BPG is committed to discovery and dissemination of knowledge
Meta-Analysis Open Access
©2014 Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Aug 28, 2014; 20(32): 11429-11438
Published online Aug 28, 2014. doi: 10.3748/wjg.v20.i32.11429
Methylenetetrahydrofolate reductase C677T and A1298C polymorphisms and gastric cancer susceptibility
Lei-Zhou Xia, Peng-Cheng Jiang, Gui Ma, Xue-Feng Bu, Yong-Jun Zhang, Feng Yu, Hua Li, Department of General Surgery, Affiliated People’s Hospital, Jiangsu University, Zhenjiang 212002, Jiangsu Province, China
Yi Liu, Ke-Sen Xu, Department of Hepatobiliary Surgery, Qilu Hospital, Shandong University, Jinan 250012, Shandong Province, China
Xiao-Zhou Xu, Department of Surgery, Chang-Hai Hospital, The Second Military Medical University, Shanghai 200000, China
Author contributions: Xia LZ and Li H designed the research; Xia LZ, Liu Y, Xu XZ, Jiang PC, Ma G, Bu XF, Zhang YJ, Yu F and Xu KS performed the data search and meta-analysis; Xia LZ wrote the paper.
Correspondence to: Hua Li, MD, Department of General Surgery, Affiliated People’s Hospital, Jiangsu University, No. 8, Dianli Road, Zhenjiang 212002, Jiangsu Province, China. drlihua212@163.com
Telephone: +86-511-88915151 Fax: +86-511-88915151
Received: October 8, 2013
Revised: March 4, 2014
Accepted: May 12, 2014
Published online: August 28, 2014
Processing time: 324 Days and 14 Hours

Abstract

AIM: To identify the association between methylenetetrahydrofolate reductase (MTHFR) polymorphisms and gastric cancer (GC) susceptibility.

METHODS: Systematic searches were performed on the electronic databases PubMed, ISI, Web of knowledge, CNKI and Wanfang, as well as manual searching of the references of the identified articles. A total of 26 papers were included in this meta-analysis. Overall and subgroup analyses were performed. Odds ratio (OR) and 95%CI were used to evaluate the associations between MTHFR polymorphisms and GC risk. The I2 statistics were used to evaluate between-study heterogeneity. Sensitivity analysis was also performed.

RESULTS: Increased risk was found for the MTHFR C677T polymorphism under four genetic models (TT + CT vs CC: OR = 1.23, P = 0.002; T vs C: OR = 1.15, P = 0.001; TT vs CC: OR = 1.37, P = 0.0005; TT vs CT + CC: OR = 1.17, P = 0.0008). Subgroup analysis by ethnicity suggested that C677T polymorphism conferred a risk of GC in eastern but not in western populations. Stratification by tumor site showed an association between the C677T polymorphism and gastric cardia cancer and non-cardia GC in the worldwide population and in eastern populations. Regardless of comparisons with controls or diffuse-type GC, a positive association was found for the C677T polymorphism and an increased risk of intestinal-type GC in the whole population and in western populations. With regard to the A1298C polymorphism, we found that genotype CC was significantly decreased and conferred protection against GC in eastern populations (CC vs AA: OR = 0.44, P = 0.03; CC vs AC + AA: OR = 0.46, P = 0.04).

CONCLUSION: MTHFR C677T polymorphism is a risk factor for GC, and the A1298C polymorphism may be a protective factor against GC in eastern populations.

Key Words: Methylenetetrahydrofolate reductase; Polymorphism; Gastric cancer; Meta-analysis

Core tip: Many studies have reported associations of methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms with susceptibility to gastric cancer (GC). There are several relevant published meta-analyses about this subject. Nevertheless, these articles failed to analysis MTHFR polymorphisms and GC risk per se in detail as follows. They failed to investigate the difference between gastric cardia cancer and non-cardia GC, and the distinction between diffuse and intestinal subtypes. Consequently, we performed a meta-analysis to clarify the roles of MTHFR C677T and A1298C polymorphisms in GC susceptibility among the eligible studies.



Core tip: Many studies have reported associations of methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms with susceptibility to gastric cancer (GC). There are several relevant published meta-analyses about this subject. Nevertheless, these articles failed to analysis MTHFR polymorphisms and GC risk per se in detail as follows. They failed to investigate the difference between gastric cardia cancer and non-cardia GC, and the distinction between diffuse and intestinal subtypes. Consequently, we performed a meta-analysis to clarify the roles of MTHFR C677T and A1298C polymorphisms in GC susceptibility among the eligible studies.


INTRODUCTION

The incidence of gastric cancer (GC) has decreased worldwide, but it remains the fourth most common cancer diagnosis in men and the fifth in women[1], and the second leading cause of cancer-related death[2,3]. The etiology of GC is believed to be multi-stage and multifactorial. Although the decrease in the incidence of GC[4] in recent decades can be explained by changing lifestyles, diet habits, and reduced Helicobacter pylori infection, the fact that some individuals develop GC while others do not under similar environmental circumstances suggests that genetic predisposition plays an important role in the pathogenesis of GC.

Methylenetetrahydrofolate reductase (MTHFR), wh-ose gene maps to chromosome 1p36.3[5] and encodes a 77-kDa protein[6], plays a key role in folate metabolism by irreversibly catalyzing the reduction of 5, 10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, the predominant circulatory form of folate, which serves as both a cofactor and substrate for the regeneration of methionine. The latter leads to production of S-adenosylmethionine (SAM); the universal methyl donor in humans for DNA methylation[7]. Reduced enzyme activity may result in lower levels of SAM and an increased risk of cancer, including GC, as a consequence of gene hypomethylation[8]. Two common single nucleotide polymorphisms (SNPs) of MTHFR have been indicated: C677T (rs1801133), which results in the amino acid product changing from alanine to valine[9]; and A1298C (rs1801131), which results in the amino acid product changing from glutamic acid to alanine[8]. Studies have confirmed that the variant genotypes are associated with a significant reduction of enzyme activity[10,11], suggesting that the polymorphisms of C677T and A1298C may be related to the risk of GC.

