BPG is committed to discovery and dissemination of knowledge
Clinical Articles Open Access
©The Author(s) 1996. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Sep 15, 1996; 2(3): 179-181
Published online Sep 15, 1996. doi: 10.3748/wjg.v2.i3.179
Effect of interferon in combination with ribavirin on the plus and minus strands of HCV RNA in patients with chronic hepatitis C
Yong-Wen He, Wei Liu, Ling-Lan Ren, Kai-Jin Xiong, Duan-De Luo, Department of Infectious Diseases, Union Hospital, Tong Ji Medical University, Wuhan 430022, Hubei Province, China
Yong-Wen He, Professor of Internal Medicine, having 23 papers published.
Author contributions: All authors contributed equally to the work.
Supported by the Science Foundation of the Education Committee of China (1990) 360.
Correspondence to: Dr. Yong-Wen He, Professor, Department of Infectious Diseases, Union Hospital, Tong Ji Medical University, Wuhan 430022, Hubei Province, China
Telephone: +86-27-5807711-512
Received: July 25, 1996
Revised: August 5, 1996
Accepted: August 24, 1996
Published online: September 15, 1996

Abstract

AIM: To probe the effect of interferon in combination with ribavirin on the plus and minus strands of hepatitis C virus RNA (HCV RNA).

METHODS: Twenty-three cases diagnosed as chronic hepatitis C (CHC), according to positive HCV RNA/anti-HCV, fluctuating levels of aminotransferase activities (< 1 year), and absence of other hepatitis virus marker, were studied. Among them, 13 patients received combined antiviral therapy (subcutaneous injection of 3 MU of interferon-α three times per week for 3 months and intravenous drip of 1 g of ribavirin per day during the first month of treatment with interferon), and 10 patients received single interferon therapy, as described above, as control. The plus and minus strands of HCV RNA in sera and peripheral blood mononuclear cells (PBMCs) of these patients were tested by nested reverse transcription-polymerase chain reaction (nested RT-PCR).

RESULTS: At the end of therapy, the abnormal alanine amino-transferase (ALT) levels decreased to normal range in nine (69.23%) cases in the combined antiviral group. Of them, five (55.56%) experienced post-therapy relapse, and four (44.44%) were complete responders. In the interferon group, ALT decreased to normal in six (60%) cases, of which, four (66.67%) had post-therapy relapse and two (33.33%) were complete responders. The differences between the two groups were not significant (P < 0.05). At the end of therapy, the positive rate of the plus strand in sera decreased from 92.30% to 38.46% (P < 0.05) and that of the minus strand in PBMCs from 76.92% to 38.46% (P < 0.05) in the combined antiviral group. In the interferon only group, the former decreased from 100% to 50% (P < 0.05) and the latter, from 90% to 40% (P < 0.05). Again, no significant differences were found between groups (P < 0.05). Relapse occurred in patients whose plus strand HCV RNA in PBMCs remained after treatment.

CONCLUSION: Ribavirin did not enhance the antiviral effect of interferon when the plus and minus strands of HCV RNA were measured. The absence of HCV RNA in serum does not mean complete clearance of HCV, and its value for evaluating antiviral effects and prognosis is limited. Therefore, it is essential to measure the plus and minus strands of HCV RNA in sera and PBMCs simultaneously.

Key Words: hepatitis C; RNA, viral; interferon-alpha; antiviral agents



INTRODUCTION

Recently, interferon has been used to treat chronic hepatitis C (CHC). Abnormal alanine aminotransferase (ALT) levels become normal in 50%-70% of treated patients, and replication of hepatitis C virus (HCV) RNA in these patients is suppressed to various degrees[1]. However, approximately 50% of CHC patients experienced post-therapy relapse after interferon withdrawal[2]. Whether the therapeutic effect of combination of antiviral drugs is superior to monotherapy is rarely reported. In this study, we used interferon in combination with ribavirin to treat patients with CHC and investigated the effect of the combined antiviral therapy on the plus and minus strands of HCV RNA in sera and peripheral blood mononuclear cells (PBMCs) using nested reverse transcription polymerase chain reaction (RT-PCR) and serum ALT.

