 54538, South Korea
ORCID number: Rajan Singh (0000-0001-5500-1949); Se Eun Ha (0000-0001-6063-5559); Seungil Ro (0000-0003-0861-8334).
Co-first authors: Gain Baek and Rajan Singh.
Author contributions: Baek G, Singh R, Ha SE, and Ro S conception or design; Baek G, Singh R, Ha SE, Cho H, Padmanabhan S, Vishwanath V, Kim MS, Seon D, You J and Lee MY analysis, or interpretation of data; Baek G, Singh R and Ha SE drafting the work; Ro S revising; All authors have read and agreed to the published version of the manuscript.
Supported by National Institutes of Health Grants, No. R01DK103055 (to Ro S); RosVivo Therapeutics, No. AWD-01-00003158 (to Ro S); and the National Research Foundation of Korea Grant Funded by the Korean Government (MSIT), No. NRF-2021R1C1C2006743 (to Kim MS) and No. NRF-2021R1A2C1095311 (to Lee MY).
Institutional review board statement: Informed consent was obtained from all participants, and the study protocol was approved by the Wonkwang University Institutional Review Board, No. WKIRB-201906-BR-046.
Institutional animal care and use committee statement: All processes involving animal subjects were approved by the Institutional Animal Care and Use Committee at University of Nevada, Reno, which is fully accredited by the American Association for Accreditation of Laboratory Animal Care International, No. 20-05-1007-1.
Conflict-of-interest statement: This author discloses the following: Ro S and the University of Nevada Reno Office of Technology Transfer (serial No. 62/837,988, filed 24 April 2019) have published a PCT International Patent WO/2020/219872 entitled “Methods and compositions of miR-10 mimics and targets thereof”. Ro S is an employee and a member of the board of directors of RosVivo Therapeutics. Ha SE and Singh R are members of the board of directors of RosVivo Therapeutics. The remaining authors disclose no conflicts.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: No additional data are available.
Corresponding author: Seungil Ro, PhD, Professor, Department of Physiology and Cell Biology, University of Nevada School of Medicine, Center for Molecular Medicine L-207E, 1664 North Virginia Street, Reno, NV 89557, United States. sro@med.unr.edu
Revised: March 18, 2025
Accepted: June 3, 2025
Published online: June 28, 2025
Processing time: 188 Days and 12.6 Hours

Abstract
BACKGROUND

We previously identified miR-10b-5p as a key regulator of gastrointestinal (GI) motility through its essential role in the development and function of interstitial cells of Cajal (ICC), the pacemaker cells of the gut. Loss of miR-10b-5p in ICC impairs intestinal motility and contributes to constipation, a common condition in the elderly. Notably, miR-10b-5p is co-expressed with its paralog, miR-10a-5p, in ICC.

AIM

To investigate the roles of miR-10a-5p and miR-10b-5p in age-associated intestinal dysmotility and assess the therapeutic potential of restoring their expression.

METHODS

We employed aged mice, mir-10a and mir-10b single and double knockout (KO) models, and human plasma and colon samples across age groups. GI and colonic transit, ICC network integrity, and expression levels of miR-10a/b-5p were evaluated. Additionally, we tested whether treatment with their microRNA mimics could restore GI motility in aged mice.

RESULTS

Aged mice exhibited delayed GI and colonic transit, reduced fecal output, and diminished expression of miR-10a-5p and miR-10b-5p, which peaked during late embryonic and early postnatal stages and declined with age. This decline paralleled ICC network deterioration in the colon. All KO models exhibited impaired motility and ICC loss, with mir-10a KO mice displaying more severe phenotypes than mir-10b KO mice. Double KO mice demonstrated growth retardation and reduced survival, with homozygous mutants living only up to 3 months. Treatment of aged mice with miR-10a-5p and miR-10b-5p mimics encapsulated in jetPEI significantly improved GI and colonic motility. Successful delivery to the gut, including the colon, was confirmed. In human samples, both miR-10a/b-5p and KIT expression decreased with age.

CONCLUSION

miR-10a-5p and miR-10b-5p are essential for ICC maintenance and colonic motility, and their age-related decline contributes to GI dysmotility in both mice and humans. Restoring their levels offers a promising therapeutic strategy for treating age-related constipation and other motility disorders.

Key Words: MicroRNAs; Aged mice; Gastrointestinal dysmotility; Constipation; Interstitial cells of Cajal

Core Tip: Gastrointestinal (GI) dysmotility is strongly associated with aging, driven by functional changes in the gut. We previously identified miR-10b-5p as a key regulator of GI motility disorders. However, the specific roles of miR-10a-5p and miR-10b-5p in age-related GI dysmotility remain unexplored. This study presents compelling evidence supporting the miR-10a-5p and miR-10b-5p as critical regulators of interstitial cells of Cajal growth and function, playing essential roles in maintaining GI motility in aged mice and humans. Restoration of these microRNAs through miR-10a-5p and miR-10b-5p mimics in aged mice effectively alleviated GI dysmotility, particularly constipation, offering a promising therapeutic strategy for age-related GI motility disorders.



INTRODUCTION

Gastrointestinal (GI) dysmotility is strongly associated with aging, driven by functional changes in the digestive system[1]. Constipation, a prevalent issue among older adults, results from a combination of physiological, lifestyle, and medical factors[2]. Among these, age-related changes in the GI tract, particularly the slowing of colonic transit, play a significant role[3]. Colonic motility, primarily regulated by interstitial cells of Cajal (ICC)[4], is impaired in aging due to a decline in both the number and function of ICC, as observed in aged mice and humans[5-7]. A reduction in ICC numbers is directly linked to constipation[4,8].