Until now, many studies have reported associations of MTHFR C677T and A1298C polymorphisms with susceptibility to GC with controversial results[12-37]. Additionally, there have been several relevant meta-analyses published on this subject[38-44]. Nevertheless, these studies failed to analyze MTHFR polymorphisms and GC risk per se in detail as follows. They failed to address the difference between gastric cardia cancer (GCC) and non-cardia gastric cancer (NCGC) as well as the distinction between diffuse and intestinal subtypes. Consequently, we performed a meta-analysis to clarify the roles of MTHFR C677T and A1298C polymorphisms in GC susceptibility among the eligible studies.

MATERIALS AND METHODS
Search strategy

Two researchers independently performed a computerized search in four databases - PubMed, ISI Web of Knowledge (Version 4.5), Chinese National Knowledge Infrastructure, and Wanfang (Chinese) - up to May 2013. Moreover, an additional search was carried out for relevant studies on scholar.google.com.hk. The search terms were ‘‘methylenetetrahydrofolate reductase’’ or MTHFR, “gastric or stomach or cardia” and “cancer or carcinoma or neoplasm” in various combinations, with the language limited to English and Chinese. The reference list of each relevant publication was also reviewed to ensure that all appropriate studies were included in the meta-analysis.

Inclusion and exclusion criteria

Studies were included according to the following criteria: (1) case-control or cohort studies determining the distribution of MTHFR C677T and/or A1298C genotypes; (2) cases with GC were diagnosed by histopathological biopsy, and the controls were free of cancer; and (3) the numbers of cases and controls reported for each genotype should be sufficient for calculation. If multiple studies from the same case series were available, the one including the most individuals was used in the analysis. We excluded the studies if they were: (1) meeting abstracts, case reports, reviews, or editorials; (2) not written in English or Chinese; or (3) not in Hardy-Weinberg equilibrium (HWE) with the controls. The final included studies were based on discussion among the researchers.

Data extraction

Two investigators independently extracted data from the published reports using a standardized protocol and a reporting form with the following information: first author’s last name, year of publication, country and ethnicity of participants (classified into eastern and western), sample size, detailed genotype information (genotype distribution and allele frequency), anatomical site of tumor (cardia or non-cardia GC) and Lauren classification (intestinal or diffuse subtype).

Statistical analysis

The MTHFR C677T genotypes include TT, CT and CC, and A1298C comprises CC, AC and AA genotypes. The pooled odds ratios (ORs) were calculated for the dominant model [C677T: (TT + CT) vs CC; A1298C: (CC + AC) vs AA], the allelic model (C677T: T allele vs C allele; A1298C: C allele vs A allele), the additive model (C677T: TT vs CC; A1298C: CC vs AA), and the recessive model (C677T: TT vs (CT + CC); A1298C: CC vs (AC + AA), respectively. Given that the potential causes of heterogeneity among studies were ethnicity, tumor site and classification, subgroup analyses were conducted according to different ethnic groups (Eastern/Western), tumor site (cardia/non-cardia), and Lauren classification (intestinal/diffuse).

RevMan software (Review Manager, Version 5.1; Cochrane Collaboration, 2011) was used for this meta-analysis. The between-study heterogeneity (i.e., the variation in findings not compatible with chance alone) was tested with the χ2-based Cochran’s statistic and the inconsistency index (I2). Statistically significant heterogeneity was considered to be present when Pheterogeneity < 0.05 and I² > 50%. If there was no statistical heterogeneity among studies (I2 < 50% and Pheterogeneity > 0.05), the OR and 95%CI were estimated for each study in a fixed-effects model (FEM). Otherwise, a random effect model (REM) was used. A funnel plot was performed to look for evidence of publication bias; the funnel plot should be asymmetric when there is publication bias and symmetric in the case of no publication bias. Additionally, the publication bias was quantitatively estimated by Begg’s and Egger’s tests.

RESULTS
Study characteristics

Figure 1 summarizes the selection process of eligible studies. After a thorough literature search, 26 qualified publications[12-37] were included in this meta-analysis according to the inclusion criteria. Among these, 24 were included for the MTHFR C677T polymorphism and GC, and 11 were included for the MTHFR A1298C polymorphism and GC. The characteristics of the included studies, the variant genotypes and allele frequencies are listed in Table 1. Table 2 shows the available data on GCC and NCGC for MTHFR C677T and A1298C in detail. Additionally, data on intestinal and diffuse subtype GC for C677T were accessible in four studies (Table 3). According to the size of the heterogeneity, FEM or REM was adopted to analyze every comparison (Table 4).