MATERIALS AND METHODS
Subjects

Twenty-three patients with CHC (29 to 55 years old, nine male and 14 female) were studied. All patients had positive HCV RNA/anti-HCV and fluctuating levels of aminotransferase activities (> 1 year) and did not have any hepatitis B virus (HBV) related markers, positive anti-hepatitis E virus (HEV), and anti-hepatitis A virus (HAV) immunoglobulin (Ig)M. Chronic active hepatitis (CAH) was confirmed in eight of the HCV patients by biopsy. Thirteen of them received the combined antiviral therapy, i.e., interferon plus ribavirin (I + R group), which consisted of subcutaneous injection of 3 MU of interferon-α (α-2b interferon, Schering Corporation, Kenilworth, NJ, United States) three times per week for 3 mo and intravenous drip of 1 g of ribavirin (Wuhan Second Pharmaceutical Factory, Wuhan, China) per day during the first month of interferon therapy. The remaining 10 patients received single interferon therapy, as described, as control (IFN group). Serum ALT and plus and minus strands of HCV RNA in sera and PBMCs in all patients were detected before therapy, at the end of therapy, and 24 wk after therapy.

Primers

Primer sequences were selected from the highly conserved 5’ noncoding region of the HCV RNA and were synthesized by the Institute of Immunology, Essen University, Germany. Two outer primers were sense: r-kf-10, 5’GGCGACACTCCACCATAGAT and antisense: r-kf-11c, 5’GGTGCACGGTCTACGAGACC. The inner sense primer was r-kf-15: 5’GGAGGATCCACTCCCCTGT, and the antisense primer was r-kf-16a: 5’ GGAAAGCTTGAATTCACCCTATCAGGCAGT. The size of the expected amplification product was 295 bp.

Nested RT-PCR

PBMCs were separated by density gradient centrifugation on ficoll hypaque from 4 mL EDTA blood samples and then washed three times in 10 mL of 0.9% NaCl. The extraction of HCV RNA in sera and PBMCs and the synthesis of complementary DNA (cDNA) of the plus and minus strands of HCV RNA were performed, as described previously[3]. Three microliters of cDNA were added to 25 μL of PCR reaction mixture and amplified for 40 cycles. Next, 3 μL of the first PCR products were added to 25 μL of the second PCR reaction mixture, with inner primer instead of outer primers, and nested RT-PCR was performed in the same way as described above.

Judgement of antiviral effect

The patients were divided into three groups based on changes of HCV RNA and ALT levels before and after antiviral therapy. Patients whose sera ALT level and status of HCV RNA had not changed after antiviral therapy were named nonresponders (NR). Patients whose ALT level decreased to within the normal range, whose plus and/or minus strands of HCV RNA became negative at the end of the treatment, and who experienced post therapy relapse 24 wk after therapy were named short-term responders (SR). The third group consisted of complete responders (CR), who had sustained normal ALT levels and had undetectable plus and/or minus strands not only at the end of therapy but also 24 wk after cessation of the therapy.

Statistics

Chi-square test was used to statistically analyze the percentages. P < 0.05 was considered significant.

RESULTS
Dynamics of ALT levels before and after antiviral therapy

A 295 bp fragment was found in the positive blood samples from the cases and the positive control serum but not in the negative control serum, which was an aliquot from the last wash of PBMCs and PCR reaction mixture without cDNA or primer.

The results (Table 1) showed that by the end of treatment, the increase in ALT levels in nine (69.23%) cases in the I+R group were restored to within the normal range, which took an average of 23.8 days. Of the nine cases, five (55.56%) were SR and four were CR. In the IFN group, the ALT level of six (60.00%) cases decreased to normal, taking an average of 29.6 days. Four (66.67%) of the six cases were SR and two (33.33%) were CR. There were no significant differences between the two groups (P > 0.05).