ICC are pacemaker cells that generate electrical slow waves, driving phasic contractions in the GI tract[9]. Subtypes of ICC include myenteric plexus ICC (ICC-MY) and submucosal plexus ICC (ICC-SMP), both of which are critical for the rhythmic electrical activity that coordinates digestive tract contractions[5]. The growth and function of ICC are regulated by the receptor tyrosine kinase KIT[10]. KIT signaling is essential for ICC development, maintenance, and pacemaker activity[11].

MicroRNAs (miRNAs) are small non-coding RNAs, approximately 22 nucleotides in length, that are pivotal regulators of gene expression through mRNA targeting and translational repression. miRNAs influence various cellular processes, including proliferation, differentiation, and apoptosis[12]. During miRNA biogenesis, miRNAs are processed into duplexes consisting of 5’ and 3’ strands, both of which can be functional[13]. However, most miRNAs exhibit a 5’ and 3’ strand bias, where one strand is preferentially incorporated into the RNA-induced silencing complex, while the other is typically degraded[14].

In our previous studies, we demonstrated that mir-10b is essential for ICC growth and function in the GI tract[15]. mir-10a and mir-10b belong to the same family, with miR-10a-5p and miR-10b-5p being the predominantly generated strands from their respective genes[14]. These miRNAs target KLF11, a transcriptional repressor that negatively regulates KIT expression in ICC[15]. A deficiency of miR-10b-5p in mice leads to impaired GI motility due to reduced KIT expression and subsequent ICC loss[15].

In this study, we investigated the roles of miR-10a-5p and miR-10b-5p in colonic dysmotility associated with aging in mice and humans.

MATERIALS AND METHODS
Animals

This study utilized C57BL/6J (ranging from embryo day 6 to 25-month-old male mice), as well as mir-10a knockout (KO)[16], mir-10b KO[17] and mir-10a/b double KO mice. All animals were housed and maintained in the centralized animal care facility at the University of Nevada, Reno (UNR) Animal Resources. All processes involving animal subjects were approved by the Institutional Animal Care and Use Committee at UNR, which is fully accredited by the American Association for Accreditation of Laboratory Animal Care International.

Body weight and blood glucose measurements

Mouse body weight was measured biweekly. Fasting blood glucose levels were assessed every two weeks following a 6-hour fast. Blood samples were obtained from the tail vein using a small needle prick and analyzed with a blood glucose monitoring system.

In vivo GI motility assessments

GI motilities were assessed in overnight-fasted mice by measuring total GI transit time (TGITT) and colonic transit time (CTT)[17]. For TGITT, mice received 0.1 mL of a semiliquid solution containing 5% Evans blue dye in 0.9% NaCl with 0.5% methylcellulose via oral gavage. The time from gavage to the appearance of the first blue fecal pellet was recorded, representing the dye’s passage through the entire GI tract. For CTT, a 3 mm glass bead was gently inserted into the colon approximately 3 cm from the anus using a lubricated disposable Pasteur pipette. CTT was defined as the time elapsed from bead insertion to its expulsion, reflecting colonic motility.

To assess defecation patterns, fecal pellets were collected weekly from each mouse. During collection, an alpha pad (LBS Biotechnology; London, United Kingdom) replaced standard corn cob bedding to facilitate retrieval of fresh fecal matter. Over a 24-hour period, all fecal pellets were collected, weighed, and counted. Fecal pellet output was determined by multiplying the total pellet count by their average weight (g), providing a quantitative measure of defecation over 24 hours.

Immunohistochemistry and confocal microscopy analysis

Mouse proximal colonic tissue and human colonic tissue were analyzed using whole-mount or frozen section staining techniques. Tissues were incubated at 4 °C with anti-KIT antibody (R&D Systems; MN, United States) for 48 hours, followed by a 2-hour incubation with a secondary antibody at room temperature. After washing with 1x TBS, samples were mounted with Fluoroshield mounting medium containing DAPI (Abcam; Cambridge, United Kingdom). Images were acquired using Fluoview FV10-ASW 3.1 Viewer software (Olympus; Tokyo, Japan) with an Olympus FV1000 confocal laser scanning microscope or a Keyence BZ-X710) microscope (Osaka, Japan). KIT+ cell density was quantified using the BZ-X710 analyzer, measuring green or red fluorescent protein signals per unit area. The percentage of KIT+ cells was determined across both the myenteric and submucosal layers.

TA cloning, colony PCR, and restriction enzyme digestion

The miR-10a-5p and miR-10b-5p fragments were amplified by RT-qPCR and purified using the QIAquick® PCR Purification Kit (Qiagen; Hilden, Germany). Each amplicon was cloned to the pCR™4-TOPO vector using the TOPO®TA Cloning®Kit for Sequencing (Invitrogen; MA, United States), following the manufacturer's protocol. Recombinant vectors were then transformed into competent Escherichia coli (One Shot™ TOP10, Invitrogen; MA, United States) and cultured in LB medium supplemented with ampicillin for selection. To identify clones containing the insert, colony PCR was performed using M13 primers supplied with the TOPO cloning kit. Positive clones were further confirmed by electrophoresis, followed by gel purification of the miR-10a-5p and miR-10b-5p PCR products using the Qiagen MinElute Gel Extraction Kit (Qiagen; Hilden, Germany). Finally, purified products were digested with the restriction enzymes SfcI and Sau3AI (New England Biolabs; MA, United States) and analyzed by agarose gel electrophoresis.