Table 1 Characteristics of eligible studies included in the meta-analysis.
Ref.CountryEthnicitySample size
C677T
A1298C
Genotypes distribution
Alleles frequency
PGenotypes distribution
Alleles frequency
P
CaseControlCase
Control
Case
Control
HWECase
Control
Case
Control
HWE
CCCTTTCCCTTTCTCTAAACCCAAACCCACAC
Gao et al[12]ChinaEastern26453511510544277207513351937613090.19
Guo et al[13]ChinaEastern97114224827325725921021211070.97
Saberi et al[14]IranEastern405780198172354223085057824211524080.54
Yang et al[15]ChinaEastern1391654480156275281681101971310.5
Cui et al[16]South KoreaEastern22131700778105238254086329726081816194314570.13
De Re et al[17]ItalyWestern48961223133746134749120720.7324195335496729120720.08
Galvan-Portillo et al[18]MexicoWestern2484783713279892171722162903955610.17
Gotze et al[19]GermanyWestern10610646451241491613769131810.74
Zeybek et al[20]TurkeyEastern35144181256465154822193950.76
Vollset et al[21]Europea1Western24763110910432248277943221687734650.2710311625315246533221668763520.61
Mu et al[22]ChinaEastern1963975010638135199572061824693130.231474902751127343496621260.25
Zhang et al[23]PolandWestern30542714611633185178364081825482500.4813512531180179413951875392610.72
Boccia et al[24]ItalyWestern1022542951229811541109953111970.435043912510722143613571510.89
Fu et al[25]ChinaEastern1691699673012544026573294440.12
Graziano et al[26]ItalyWestern1621643486426768291541262021260.10
Li et al[27]ChinaEastern170140617831675617200140190900.321264229741229446235450.32
Weng et al[28]ChinaEastern38341419515118472941270.062612022111641255130.79
Kim et al[29]South KoreaEastern133445426427143239631481185253650.022983413081298230367451450.19
Si et al[30]ChinaEastern1221015848164943916480141610.92734455838519054154480.70
Sarbia et al[31]GermanyWestern33225513815341107115334292353291810.81
Bi et al[32]ChinaEastern309188139150209776154281902701060.99
Wang et al[33]ChinaEastern1293152545597414398951632913390.12
Stolzenberg-Solomon et al[34]ChinaEastern9039817363765209124701103394570.14692102941040159216921040.0032
Miao et al[35]ChinaEastern21746847107631512171002012335194170.181506433241395364707871490.022
Gao et al[36]ChinaEastern1072002261246399381051092251750.93
Shen et al[37]ChinaEastern1871665590426080262001742001320.9613055211150531559272600.83
Figure 1
Figure 1 Flowchart of the literature selection process.
Table 2 Distribution of MTHFR C677T and A1298C genotypes and alleles frequency in gastric cardia cancer, non-cardia cancer and controls.
Ref.Sample size
Genotypes distribution
Alleles frequency
CardiaNon-cardiaControlCardiaNon-cardiaControlCardiaNon-cardiaControl
MTHFR C677T polymorphismCCCTTTCCCTTTCCCTTTCTCTCT
Saberi et al[14]15221078077601599981342230850214902961241152408
Gotze et al[19]2776106131313332114149163915985413181
Graziano et al[26]43119164725112761316768293947115123202126
Weng et al[28]NA3834NA1419515118NA47294127
Sarbia et al[31]1192132556545973108321071153317563254172329181
Si et al[30]29931012171374115494394991157114161
Bi et al[32]1551541887473865771297761521189207101270106
Wang et al[33]129NA315254559NA741439895163NA291339
Stolzenberg-Solomon et al[34]90NA398173637NA6520912470110NA339457
Miao et al[35]217NA4684710763NA151217100201233NA519417
Shen et al[37]82105166223822335220608026828211892200132
MTHFR A1298C polymorphismAAACCCAAACCCAAACCCACACAC
Weng et al[28]NA3834NA2612022111NA64125513
Si et al[30]299310115122583235838542161483815448
Shen et al[37]821051666417166381111505145191704027260
Table 3 Distribution of MTHFR C677T and A1298C genotypes and alleles frequency in intestinal, diffuse gastric cancer and controls.
Ref.Sample size
Genotypes distribution
Alleles frequency
IntestinalDiffuseControlIntestinal
Diffuse
Control
Intestinal
Diffuse
Control
CCCTTTCCCTTTCCCTTTCTCTCT
MTHFR C677T polymorphism
Saberi et al[14]14280780695914393474223085019787112481152408
Galvan-Portillo et al[18]88152454503811339291163NANANA
Gotze et al[19]533710621248181544149166640512313181
Graziano et al[26]917116419472515391767682985976973202126
Table 4 Comparisons of MTHFR C677T and A1298C polymorphisms for whole and stratified analysis.
nCase/controlOR (95%CI)PPHeterogeneityOR (95%CI)PPHeterogeneityOR (95%CI)PPHeterogeneityOR (95%CI)PPHeterogeneity
(TT + CT)/CCT/CTT/CCTT/(CT + CC)
C677T
Total246266/82501.23 (1.08, 1.40)0.002< 0.00011.15 (1.06, 1.25)0.0010.00041.37 (1.15, 1.63)0.00050.00051.17 (1.07, 1.28)0.00080.01
Eastern164716/58391.26 (1.08, 1.47)0.0030.0021.21 (1.08, 1.34)0.00050.0021.42 (1.15, 1.76)0.0010.0051.22 (1.09, 1.35)0.00030.03
Western81550/24111.20 (0.92, 1.56)0.1800.0021.05 (0.91, 1.21)0.530.051.28 (0.91, 1.82)0.160.0091.05 (0.88, 1.25)0.550.11
Tumor site
Cardia
Total101043/29411.09 (0.81, 1.48)0.5600.00051.16 (0.95, 1.41)0.140.0021.28 (0.85, 1.95)0.240.0031.38 (1.15, 1.67)0.00060.05
Eastern7854/24161.16 (0.89, 1.52)0.2800.051.24 (1.04, 1.48)0.020.061.57(1.23, 2.00)0.00030.161.53 (1.25, 1.87)< 0.00010.31
Western3189/5251.09 (0.38, 3.12)0.8700.0011.00 (0.52, 1.91)1.000.0040.78 (0.15, 4.16)0.770.0030.73 (0.27, 1.99)0.540.07
Non-cardia
Total81008/17941.38 (1.18, 1.63)< 0.00010.421.24 (1.10, 1.40)0.00030.421.44 (1.09, 1.91)0.010.311.19 (0.93, 1.52)0.160.61
Eastern5600/12691.35 (1.10, 1.66)0.0040.991.21 (1.04, 1.41)0.010.871.30 (0.87, 1.95)0.200.481.10 (0.79, 1.55)0.570.44
Western3408/5251.41 (0.83, 2.38)0.4000.031.26 (0.91, 1.76)0.160.061.55 (0.86, 2.78)0.140.121.29 (0.91, 1.83)0.160.53
Lauren’s classification
Intestinal
Total4374/15041.46 (0.86, 2.47)0.1600.051.33 (0.97, 1.84)0.080.101.88 (1.22, 2.89)0.0040.191.45 (1.07, 1.95)0.020.76
Eastern1142/7801.25 (0.87,1.87)0.230NA1.25 (0.95, 1.64)0.12NA1.71 (0.90, 3.26)0.10NA1.60 (0.86, 2.97)0.14NA
Western3232/7241.61 (0.60,4.29)0.3400.031.37 (0.74, 2.52)0.320.042.01 (1.13, 3.59)0.020.071.41 (1.00, 1.98)0.050.58
Diffuse
Total4340/15041.31 (0.66,2.58)0.4400.031.19 (0.78, 1.82)0.420.061.46 (0.66, 3.21)0.350.130.94 (0.56, 1.58)0.820.09
Eastern180/7801.24 (0.78,1.96)0.360NA1.21 (0.85, 1.73)0.29NA1.51 (0.64, 3.57)0.34NA1.40 (0.61, 3.20)0.80NA
Western3260/7241.33 (0.35,5.01)0.6700.0081.14 (0.50, 2.60)0.760.021.31 (0.29, 5.83)0.720.040.85 (0.46, 1.55)0.590.1
A1298C(CC + AC)/AAC/ACC/AACC/(AC + AA)
Total112007/36790.98 (0.79, 1.21)0.8400.0080.97 (0.83, 1.14)0.730.030.95 (0.71, 1.28)0.760.600.95 (0.72, 1.27)0.750.78
Eastern71015/14520.96 (0.72, 1.29)0.7900.020.93 (0.73, 1.19)0.560.040.44 (0.21, 0.93)0.030.840.46 (0.22, 0.96)0.040
Western4702/14081.00 (0.71, 1.41)0.9900.041.07 (0.93, 1.23)0.360.151.13 (0.82, 1.57)0.460.691.11 (0.81, 1.51)0.530.98
Tumor site
Cardia
Total2111/2670.80 (0.37, 1.74)0.2400.130.83 (0.41, 1.69)0.610.100.76 (0.21, 2.83)0.690.280.80 (0.22, 2.93)0.730.36
Eastern2111/2670.80 (0.37, 1.74)0.2400.130.83 (0.41, 1.69)0.610.100.76 (0.21, 2.83)0.690.280.80 (0.22, 2.93)0.730.36
Western00NANANANA
Non-cardia
Total3236/3010.98 (0.69, 1.41)0.9300.590.93 (0.68, 1.26)0.620.690.45 (0.15, 1.40)0.170.860.46 (0.15, 1.40)0.170.82
Eastern3236/3010.98 (0.69, 1.41)0.9300.590.93 (0.68, 1.26)0.620.690.45 (0.15, 1.40)0.170.860.46 (0.15, 1.40)0.170.82
Western00NANANANA
Overall analysis