Small RNA isolation, cDNA synthesis, and RT-qPCR

Small RNAs were isolated using the mirVana™ miRNA Isolation Kit (Thermo Fisher Scientific; MA, United States) following the manufacturer's instructions. RNA quality and quantity were assessed using a Nanodrop 2000 Spectrophotometer (Thermo Fisher Scientific; MA, United States). Polyadenylation of RNAs was performed using Poly (A) Polymerase (Ambion; TX, United States), followed by purification with the mirVana™ Probe & Marker Kit (Ambion; TX, United States). Reverse transcription was carried out using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific; MA, United States) and a miRTQ primer (Table 1), as previously described[15]. All cDNA samples were diluted to a concentration of 100 ng/μL. RT-qPCR was conducted using SYBR Green PCR Master Mix (Thermo Fisher Scientific; MA, United States), synthesized cDNAs, the universal miRTQ reverse primer, and target-specific primers. Reactions followed a standard RT-qPCR protocol on the CFX connect real-time PCR Detection System (Bio-Rad; CA, United States). Relative transcription levels were determined using the comparative cycle threshold method. Expression levels of each miRNA were quantified as the relative fold-change normalized to the control small nucleolar RNA, either human C/D box 55 (SNORD55) or mouse C/D box 66 (Snord66). Primer sequences are listed in Table 1.

Table 1 Oligonucleotides used in this study: Primers.
Name
Sequences (5' to 3')
Sense
Product (bp)
Spices
Application
miRTQCGAATTCTAGAGCTCGAGGCAGGCGACATGGCTGGCTAGTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCTTTTTTTTTTTTTTTTTTTTTTTTTVN1ReversecDNA
miRTQ-revCGAATTCTAGAGCTCGAGGCAGGReverseqPCR
miR-10aTACCCTGTAGATCCGAATTTGForward123Mouse/humanqPCR
miR-10bTACCCTGTAGAACCGAATTTGForward123Mouse/humanqPCR
Snord55GGTAATGCTGCATACTCCCGAGForwardHumanqPCR
Snord66CTGAGACCACATGATGGGATTGForwardMouseqPCR
M13CAGGAAACAGCTATGACForward289Cloning
M13-revACTGGCCGTCGTTTTACReverse289Cloning
Sequencing

The cloned miR-10a-5p and miR-10b-5p PCR products were purified, eluted, and sequenced using M13 forward and reverse primers at the Nevada Genomic Center. The resulting chromatograms were analyzed to confirm the DNA sequences of miR-10a-5p and miR-10b-5p in the cloned PCR products.

miRNA mimic synthesis and in vivo delivery

Chemically synthesized miR-10a-5p and miR-10b-5p mimics (Thermo Fisher Scientific, MA, United States) were complexed with in vivo-jetPEI (Polyplus-transfection; Illkirch, France) according to the manufacturer's instructions. Mice received intraperitoneal injections of either the miR-10a-5p mimic or the miR-10b-5p mimic at a dose of 500 ng/g body weight. The specific sequences of the miRNA mimics used in this study are listed in Table 2.

Table 2 Oligonucleotides used in this study: MicroRNA mimics.
Name
Sequence (5' to 3')
Sense
Spices
Application
miR-10a mimicUACCCUGUAGAUCCGAAUUUGUGSenseMouse/humanIn vivo
TTAUGGGACAUCUAGGCUUAAACAntisense
miR-10b mimicUACCCUGUAGAACCGAAUUUGUGSenseMouse/humanIn vivo
TTAUGGGACAUCUUGGCUUAAACAntisense
Human plasma and colon tissue

Human plasma samples were obtained from 26 healthy volunteers (aged 21-80 years) at Wonkwang University Hospital, South Korea. Colon tissue samples, specifically marginal tissue distant from cancer lesions, were collected from patients undergoing colonic resection for neoplasms at the Wonkwang University Hospital Biobank. Informed consent was obtained from all participants, and the study protocol was approved by the Wonkwang University Institutional Review Board.

Western blot

Proteins were extracted from mouse and human colon tissues, and Western blotting was conducted as previously described[15]. Primary antibodies used included anti-KIT (goat, 1:100, R&D Systems; MN, United States) and anti-GAPDH (Rabbit, 1:2500, Cell signaling; MA, United States). Blot images were acquired using the Vilber Fusion Solo.6S EDGE V0.70 imaging system (Vilber; Paris, France), and band quantification was conducted using ImageJ software.

Statistical analysis

Experimental data are presented as mean ± SEM. Intergroup comparisons were conducted using one-way analysis of variance with appropriate corrections for multiple comparisons. Data analysis was performed using GraphPad Prism (version 8.0, GraphPad Software). Statistical significance was defined as P values less than 0.05 for all tests.

RESULTS
Aged mice develop constipation with ICC loss

To examine the impact of aging on GI function, we assessed GI motility and analyzed fecal pellets in three age groups: Young (2-6 months), middle-aged (8-14 months), and old (18-30 months) mice (Table 3). TGITT was significantly delayed in old mice compared to young mice, both overall (Figure 1A) and at the individual level (Figure 1B). Similarly, CTT was prolonged in middle-aged mice and further delayed in old mice (Figure 1C and D). Fecal analyses revealed reduced fecal frequency and output in middle-aged and old mice compared to their young counterparts (Figure 1E and F). These changes were accompanied by an increase in fecal pellet size in the middle-aged and old groups, a hallmark of age-associated constipation (Figure 1G). We also examined ICC, which play a critical role in GI motility[18,19]. The expression of KIT, a key marker for ICC[20] and their function[21], showed an age-related decline. ICC subpopulations in the proximal colon, specifically ICC-MY and ICC-SMP, were fully mature in young mice at 2 months but progressively diminished with age (Figure 1H and I). Furthermore, KIT protein levels were significantly reduced in the proximal colonic muscle tissue of middle- and old-aged mice (Figure 1J and K). These findings suggest that the decline in ICC with aging contributes to colonic dysmotility, particularly constipation, in aged mice.

Figure 1
Figure 1 Aged mice develop gastrointestinal dysmotility with a progressive reduction in interstitial cells of Cajal. A: Total gastrointestinal transit time (TGITT) in young (2-6 months), middle age (8-14 months), and old (18-30 months) C57BL/6J mice. n ≥ 16 per group; B: Changes in TGITT in individual mice at 2, 12, and 22 months. n = 6; C: Colonic transit time (CTT) in young, middle age, and old mice, n ≥ 11 per group; D: Changes in CTT in individual mice at 2, 12, and 22 months. n = 6; E: Fecal frequency. n = 13; F: Fecal pellet output. n = 18; G: Fecal pellets collected; H: Whole-mount confocal images of interstitial cells of Cajal (ICC) in submucosal plexus (SMP) and myenteric plexus layer (MY) ICC in colonic smooth muscle detected by KIT antibody (green) in mice at 2, 6, 12, and 18 months. Scale bars were 50 μm; I: Quantification of KIT+ cells in panel H, presented as a percentage of the total across both MY and SMP layers. n = 3; J and K: Western blot and quantification of KIT in the proximal colonic smooth muscle in mice at 2, 3, 8 and 27 months. n = 3. aP < 0.05; bP < 0.01; cP < 0.001; dP < 0.0001; TGITT: Total gastrointestinal transit time; CTT: Colonic transit time; MY: Myenteric plexus; SMP: Submucosal plexus.
Table 3 Body weight and blood glucose levels across different age groups in this study.
Group
Age (months)
Blood glucose (mg/dL)
Body weight (g)
Young2-6104.5 ± 5.5626 ± 5.48
Middle8-14110.7 ± 13.9735.5 ± 3.42a
Old18-3095.5 ± 12.4038.9 ± 5.78b
Expression of both miR-10a-5p and miR-10b-5p decreases with age

Our previous study demonstrated that miR-10b-5p deficiency in ICC leads to reduced KIT expression and subsequent GI dysmotility[15]. Notably, miR-10b-5p is abundantly co-expressed with its family member, miR-10a-5p, making them the most highly expressed miRNAs in ICC[15]. miR-10a-5p and miR-10b-5p (collectively referred to as miR-10a/b-5p) belong to the same family but are derived from two distinct precursors and differ by a single nucleotide in their central region (Figure 2A). To investigate age-related changes in miR-10a/b-5p expression, their levels were quantified by RT-qPCR in mice from embryonic day 18 (E18) to 20 months. miR-10a-5p exhibited high expression at E18, followed by a gradual decline with age (Figure 2B). Similarly, miR-10b-5p displayed comparable levels at E18, peaked at 7 days postpartum (7D), and subsequently decreased over time (Figure 2C). These findings suggest that miR-10a/b-5p levels decrease with aging in mice.

Figure 2
Figure 2 Expression of miR-10a-5p and miR-10b-5p decreases with age. A: RNA sequence and structure of mouse miR-10a and 10b precursors encoding homologous miR-10a-5p and miR-10b-5p. One nucleotide, U or A differing between miR-10a-5p and miR-10b-5p, is circled; B and C: Expression of miR-10a-5p and miR-10b-5p in the whole gastrointestinal tissue at embryonic stage 18 (E18) and the whole blood from 7 days (7D) to 20 months across different age groups of C57BL/6J mice, measured by qPCR. Data were presented as mean ± SD. n ≥ 3 per group. aP < 0.05; bP < 0.01; D: QPCR amplicons of miR-10a-5p and miR-10b-5p electrophoresed on a 2% agarose gel. NTC stands for a non-template control. A DNA ladder was loaded on each side the gel; E: Construction of a TOPO®TA based expression vector cloned with miR-10a-5p or miR-10b-5p PCR products. A primer set, M13 forward and reverse primers, used to amplify PCR products (289 bp) is shown. Restriction enzyme sites for SfcI and Sau3AI are indicated; F: Colony PCR products electrophoresed on 2% agarose gels; G: PCR-amplified products digested with Sfcl and Sau3AI electrophoresed on a 1% agarose gel; H: MiR-10a-5p and miR-10b-5p sequencing chromatograms. One nucleotide, T or A differing between miR-10a-5p and miR-10b-5p, is circled.

To validate the specificity of our RT-qPCR assays for miR-10a-5p and miR-10b-5p, the amplicons were analyzed on an agarose gel, revealing single bands of approximately 120 bp (Figure 2D). These bands were eluted, cloned into the pCR4-TOPO vector, and amplified using M13 forward and reverse primers (Figure 2E). Clones of the expected size (289 bp) were selected for further analysis (Figure 2F). Digestion of the PCR products with restriction enzymes confirmed the specificity of the assay. Both miR-10a-5p and miR-10b-5p amplicons were digested by SfcI, which recognizes a shared cleavage site, producing fragments of 30 bp, 40 bp, 65 bp, and 154 bp (Figure 2E and G). However, Sau3AI digestion yielded distinct fragment patterns: miR-10a-5p produced fragments of 50 bp, 99 bp, and 140 bp, whereas miR-10b-5p produced fragments of 140 bp and 149 bp (Figure 2E and G). Finally, sequencing of the PCR products confirmed that the RT-qPCR selectively amplified miR-10a-5p and miR-10b-5p, further validating the assay's specificity (Figure 2H).

mir-10a and mir-10b single and double KO mice develop GI dysmotility

To examine whether miR-10a-5p and/or miR-10b-5p deficiency impacts the GI phenotype in mice, we generated mir-10b KO mice[17], obtained mir-10a KO mice[16], and created double mir-10a/b KO mice. Gross anatomical images of 1-month-old mir-10a/b single and double KO and wild-type (WT) mice are shown in Figure 3A. The mir-10b single KO mice were similar in size to the WT mice. In contrast, the mir-10a single KO mice were noticeably smaller. Notably, the mir-10a/b heterozygous and homozygous double mice were significantly smaller than either the mir-10a or mir-10b single KO mice (Figure 3A). The survival rates of the mir-10a/b single and double KO mice highlighted the lethal effects of dual gene deletion (Figure 3B). While mir-10a and mir-10b single KO mice survived up to 22 and 24 months, respectively, their WT counterparts lived up to 30 months. However, the mir-10a/b heterozygous and homozygous double KO mice showed drastically reduced lifespans, surviving up to 12 months and 3 months, respectively.