MTHFR C677T polymorphism and GC: Table 4 lists the main results of this meta-analysis. A total of 6266 cases and 8250 controls were identified for analysis of the association between the MTHFR C677T polymorphism and GC. The overall results showed that there was a significant association between C677T and GC [TT + CT vs CC: OR = 1.23 (1.08, 1.40), P = 0.002], and a T allele was associated with a 15.0% increased risk of GC compared to a C allele [T vs C: OR = 1.15 (1.06, 1.25), P = 0.001]. Similar results were obtained in the analysis for the additive model [TT vs CC: OR = 1.37 (1.15, 1.63), P = 0.0005] and the recessive model [TT vs CT + CC: OR = 1.17 (1.07, 1.28), P = 0.0008].

MTHFR A1298C polymorphism and GC: As shown in Table 4, 11 studies including a total of 2007 cases and 3679 controls were performed to analyze the relationship between the MTHFR A1298C polymorphism and GC. The risk for GC conferred by the MTHFR A1298C polymorphism did not reach significance under the four genetic models (P > 0.05).

Subgroup analysis

When stratifying the data by ethnicity, stronger significance between the MTHFR C677T polymorphism and GC was shown when restricted to eastern populations [TT + CT vs CC: OR = 1.26 (1.08, 1.47), P = 0.003; T vs C: OR = 1.21 (1.08, 1.34), P = 0.0005; TT vs CC: OR = 1.42 (1.15, 1.76), P = 0.001; TT vs CT + CC: OR = 1.22 (1.09, 1.35), P = 0.0003], although the result for western populations was not significant (Table 4). With regard to the A1298C polymorphism, the results showed that there was a significant association between the A1298C polymorphism and a decreased risk of GC in eastern populations in the additive and recessive models [CC vs AA: OR = 0.44 (0.21, 0.93), P = 0.03; CC vs AC + AA: OR = 0.46 (0.22, 0.96), P = 0.04] (Table 4).

Stratification analyses were performed to consider tumor sites. The results suggested that the MTHFR C677T polymorphism was significantly associated with an increased GC risk for both GCC [TT vs CT + CC: OR = 1.38 (1.15, 1.67), P = 0.0006] and NCGC [TT + CT vs CC: OR = 1.38 (1.18, 1.63), P < 0.0001; T vs C: OR = 1.24 (1.10, 1.40), P = 0.0003; TT vs CC: OR = 1.44 (1.09, 1.91), P = 0.01] in the whole population. When further analyzed by ethnicity, similar positive results were found only in eastern but not in western populations. We also obtained no significant results for the association between A1298C and both GCC and NCGC (Table 4).

In view of the Lauren classification, we divided the studies into two subgroups. The results showed that the MTHFR C677T polymorphism was significantly associated with an increased risk for intestinal-type GC [TT vs CC: OR = 1.88 (1.22, 2.89), P = 0.004; TT vs CT + CC: OR = 1.45 (1.07, 1.95), P = 0.02] in the whole population. When further analyzed by ethnicity, similar positive results were found only in western populations but not in eastern populations. No significant relationship was found between the MTHFR C677T polymorphism and diffuse-type GC (Table 4).

Relationships between GCC and NCGC, and intestinal-type and diffuse-type GC

When comparing GCC with NCGC, no significant results were observed in any of the four models for C677T or A1298C (Table 5), and ORs of 1.71 (95%CI: 1.13-2.59, P = 0.01) and 1.60 (95%CI: 1.09-2.35, P = 0.02) were found in the TT vs CC model in western populations and total populations, respectively, when comparing intestinal-type with diffuse-type GC for C677T. None of the other models produced significant results for eastern, western or overall populations (Table 5).