Figure 3
Figure 3 mir-10a and/or mir-10b knockout mice develop gastrointestinal dysmotility with a substantial reduction in interstitial cells of Cajal. A: Gross image in mir-10a knockout (KO), mir-10b KO and mir-10ab double heterozygous knockout (Het-dKO) and homozygous (Hom-dKO) mice; B: Survival percentages of mir-10a KO, mir-10b KO, mir-10ab Het-dKO, and mir-10ab Hom-dKO mice (n = 7-10, mir-10a, mir-10b KO, and wild-type (WT); n = 5, mir-10ab Het-dKO; n = 4, mir-10ab Hom-dKO); C and D: Total gastrointestinal transit time and Colonic transit time at 4-month and 10-month-old age in WT, mir-10a KO, mir-10b KO, and mir-10ab Het-dKO mice. n = 6-8 per group; E: Expression levels of miR-10a-5p and miR-10b-5p in the proximal colonic smooth muscle in WT, mir-10a KO, mir-10b KO, and mir-10ab Het-dKO mice, as measured by qPCR. n = 3 each group; F: Whole-mount confocal images of interstitial cells of Cajal (ICC) (KIT+) cells in submucosal plexus (SMP) and myenteric plexus layer (MY) ICC in proximal colonic smooth muscle in WT, mir-10a KO, mir-10b KO, and mir-10ab Het-dKO mice. Scale bars were 50 μm; G: Quantification of KIT+ cells in panel F, presented as a percentage of the total across both MY and SMP layers. n = 3 per group. Error bars indicate SEM, 1-way ANOVA. aP < 0.05; bP < 0.01 and cP < 0.001; TGITT: Total gastrointestinal transit time; WT: Wild-type; KO: Knockout; CTT: Colonic transit time; NA: Not available; MY: Myenteric plexus; SMP: Submucosal plexus.

The mir-10a/b single and double KO mice displayed marked GI dysmotility, as evidenced by significantly delayed TGITT and CTT at 4 months, which became further prolonged by 10 months (Figure 3C and D). We confirmed a significant reduction of miR-10a-5p or miR-10b-5p expression selectively in the proximal colonic muscle of mir-10a/b single and double KO mice, while detecting their presence in healthy WT mice, using qPCR (Figure 3E). Additionally, both ICC-MY and ICC-SMP populations were significantly reduced in the mir-10a/b single and double KO mice (Figure 3F and G). These findings suggest that both mir-10a and mir-10b genes are essential for the growth and function of ICC, thereby regulating GI motility.

Both miR-10a-5p mimic and miR-10b-5p mimic rescue GI dysmotility in aged mice

To assess whether miR-10a-5p and miR-10b-5p mimics could restore delayed GI motility in aged mice, we injected miR-10a-5p or miR-10b-5p mimics into 22-month-old mice with GI dysmotility (Figure 4A). These mimics, structured as RNA duplexes with two TT overhangs, replicate endogenous miR-10a-5p and miR-10b-5p, enhancing their stability and preferential strand selection (Figure 4B). The negatively charged miRNA duplexes were encapsulated with positively charged polymers using in vivo-jetPEI, forming miRNA/jetPEI complexes (Figure 4C).

Figure 4
Figure 4 miR-10a-5p mimic and miR-10b-5p mimic rescue gastrointestinal dysmotility in aged mice. A: Experimental design illustrating the intraperitoneal administration of miR-10a-5p or miR-10b-5p mimics in 22-month-old (aged) mice. Mice received a single intraperitoneal injection of either miR-10a-5p or miR-10b-5p mimics at a dosage of 500 ng/g body weight. Subsequent gastrointestinal (GI) functional assessments were conducted at 4 weeks post-injection; B: Duplex sequence and structure of the miR-10a-5p mimic or miR-10b-5p mimic; C: Complex formation of miR-10a-5p or miR-10b-5p mimic duplexes with in vivo-jet PEI; D: Verification of in vivo delivery of in vivo-jet PEI/miR-10a-5p mimic-Cy3 complexes in 8-months old mice. Cy3 fluorescence in the GI tract was assessed at 12-, 24-, and 48-hours post-injections, as well as pre-injection; E and F: Total gastrointestinal transit time and colonic transit time measurements in aged (22 months old) mice injected with the miR-10a-5p mimic (10a), miR-10b-5p mimic (10b), or left untreated [no injection (NI)], compared with young control (2-4 months old) mice. G: Fecal output in aged mice injected with the 10a or 10b mimic, or untreated (NI), compared with young controls. n = 5-6 per group; H-J: Expression levels of miR-10a-5p and miR-10b-5p and KIT in colonic muscle in aged mice injected with the miR-10a-5p mimic (10a), miR-10b-5p mimic (10b), or left untreated (no injection, NI), compared with young control mice (2-4 months old, n = 3). Error bars indicate SEM, 1-way ANOVA. aP < 0.05; bP < 0.01; cP < 0.001; dP < 0.0001; TGITT: Total gastrointestinal transit time; CTT: Colonic transit time.

To verify effective delivery, the miR-10a-5p mimic labeled with Cy3 was administered to mice. The mimic was successfully delivered to multiple organs, including the stomach, small intestine, colon, and pancreas. Peak detection occurred at 12 hours post-injection, decreased noticeably by 24 hours, and was undetectable at 48 hours (Figure 4D).

Both miR-10a-5p mimic and miR-10b-5p mimic effectively alleviated GI dysmotility in aged mice after 4 weeks post-single injection, as evidenced by significantly improved TGITT and CTT (Figure 4E and F). Moreover, fecal output was markedly restored in aged mice to levels comparable to those of young mice following miR-10a/b-5p mimic injection (Figure 4G). We further assessed miR-10a and miR-10b levels in colonic smooth muscle in aged mice and confirmed their restoration in colonic tissues following miR-10a/b-5p mimic injection (Figure 4H). Notably, KIT expression was significantly reduced in the proximal colonic smooth muscle of aged mice but was substantially restored by miR-10a/b-5p mimic injection (Figure 4I and J). These findings suggest that miR-10a/b-5p mimics, delivered into the GI tract using jetPEI as delivery agent, effectively improve GI dysmotility, particularly constipation, in aged mice.

miR-10a/b-5p levels, KIT expression, and the number of ICC in colon decline with age in humans

To validate the findings from the mouse models, we measured the levels of miR-10a/b-5p and KIT expression in human samples across different age groups. Both miR-10a-5p and miR-10b-5p were abundantly present in plasma and colonic tissue at 20 and 30 years of age, but their levels progressively declined in individuals aged 60 and 70 years (Figure 5A and B). Similarly, the number of ICC in the colon was significantly reduced in individuals in their 50 years, with a further decline observed in those in their 70 years, compared to those of 30 years (Figure 5C and D). Consistent with these trends, KIT protein levels also showed a marked age-related decrease in individuals in their 50 years and 70 years (Figure 5E and F). These findings collectively suggest that the age-associated decline in miR-10a/b-5p levels both in the plasma and colonic tissue contributes to the reduced expression of KIT, which may underlie the loss of ICC in the colon.

Figure 5
Figure 5 Validation of altered expression of miR-10a-5p and miR-10b-5p, and KIT in aged patients. A and B: Expression of miR-10a-5p and miR-10b-5p in plasma and colonic tissue samples across different aged groups. (n = 3-8); C: KIT antibody staining in colonic tissue from different aged groups; D: Quantification of KIT+ cells in panel C; E and F: Western blot and quantification of KIT in the colonic tissue from different aged groups. n = 3. Error bars indicate SEM, 1-way ANOVA. aP < 0.05; bP < 0.01; cP < 0.001.
DISCUSSION

GI dysmotility, such as constipation, is associated with a decline in ICC in the colon of aged humans[8]; however, the precise molecular mechanisms mediated by miRNAs underlying ICC loss with aging remain unclear. This study reveals that miR-10a-5p and miR-10b-5p are crucial regulators of ICC growth and function, playing essential roles in maintaining GI motility in both aged mice and humans. Restoration of these miRNAs through miR-10a-5p and miR-10b-5p mimics in aged mice effectively alleviated GI dysmotility, particularly constipation, offering a promising therapeutic strategy for age-related GI motility disorders.

We confirmed the critical roles of miR-10a-5p and miR-10b-5p in regulating GI phenotypes using mir-10a/b single and double KO mice. miRNAs often exhibit functional redundancy in targeting mRNAs, as multiple miRNAs can regulate the same mRNA[22]. As a result, single miRNA knockouts typically do not produce pronounced phenotypes[23]. Additionally, single miRNA KO can lead to compensatory upregulation of related miRNAs within the same family[24]. Consistent with this, we observed a slight increase in miR-10a-5p levels in mir-10b KO mice[17]. Despite this compensatory mechanism, mir-10a/b single KO mice displayed GI dysmotility and a shortened lifespan, emphasizing their essential roles in GI motility. Moreover, mir-10a/b double KO mice, particularly homozygous double KO mice, exhibited a severe phenotype characterized by early mortality within three months. These findings underscore the indispensable roles of both miR-10a-5p and miR-10b-5p in maintaining proper GI function and survival.

GI dysmotility observed in mir-10a/b single and double KO mice correlates with the high expression levels of these miRNAs in jejunal and colonic ICC[15]. Notably, mir-10a KO mice exhibited a more severe phenotype than mir-10b KO mice, consistent with the higher expression levels of miR-10a in both jejunal and colonic ICC[15]. miR-10a-5p is the most abundantly expressed miRNA in jejunal ICC and the third most highly expressed in colonic ICC, with its levels being twice as high in jejunal ICC compared to colonic ICC[15]. While colonic dysmotility is directly associated with constipation[25], small intestinal dysmotility is linked to impaired food breakdown and nutrient absorption[26,27], which are critical for survival. Additionally, mir-10b KO mice exhibited leaky gut and barrier dysfunction[17]. Thus, the deficiency of miR-10a/b-5p in single and double KO mice likely results in nutrient malabsorption in the jejunum and constipation in the colon, ultimately contributing to their stunted growth and shortened lifespan.

GI motility is primarily regulated by ICC[28]. Dysfunction or loss of ICC in the GI tract has been associated with constipation in both animal models and humans[4,15]. Additionally, ICC decline with aging has been observed in mice and humans[29,30]. We previously demonstrated that miR-10b-5p is essential for ICC growth and function[15]. This miRNA enhances ICC growth and functionality by targeting KLF11, a transcriptional repressor of the KIT gene, thereby relieving KLF11-mediated suppression and enhancing KIT expression[15]. Notably, the miR-10b-5p target site in KLF11 is identical in mice and humans to that of miR-10a-5p[15], indicating that both miRNAs regulate KIT expression in ICC via KLF11.

miR-10a-5p and miR-10b-5p mimics significantly improved GI dysmotility in aged mice. Our previous studies demonstrated that these mimics effectively alleviated dysmotility symptoms, including delayed gastric emptying, TGITT, and CTT, in high-fat and high-sucrose-induced diabetic mice, as well as in mir-10b global and ICC-specific KO mice[15]. This study further validated that miR-10a-5p and miR-10b-5p mimics, encapsulated using the positively charged polymer jetPEI, were efficiently delivered to the stomach, small intestine, and colon. A growing number of miRNA-based therapeutics have entered clinical development to treat various diseases, including cancer[31]. The field of miRNA therapeutics is poised for substantial growth, especially following the 2024 Nobel Prize in Physiology or Medicine awarded to Dr. Victor Ambros and Gary Ruvkun for their groundbreaking work on miRNAs and their roles in post-transcriptional gene regulation, which influence organ development and disease processes.