Table 5 Comparisons of MTHFR C677T and A1298C polymorphisms for gastric cardia and non-cardia cancers, intestinal-type and diffuse-type gastric cancers.
nCase/controlOR (95%CI)PPHeterogeneityOR (95%CI)PPHeterogeneityOR (95%CI)PPHeterogeneityOR (95%CI)PPHeterogeneity
C677T(TT + CT)/CCT/CTT/CCTT/(CT + CC)
Cardia and non-cardia
Total7607/9700.74 (0.51, 1.08)0.120.010.80 (0.59, 1.09)0.20.0020.82 (0.49, 1.38)0.460.010.71 (0.36, 1.39)0.310.06
Eastern4418/5620.76 (0.47, 1.21)0.240.040.85 (0.56, 1.27)0.40.011.04 (0.52, 2.06)0.910.050.89 (0.39, 2.03)0.780.10
Western3189/4080.75 (0.35, 1.61)0.460.040.73 (0.45, 1.20)0.20.050.59 (0.35, 1.00)0.050.080.52 (0.17, 1.59)0.250.26
Intestinal-type and diffuse-type
Total4374/3401.09 (0.74, 1.62)0.670.761.10 (0.84, 1.45)0.50.781.60 (1.09, 2.35)0.020.871.24 (0.68, 2.27)0.480.50
Eastern1142/801.01 (0.58, 1.74)0.98NA1.03 (0.68, 1.57)0.9NA1.14 (0.44, 2.95)0.79NA1.13 (0.42, 3.04)0.81NA
Western3232/2601.19 (0.68, 2.09)0.550.541.16 (0.81, 1.66)0.40.571.71 (1.13, 2.59)0.010.641.32 (0.62, 2.80)0.480.41
A1298C(CC + AC)/AAC/ACC/AACC/(AC + AA)
Cardia and non-cardia
Total2111/1980.83 (0.26, 2.64)0.750.030.90 (0.34, 2.34)0.80.031.87 (0.39, 9.03)0.440.591.85 (0.39, 8.69)0.430.75
Eastern2111/1990.83 (0.26, 2.64)0.750.030.90 (0.34, 2.34)0.80.031.87 (0.39, 9.03)0.440.591.85 (0.39, 8.69)0.430.75
Western00NANANANA
Sensitivity analysis and publication bias evaluation

A sensitivity analysis was performed by excluding one study each time to reflect the influence of the individual data set on the ORs; the analysis did not alter the pattern of the results (data not shown), which confirmed the stability of the above results. The funnel plot (data not shown) provided no evidence of publication bias. Consistent results were drawn from Begg’s and Egger’s tests.

DISCUSSION

Regarding the MTHFR C677T and A1298C polymorphisms and their association with GC, definite conclusions cannot be drawn. Therefore, we performed a meta-analysis to estimate the relationships between the two SNPs in the MTHFR gene and the risk of GC.

In the present meta-analysis, the overall analysis suggested that MTHFR 677TT and CT genotype carriers had a higher risk of developing GC; in addition, an elevated risk of GC was also found among the MTHFR 677T allele carriers. It is well known that individuals who are MTHFR 677T carriers have reduced MTHFR activity[10], and the low enzyme activity of MTHFR C677T variant genotypes is associated with DNA hypomethylation, which may induce genomic instability and thereby affect the expression of oncogenes or tumor suppressor genes, leading to the development of malignancies[45,46]. No significant association was found between the MTHFR A1298C polymorphism and overall GC risk; a possible explanation for which could be that the reduction of MTHFR functional activity caused by the A1298C mutation is significantly less than that caused by the C677T mutation[9].

In subgroup analyses stratified by the ethnicity, gastric tumor site and Lauren classification, we found that the MTHFR C677T polymorphism was associated with susceptibility to both GCC and NCGC in eastern populations compared with controls. No positive association was found between the MTHFR C677T polymorphism and the risk of intestinal or diffuse types of GC compared with controls. With regard to the A1298C polymorphism, we found that the CC genotype conferred protection against GC in eastern but not in Western populations; however, the inconsistent results among Western and Eastern populations are difficult to explain. Moreover, irrespective of comparison with controls or diffuse-type GC, a positive association was found that the C677TT polymorphism increased the risk of intestinal-type GC in the whole population and in the western population. No significant difference was found between GCC and NCGC. Because a small sample size was included, this conclusion remains to be confirmed. To the best of our knowledge, the distribution of the MTHFR polymorphism differs among various ethnic populations[47], which may have led to the different results for eastern and western populations.

Although several related meta-analyses have been published previously[38-44], our current research still has some advantages. First, because it involved 26 studies conforming to HWE and provided 6390/8515 cases/controls, our meta-analysis included a larger number of studies than the previous studies, and the results are more reliable. Second, our study is the first to include stratification according to tumor site and Lauren classification.

There was a certain degree of heterogeneity among the studies assessed here, which may be attributed to design quality, sample size, noncomparable measures of genotyping, and variation of the covariate. To clarify the sources of heterogeneity, we conducted a sensitivity analysis, and this analysis confirmed the stability of the null association between MTHFR polymorphisms and GC after excluding any one study at a time.

No significant publication bias was found herein given the symmetry shown in the funnel plots, and consistent results were drawn from Begg’s and Egger’s tests (data not shown). Nevertheless, unpublished data from conference abstracts and dissertations and unpublished pharmaceutical company data were not extracted, which could introduce a distinct possibility of publication bias. Moreover, we followed the inclusion and exclusion criteria strictly to reduce selection bias. In addition, the test of HWE for the distribution of the genotypes in the control groups suggested that there were no individuals with significantly aberrant genetic backgrounds among the participants.

Nevertheless, this meta-analysis had several limitations that may have affected the conclusions. First, we selected only the MTHFR C677T and A1298C polymorphisms because these were the most extensively studied polymorphisms, although several other SNPs in the MTHFR gene have been identified. Meta-analyses that investigate the association of other polymorphisms in the MTHFR gene with GC should be performed in the future. Second, study design, small sample size and environmental factors may have affected the results; many studies did not use an appropriate design or neglected to consider important environmental factors. Third, the results drawn from subgroup analyses might be limited because of the small sample size. Moreover, it was difficult to obtain full papers published in various languages; we included studies published only in English and Chinese.