CONCLUSION

Consistent with findings in mice, miR-10a/b-5p levels, KIT expression, and the number of ICC in the colon decline with age in humans. Previously, we observed a significant reduction in miR-10b-5p levels in patients with constipation-predominant irritable bowel syndrome[17] and in those with diabetic and idiopathic gastroparesis[15]. Moreover, KLF11 was abnormally elevated in diabetic gastroparesis patients, while KIT expression was reduced[15]. These findings collectively suggest that the age-related decline in miR-10a/b-5p levels leads to reduced KIT expression, contributing to ICC loss in the colon and the development of constipation. Furthermore, our studies highlight the translation potential of miR-10a/b in elucidating the pathophysiological mechanisms of gut dysmotility and developing therapeutics for slow transit constipation. This study has some limitations. The role of mir-10a in GI dysmotility should be validated through conditional KO of mir-10a in ICC in aged mice. We are currently generating ICC-specific mir-10a KO mice using floxed mir-10a mice[32]. Additionally, the miR-10a-5p-KLF11-KIT pathway in ICC should be examined in aged patients with constipation. However, this validation requires a full colon biopsy, which poses challenges for elderly patients.

ACKNOWLEDGEMENTS

The authors would like to thank Benjamin J. Weigler, DVM, and Walt Mandeville, DVM, for their professional animal services provided to mice.