In summary, data from our meta-analysis support that the MTHFR C677T polymorphism increases the risk of developing GC in the general population, as well as the risk of GCC and NCGC in eastern populations and intestinal-type GC in western populations. The A1298C polymorphism may be a protective factor against GC in eastern populations. GC is a disease resulting from complex interactions between genes and the environment. Therefore, further well-designed studies with larger sample sizes should be performed to assess other genetic and environmental factors in the development of GC.

COMMENTS
Background

Currently, the incidence of gastric cancer (GC) has decreased worldwide, but it remains the fourth most common cancer diagnosis in men, and the fifth in women, and the second leading cause of cancer-related death. Methylenetetrahydrofolate reductase (MTHFR) encodes a 77-kDa protein that plays a key role in DNA methylation. Many studies have explored the association between MTHFR polymorphisms and GC risk, but the results remain either controversial or inconclusive. Consequently, the authors performed a meta-analysis to clarify the role of MTHFR polymorphisms in GC susceptibility among the eligible studies.

Research frontiers

Until now, many studies have reported associations of MTHFR polymorphisms with susceptibility to GC; however, the results have been inconsistent and inconclusive.

Innovations and breakthroughs

This meta-analysis indicates that the MTHFR C677T polymorphism is a risk factor in GC and that the A1298C polymorphism may be a protective factor against GC in eastern populations. Moreover, this study is the first to include stratification according to tumor site and Lauren classification.

Applications

This meta-analysis showed that the C677T and A1298C polymorphisms of the MTHFR gene could alter susceptibility to GC. The findings may provide valuable information about the etiology of GC for both researchers and clinicians.

Terminology

MTHFR encodes a 77-kDa protein that plays a key role in folate metabolism by irreversibly catalyzing the reduction of 5, 10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, the predominant circulatory form of folate, which serves as both a cofactor and substrate for the regeneration of methionine. The latter leads to the production of S-adenosylmethionine (SAM), the universal methyl donor in humans for DNA methylation. Reduced enzyme activity may result in lower levels of SAM and an increased risk of cancer, including GC, as a consequence of gene hypomethylation.

Peer review

This meta-analysis was a well-written and well-conducted study that evaluated the association of MTHFR polymorphisms with susceptibility to gastric cancer. It had a large sample size, which allowed consistent conclusions in relation to the general population. Additionally, this study is the first to include stratification according to gastric cancer location and histological subtype. It is important to review these relevant reports systematically.