References
1.  Stillhart C, Asteriadis A, Bocharova E, Eksteen G, Harder F, Kusch J, Tzakri T, Augustijns P, Matthys C, Vertzoni M, Weitschies W, Reppas C. The impact of advanced age on gastrointestinal characteristics that are relevant to oral drug absorption: An AGePOP review. Eur J Pharm Sci. 2023;187:106452.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 18]  [Reference Citation Analysis (0)]
2.  Schuster BG, Kosar L, Kamrul R. Constipation in older adults: stepwise approach to keep things moving. Can Fam Physician. 2015;61:152-158.  [PubMed]  [DOI]
3.  Dumic I, Nordin T, Jecmenica M, Stojkovic Lalosevic M, Milosavljevic T, Milovanovic T. Gastrointestinal Tract Disorders in Older Age. Can J Gastroenterol Hepatol. 2019;2019:6757524.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 234]  [Cited by in RCA: 174]  [Article Influence: 24.9]  [Reference Citation Analysis (7)]
4.  Huizinga JD, Hussain A, Chen JH. Interstitial cells of Cajal and human colon motility in health and disease. Am J Physiol Gastrointest Liver Physiol. 2021;321:G552-G575.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 66]  [Article Influence: 13.2]  [Reference Citation Analysis (4)]
5.  Sanders KM, Ward SM, Koh SD. Interstitial cells: regulators of smooth muscle function. Physiol Rev. 2014;94:859-907.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 439]  [Cited by in RCA: 367]  [Article Influence: 30.6]  [Reference Citation Analysis (6)]
6.  Gomez-Pinilla PJ, Gibbons SJ, Sarr MG, Kendrick ML, Shen KR, Cima RR, Dozois EJ, Larson DW, Ordog T, Pozo MJ, Farrugia G. Changes in interstitial cells of cajal with age in the human stomach and colon. Neurogastroenterol Motil. 2011;23:36-44.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 96]  [Cited by in RCA: 93]  [Article Influence: 6.2]  [Reference Citation Analysis (0)]
7.  Sun T, Li D, Hu S, Huang L, Sun H, Yang S, Wu B, Ji F, Zhou D. Aging-dependent decrease in the numbers of enteric neurons, interstitial cells of Cajal and expression of connexin43 in various regions of gastrointestinal tract. Aging (Albany NY). 2018;10:3851-3865.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 47]  [Cited by in RCA: 43]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
8.  He CL, Burgart L, Wang L, Pemberton J, Young-Fadok T, Szurszewski J, Farrugia G. Decreased interstitial cell of cajal volume in patients with slow-transit constipation. Gastroenterology. 2000;118:14-21.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 287]  [Cited by in RCA: 278]  [Article Influence: 10.7]  [Reference Citation Analysis (4)]
9.  Sanders KM, Koh SD, Ward SM. Interstitial cells of cajal as pacemakers in the gastrointestinal tract. Annu Rev Physiol. 2006;68:307-343.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 521]  [Cited by in RCA: 452]  [Article Influence: 22.6]  [Reference Citation Analysis (1)]
10.  Friedmacher F, Rolle U. Interstitial cells of Cajal: clinical relevance in pediatric gastrointestinal motility disorders. Pediatr Surg Int. 2023;39:188.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 12]  [Article Influence: 4.0]  [Reference Citation Analysis (2)]
11.  Torihashi S, Nishi K, Tokutomi Y, Nishi T, Ward S, Sanders KM. Blockade of kit signaling induces transdifferentiation of interstitial cells of cajal to a smooth muscle phenotype. Gastroenterology. 1999;117:140-148.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 203]  [Cited by in RCA: 221]  [Article Influence: 8.2]  [Reference Citation Analysis (1)]
12.  Croce CM, Calin GA. miRNAs, cancer, and stem cell division. Cell. 2005;122:6-7.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1002]  [Cited by in RCA: 1074]  [Article Influence: 51.1]  [Reference Citation Analysis (0)]
13.  Shang R, Lee S, Senavirathne G, Lai EC. microRNAs in action: biogenesis, function and regulation. Nat Rev Genet. 2023;24:816-833.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 617]  [Cited by in RCA: 620]  [Article Influence: 206.7]  [Reference Citation Analysis (1)]
14.  Kozomara A, Birgaoanu M, Griffiths-Jones S. miRBase: from microRNA sequences to function. Nucleic Acids Res. 2019;47:D155-D162.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1834]  [Cited by in RCA: 3326]  [Article Influence: 554.3]  [Reference Citation Analysis (0)]
15.  Singh R, Ha SE, Wei L, Jin B, Zogg H, Poudrier SM, Jorgensen BG, Park C, Ronkon CF, Bartlett A, Cho S, Morales A, Chung YH, Lee MY, Park JK, Gottfried-Blackmore A, Nguyen L, Sanders KM, Ro S. miR-10b-5p Rescues Diabetes and Gastrointestinal Dysmotility. Gastroenterology. 2021;160:1662-1678.e18.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 76]  [Cited by in RCA: 61]  [Article Influence: 12.2]  [Reference Citation Analysis (4)]
16.  Stadthagen G, Tehler D, Høyland-Kroghsbo NM, Wen J, Krogh A, Jensen KT, Santoni-Rugiu E, Engelholm LH, Lund AH. Loss of miR-10a activates lpo and collaborates with activated Wnt signaling in inducing intestinal neoplasia in female mice. PLoS Genet. 2013;9:e1003913.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 36]  [Cited by in RCA: 43]  [Article Influence: 3.3]  [Reference Citation Analysis (3)]
17.  Zogg H, Singh R, Ha SE, Wang Z, Jin B, Ha M, Dafinone M, Batalon T, Hoberg N, Poudrier S, Nguyen L, Yan W, Layden BT, Dugas LR, Sanders KM, Ro S. miR-10b-5p rescues leaky gut linked with gastrointestinal dysmotility and diabetes. United European Gastroenterol J. 2023;11:750-766.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 13]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
18.  Hwang SJ, Kwon JG, Beckett EAH, Kim M, Herbert T, Sanders KM, Ward SM. Functional roles of interstitial cells of Cajal in the GI tract of rats. Am J Physiol Gastrointest Liver Physiol. 2025;328:G677-G695.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 4]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
19.  Chen H, Ordög T, Chen J, Young DL, Bardsley MR, Redelman D, Ward SM, Sanders KM. Differential gene expression in functional classes of interstitial cells of Cajal in murine small intestine. Physiol Genomics. 2007;31:492-509.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 97]  [Cited by in RCA: 102]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
20.  Zhou J, O'Connor MD, Ho V. The Potential for Gut Organoid Derived Interstitial Cells of Cajal in Replacement Therapy. Int J Mol Sci. 2017;18:2059.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 17]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
21.  Torihashi S, Ward SM, Nishikawa S, Nishi K, Kobayashi S, Sanders KM. c-kit-dependent development of interstitial cells and electrical activity in the murine gastrointestinal tract. Cell Tissue Res. 1995;280:97-111.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 27]  [Cited by in RCA: 123]  [Article Influence: 4.0]  [Reference Citation Analysis (2)]
22.  Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116:281-297.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 29798]  [Cited by in RCA: 27796]  [Article Influence: 1263.5]  [Reference Citation Analysis (4)]
23.  Vidigal JA, Ventura A. The biological functions of miRNAs: lessons from in vivo studies. Trends Cell Biol. 2015;25:137-147.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 435]  [Cited by in RCA: 403]  [Article Influence: 36.6]  [Reference Citation Analysis (0)]
24.  Gurtan AM, Sharp PA. The role of miRNAs in regulating gene expression networks. J Mol Biol. 2013;425:3582-3600.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 382]  [Cited by in RCA: 349]  [Article Influence: 26.8]  [Reference Citation Analysis (0)]
25.  Dinning PG, Di Lorenzo C. Colonic dysmotility in constipation. Best Pract Res Clin Gastroenterol. 2011;25:89-101.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 57]  [Cited by in RCA: 48]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
26.  Jackman L, Arpe L, Thapar N, Rybak A, Borrelli O. Nutritional Management of Pediatric Gastrointestinal Motility Disorders. Nutrients. 2024;16:2955.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
27.  Bildstein T, Charbit-Henrion F, Azabdaftari A, Cerf-Bensussan N, Uhlig HH. Cellular and molecular basis of proximal small intestine disorders. Nat Rev Gastroenterol Hepatol. 2024;21:687-709.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 13]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
28.  Sanders KM, Koh SD, Ro S, Ward SM. Regulation of gastrointestinal motility--insights from smooth muscle biology. Nat Rev Gastroenterol Hepatol. 2012;9:633-645.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 395]  [Cited by in RCA: 343]  [Article Influence: 24.5]  [Reference Citation Analysis (4)]
29.  Taheri N, Choi EL, Nguyen VTT, Zhang Y, Huynh NM, Kellogg TA, van Wijnen AJ, Ordog T, Hayashi Y. Inhibition of EZH2 Reduces Aging-Related Decline in Interstitial Cells of Cajal of the Mouse Stomach. Cell Mol Gastroenterol Hepatol. 2024;18:101376.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 11]  [Article Influence: 5.5]  [Reference Citation Analysis (0)]
30.  Patejdl R. Gastrointestinal Motility Function and Dysfunction in the Elderly Patient: What Are the Effects of Aging? Visc Med. 2024;40:325-330.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 8]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
31.  Seyhan AA. Trials and Tribulations of MicroRNA Therapeutics. Int J Mol Sci. 2024;25:1469.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 303]  [Cited by in RCA: 229]  [Article Influence: 114.5]  [Reference Citation Analysis (0)]
32.  Yang W, Chen L, Xu L, Bilotta AJ, Yao S, Liu Z, Cong Y. MicroRNA-10a Negatively Regulates CD4(+) T Cell IL-10 Production through Suppression of Blimp1. J Immunol. 2021;207:985-995.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 10]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: United States

Peer-review report’s classification

Scientific Quality: Grade B, Grade B

Novelty: Grade B, Grade C

Creativity or Innovation: Grade B, Grade C

Scientific Significance: Grade B, Grade B

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Sui N; Zhu WJ S-Editor: Li L L-Editor: A P-Editor: Wang WB

Write to the Help Desk