References
1.  Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61:69-90.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23200]  [Cited by in RCA: 24570]  [Article Influence: 1638.0]  [Reference Citation Analysis (8)]
2.  Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010;127:2893-2917.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12151]  [Cited by in RCA: 11520]  [Article Influence: 720.0]  [Reference Citation Analysis (11)]
3.  Crew KD, Neugut AI. Epidemiology of gastric cancer. World J Gastroenterol. 2006;12:354-362.  [PubMed]  [DOI]
4.  Muñoz N, Franceschi S. Epidemiology of gastric cancer and perspectives for prevention. Salud Publica Mex. 1997;39:318-330.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 27]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
5.  Goyette P, Sumner JS, Milos R, Duncan AM, Rosenblatt DS, Matthews RG, Rozen R. Human methylenetetrahydrofolate reductase: isolation of cDNA mapping and mutation identification. Nat Genet. 1994;7:551.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 566]  [Cited by in RCA: 543]  [Article Influence: 17.0]  [Reference Citation Analysis (0)]
6.  Rozen R. Genetic predisposition to hyperhomocysteinemia: deficiency of methylenetetrahydrofolate reductase (MTHFR). Thromb Haemost. 1997;78:523-526.  [PubMed]  [DOI]
7.  Kim YI. Methylenetetrahydrofolate reductase polymorphisms, folate, and cancer risk: a paradigm of gene-nutrient interactions in carcinogenesis. Nutr Rev. 2000;58:205-209.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 88]  [Cited by in RCA: 85]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
8.  Stern LL, Mason JB, Selhub J, Choi SW. Genomic DNA hypomethylation, a characteristic of most cancers, is present in peripheral leukocytes of individuals who are homozygous for the C677T polymorphism in the methylenetetrahydrofolate reductase gene. Cancer Epidemiol Biomarkers Prev. 2000;9:849-853.  [PubMed]  [DOI]
9.  van der Put NM, Gabreëls F, Stevens EM, Smeitink JA, Trijbels FJ, Eskes TK, van den Heuvel LP, Blom HJ. A second common mutation in the methylenetetrahydrofolate reductase gene: an additional risk factor for neural-tube defects? Am J Hum Genet. 1998;62:1044-1051.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1106]  [Cited by in RCA: 1116]  [Article Influence: 39.9]  [Reference Citation Analysis (0)]
10.  Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, Matthews RG, Boers GJ, den Heijer M, Kluijtmans LA, van den Heuvel LP. A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Nat Genet. 1995;10:111-113.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4266]  [Cited by in RCA: 3902]  [Article Influence: 125.9]  [Reference Citation Analysis (0)]
11.  Weisberg I, Tran P, Christensen B, Sibani S, Rozen R. A second genetic polymorphism in methylenetetrahydrofolate reductase (MTHFR) associated with decreased enzyme activity. Mol Genet Metab. 1998;64:169-172.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 917]  [Cited by in RCA: 909]  [Article Influence: 32.5]  [Reference Citation Analysis (0)]
12.  Gao S, Ding LH, Wang JW, Li CB, Wang ZY. Diet folate, DNA methylation and polymorphisms in methylenetetrahydrofolate reductase in association with the susceptibility to gastric cancer. Asian Pac J Cancer Prev. 2013;14:299-302.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 27]  [Cited by in RCA: 22]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
13.  Guo W, Chen P, Zheng LH, Li S. Association between methylenetetrahydrofolate reductase gene polymorphisms (C677T and G1793A) and risk of gastric cancer. Shijie Huaren Xiaohua Zazhi. 2012;20:690-693.  [PubMed]  [DOI]
14.  Saberi S, Zendehdel K, Jahangiri S, Talebkhan Y, Abdirad A, Mohajerani N, Bababeik M, Karami N, Esmaili M, Oghalaie A. Impact of methylenetetrahydrofolate reductase C677T polymorphism on the risk of gastric cancer and its interaction with Helicobacter pylori infection. Iran Biomed J. 2012;16:179-184.  [PubMed]  [DOI]
15.  Yang XX, Li F, Yi JP, Li X, Sun JZ, Hu NY. Methylenetetrahydrofolate reductase C677T polymorphism in patients with gastric, colorectal and lung cancer. Guangdong Yixue. 2010;31:2375-2378.  [PubMed]  [DOI]
16.  Cui LH, Shin MH, Kweon SS, Kim HN, Song HR, Piao JM, Choi JS, Shim HJ, Hwang JE, Kim HR. Methylenetetrahydrofolate reductase C677T polymorphism in patients with gastric and colorectal cancer in a Korean population. BMC Cancer. 2010;10:236.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 36]  [Cited by in RCA: 40]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
17.  De Re V, Cannizzaro R, Canzonieri V, Cecchin E, Caggiari L, De Mattia E, Pratesi C, De Paoli P, Toffoli G. MTHFR polymorphisms in gastric cancer and in first-degree relatives of patients with gastric cancer. Tumour Biol. 2010;31:23-32.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 20]  [Cited by in RCA: 24]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
18.  Galván-Portillo MV, Cantoral A, Oñate-Ocaña LF, Chen J, Herrera-Goepfert R, Torres-Sanchez L, Hernandez-Ramirez RU, Palma-Coca O, López-Carrillo L. Gastric cancer in relation to the intake of nutrients involved in one-carbon metabolism among MTHFR 677 TT carriers. Eur J Nutr. 2009;48:269-276.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 31]  [Cited by in RCA: 33]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
19.  Götze T, Röcken C, Röhl FW, Wex T, Hoffmann J, Westphal S, Malfertheiner P, Ebert MP, Dierkes J. Gene polymorphisms of folate metabolizing enzymes and the risk of gastric cancer. Cancer Lett. 2007;251:228-236.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 31]  [Article Influence: 1.6]  [Reference Citation Analysis (1)]
20.  Zeybek U, Yaylim I, Yilmaz H, Ağaçhan B, Ergen A, Arikan S, Bayrak S, Isbir T. Methylenetetrahydrofolate reductase C677T polymorphism in patients with gastric and colorectal cancer. Cell Biochem Funct. 2007;25:419-422.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 25]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
21.  Vollset SE, Igland J, Jenab M, Fredriksen A, Meyer K, Eussen S, Gjessing HK, Ueland PM, Pera G, Sala N. The association of gastric cancer risk with plasma folate, cobalamin, and methylenetetrahydrofolate reductase polymorphisms in the European Prospective Investigation into Cancer and Nutrition. Cancer Epidemiol Biomarkers Prev. 2007;16:2416-2424.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 49]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
22.  Mu LN, Cao W, Zhang ZF, Yu SZ, Jiang QW, You NC, Lu QY, Zhou XF, Ding BG, Chang J. Polymorphisms of 5,10-methylenetetralydrofolate reductase (MTHFR), fruit and vegetable intake, and the risk of stomach cancer. Biomarkers. 2007;12:61-75.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 20]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
23.  Zhang FF, Terry MB, Hou L, Chen J, Lissowska J, Yeager M, Zatonski W, Chanock S, Morabia A, Chow WH. Genetic polymorphisms in folate metabolism and the risk of stomach cancer. Cancer Epidemiol Biomarkers Prev. 2007;16:115-121.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 38]  [Cited by in RCA: 40]  [Article Influence: 2.1]  [Reference Citation Analysis (0)]
24.  Boccia S, Gianfagna F, Persiani R, La Greca A, Arzani D, Rausei S, D’ugo D, Magistrelli P, Villari P, Van Duijn CM. Methylenetetrahydrofolate reductase C677T and A1298C polymorphisms and susceptibility to gastric adenocarcinoma in an Italian population. Biomarkers. 2007;12:635-644.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 24]  [Cited by in RCA: 30]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
25.  Fu G, Yang FY, Shen XB, PU YP, Zhang J. Relationship between the Methylenetetrahydrofolate Reductase A1298C Genetic Polymorphisms and Susceptibility to Gastric Cancer. J Environ Occup Med. 2007;24:32-35.  [PubMed]  [DOI]
26.  Graziano F, Kawakami K, Ruzzo A, Watanabe G, Santini D, Pizzagalli F, Bisonni R, Mari D, Floriani I, Catalano V. Methylenetetrahydrofolate reductase 677C/T gene polymorphism, gastric cancer susceptibility and genomic DNA hypomethylation in an at-risk Italian population. Int J Cancer. 2006;118:628-632.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 53]  [Cited by in RCA: 53]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
27.  Li S, Cai MJ, Hou P, He NY. Single nucleotide polymorphisms (C677T and A1298C) in methylenetetrahy 2 drofolate reductase gene and suscepcipility to gastric carcinoma. Dongnan Daxue Xuebao. 2006;25:321-324.  [PubMed]  [DOI]
28.  Weng YR, Sun DF, Fang JY, Gu WQ, Zhu HY. Folate levels in mucosal tissue but not methylenetetrahydrofolate reductase polymorphisms are associated with gastric carcinogenesis. World J Gastroenterol. 2006;12:7591-7597.  [PubMed]  [DOI]
29.  Kim JK, Kim S, Han JH, Kim HJ, Chong SY, Hong SP, Hwang SG, Ahn JY, Cha KY, Oh D. Polymorphisms of 5,10-methylenetetrahydrofolate reductase and risk of stomach cancer in a Korean population. Anticancer Res. 2005;25:2249-2252.  [PubMed]  [DOI]
30.  Si PR, Fang DC, Zhang H, Yang LQ, Luo YH, Liao HY. The relationship between metbylenetetrahydrofolate reductase gene polymorphism and microsatellite instability in gastric cancer. Zhonghua Liuxingbing Zazhi. 2005;26:794-799.  [PubMed]  [DOI]
31.  Sarbia M, Geddert H, Kiel S, Kandemin Y, Schulz WA, Vossen S, Zotz RD, Willers R, Baldus SE, Schneider PM. Methylenetetrahydrofolate reductase C677T polymorphism and risk of adenocarcinoma of the upper gastrointestinal tract. Scand J Gastroenterol. 2005;40:109-111.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 17]  [Article Influence: 0.8]  [Reference Citation Analysis (1)]
32.  Bi JP, Cai L, Zheng ZL. Study on C667T gene polymorphism and susceptibility to gastric cancer. Zhongguo Gonggong Weisheng. 2005;21:661-663.  [PubMed]  [DOI]
33.  Wang LD, Guo RF, Fan ZM, He X, Gao SS, Guo HQ, Matsuo K, Yin LM, Li JL. Association of methylenetetrahydrofolate reductase and thymidylate synthase promoter polymorphisms with genetic susceptibility to esophageal and cardia cancer in a Chinese high-risk population. Dis Esophagus. 2005;18:177-184.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 40]  [Cited by in RCA: 40]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
34.  Stolzenberg-Solomon RZ, Qiao YL, Abnet CC, Ratnasinghe DL, Dawsey SM, Dong ZW, Taylor PR, Mark SD. Esophageal and gastric cardia cancer risk and folate- and vitamin B(12)-related polymorphisms in Linxian, China. Cancer Epidemiol Biomarkers Prev. 2003;12:1222-1226.  [PubMed]  [DOI]
35.  Miao X, Xing D, Tan W, Qi J, Lu W, Lin D. Susceptibility to gastric cardia adenocarcinoma and genetic polymorphisms in methylenetetrahydrofolate reductase in an at-risk Chinese population. Cancer Epidemiol Biomarkers Prev. 2002;11:1454-1458.  [PubMed]  [DOI]
36.  Gao CM, Wu JZ, Ding JH, Liu YT, Zang Y, Li SP, Su P, Hu X, Xu TL. Polymorphisms of methylenetetrahydrofolate reductase C677T and the risk of stomach cancer. Zhonghua Liuxingbing Zazhi. 2002;23:289-292.  [PubMed]  [DOI]
37.  Shen H, Xu Y, Zheng Y, Qian Y, Yu R, Qin Y, Wang X, Spitz MR, Wei Q. Polymorphisms of 5,10-methylenetetrahydrofolate reductase and risk of gastric cancer in a Chinese population: a case-control study. Int J Cancer. 2001;95:332-336.  [PubMed]  [DOI]  [Full Text]
38.  Dong X, Wu J, Liang P, Li J, Yuan L, Liu X. Methylenetetrahydrofolate reductase C677T and A1298C polymorphisms and gastric cancer: a meta-analysis. Arch Med Res. 2010;41:125-133.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 27]  [Article Influence: 1.7]  [Reference Citation Analysis (1)]
39.  Boccia S, Hung R, Ricciardi G, Gianfagna F, Ebert MP, Fang JY, Gao CM, Götze T, Graziano F, Lacasaña-Navarro M. Meta- and pooled analyses of the methylenetetrahydrofolate reductase C677T and A1298C polymorphisms and gastric cancer risk: a huge-GSEC review. Am J Epidemiol. 2008;167:505-516.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 87]  [Cited by in RCA: 81]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
40.  Zintzaras E. Association of methylenetetrahydrofolate reductase (MTHFR) polymorphisms with genetic susceptibility to gastric cancer: a meta-analysis. J Hum Genet. 2006;51:618-624.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 57]  [Cited by in RCA: 53]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
41.  Larsson SC, Giovannucci E, Wolk A. Folate intake, MTHFR polymorphisms, and risk of esophageal, gastric, and pancreatic cancer: a meta-analysis. Gastroenterology. 2006;131:1271-1283.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 219]  [Cited by in RCA: 181]  [Article Influence: 9.1]  [Reference Citation Analysis (0)]
42.  Lv L, Wang P, Sun B, Chen G. The polymorphism of methylenetetrahydrofolate reductase C677T but not A1298C contributes to gastric cancer. Tumour Biol. 2014;35:227-237.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 7]  [Article Influence: 0.5]  [Reference Citation Analysis (2)]
43.  Zacho J, Yazdanyar S, Bojesen SE, Tybjærg-Hansen A, Nordestgaard BG. Hyperhomocysteinemia, methylenetetrahydrofolate reductase c.677C > T polymorphism and risk of cancer: cross-sectional and prospective studies and meta-analyses of 75,000 cases and 93,000 controls. Int J Cancer. 2011;128:644-652.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 43]  [Cited by in RCA: 43]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
44.  Yan S, Xu D, Wang P, Wang P, Liu C, Hua C, Jiang T, Zhang B, Li Z, Lu L. MTHFR C677T polymorphism contributes to the risk for gastric cancer. Tumour Biol. 2014;35:2123-2132.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 4]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
45.  Solomon E, Borrow J, Goddard AD. Chromosome aberrations and cancer. Science. 1991;254:1153-1160.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 409]  [Cited by in RCA: 388]  [Article Influence: 11.1]  [Reference Citation Analysis (0)]
46.  Laird PW, Jaenisch R. The role of DNA methylation in cancer genetic and epigenetics. Annu Rev Genet. 1996;30:441-464.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 358]  [Cited by in RCA: 337]  [Article Influence: 11.2]  [Reference Citation Analysis (0)]
47.  Botto LD, Yang Q. 5,10-Methylenetetrahydrofolate reductase gene variants and congenital anomalies: a HuGE review. Am J Epidemiol. 2000;151:862-877.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 688]  [Cited by in RCA: 685]  [Article Influence: 26.3]  [Reference Citation Analysis (8)]
Footnotes

P- Reviewer: Jonaitis L, Santos JS, Zhang SN S- Editor: Gou SX L- Editor: Kerr C E- Editor: Zhang DN

Write to the Help Desk