Table 1 The results of alanine aminotransferase (ALT) and hepatitis C virus (HCV) RNA before and after treatment.
CasesTypeBiopsyTherapeuticeffectBefore therapy
End of therapy
24 wk after therapy
HCV
RNA
ALT
HCV
RNA
ALT
HCV
RNA
ALT
SerumPBMCU/LSerumPBMCU/LSerumPBMCU/L
1 IFNCHCNTNR+ (-)+ (+)230+ (-)+ (+)77+ (-)+ (+)112
2 IFNCHCNTNR+ (-)+ (+)146+ (-)+ (+)68+ (-)+ (+)57
3 IFNCHCCAHNR+ (-)+ (+)60+ (-)+ (+)50+ (-)+ (+)88
4 IFNCHCNTNR+ (-)+ (+)126+ (-)+ (-)46+ (-)+ (+)97
5 IFNCHCCAHSR+ (-)+ (+)175- (-)+ (-)25+ (-)+ (+)92
6 IFNCHCNTSR+ (-)- (-)108- (-)+ (-)38+ (-)+ (-)66
7 IFNCHCNTSR+ (-)+ (+)88+ (-)+ (-)30+ (-)+ (+)120
8 IFNCHCCAHSR+ (-)+ (+)105- (-)- (+)40+ (-)+ (+)68
9 IFNCHCNTCR+ (-)+ (+)200- (-)- (-)28- (-)- (-)27
10 IFNCHCCAHCR+ (-)+ (+)220- (-)- (-)30- (-)- (-)40
11 I+RCHCNTNR+ (-)+ (+)166+ (-)+ (+)188+ (-)+ (+)100
12 I+RCHCNTNR+ (-)+ (+)250+ (-)+ (+)142+ (-)+ (+)320
13 I+RCHCCAHNR+ (-)+ (+)98+ (-)+ (+)66+ (-)+ (+)146
14 I+RCHCCAHNR+ (-)+ (+)125- (-)- (+)55- (-)- (+)70
15 I+RCHCNTSR+ (-)+ (+)241- (-)+ (-)26- (-)- (-)67
16 I+RCHCNTSR+ (-)+ (+)225+ (-)- (+)31+ (-)+ (-)560
17 I+RCHCCAHSR+ (-)- (-)290- (-)+ (-)20+ (-)+ (-)50
18 I+RCHCNTSR+ (-)+ (+)90+ (-)+ (-)34+ (-)+ (+)60
19 I+RCHCNTSR+ (-)+ (+)110- (-)+ (-)32+ (-)+ (+)72
20 I+RCHCNTCR+ (-)- (-)450- (-)- (-)16- (-)- (-)34
21 I+RCHCNTCR+ (-)+ (+)140- (-)- (-)36- (-)- (-)40
22 I+RCHCNTCR+ (-)+ (+)204- (-)- (-)30- (-)- (-)28
23 I+RCHCCAHCR+ (-)- (-)200- (-)- (-)28- (-)- (-)28
The effect of antiviral therapy on the plus and minus strands of HCV RNA

The minus strand of HCV RNA in sera was negative in all patients. At the end of therapy in the I+R group, the positive rate of the plus strand in sera (92.31%) decreased to 38.46% (P < 0.05) and that of the minus strand in PBMCs (76.92%) decreased to 38.46% (P < 0.05). In the IFN group, the former decreased from 100% to 50% (P < 0.05) and the latter from 90% to 40% (P < 0.05). Although the results indicated that antiviral therapy suppressed the reproduction of HCV, the differences between the two groups were not significant (P > 0.05). Regarding the percentage of HCV RNA turned negative at the end of the therapy in the I + R group (Table), we found that if the plus strand of HCV RNA in sera alone was tested, HCV RNA of seven (58.33%) cases turned negative; and if the plus and minus strands of HCV RNA in sera and PBMCs were simultaneously tested, HCV RNA of only four (30.77%) cases became negative. Regarding the relationship between HCV RNA and relapse, we found that if the plus strand of HCV RNA in sera alone was tested, HCV RNA of three out of five patients who had relapsed turned negative. When the plus and minus strands of HCV RNA in PBMCs were simultaneously detected, the plus strand of HCV RNA of four out of five and the minus strand of HCV RNA of one out of the five patients remained positive. These data indicate that the plus strand of HCV RNA in the sera of the three cases turned negative and that HCV was actually not cleared. In contrast, the four cases whose plus and minus strands of HCV RNA in sera and PBMCs remained negative 24 wk after the treatment, no post-therapy relapse occurred.

DISCUSSION

It is now clear that when HCV is replicated, a minus strand of HCV RNA, i.e., the replicative form of HCV RNA, can be detected[4,5]. Here, we showed that interferon in combination with ribavirin made the replicative form of HCV RNA negative in more than 50% of patients with CHC, confirming that combined antiviral therapy suppressed the replication of HCV. About half of the responders, as defined as those in whom the plus strand of HCV RNA in sera became negative, had relapse after interruption of the treatment. In these patients, however, the plus strand in PBMCs remained positive during and after treatment. Importantly, in the cases that did not have relapse, the plus and minus strands of HCV RNA in sera and PBMCs were both negative, indicating that (1) the absence of HCV RNA in serum did not mean complete clearance of HCV, and its lack of detection was due primarily to the low serum concentration of HCV following antiviral therapy that suppressed the replication of HCV; and (2) HCV in extrahepatic sites, such as PBMC,s is difficult to eliminate, which might serve as a source of reinfection of the liver[6] and might be one of the causes of relapse. It has been suggested that the value of the plus strand of HCV RNA in sera alone for evaluating the antiviral effect and prognosis is limited. Therefore, it is essential to measure the plus and minus strands of HCV RNA in sera and PBMCs simultaneously to identify complete clearance of HCV.

Falling serum ALT levels means a reduction of hepatocellular damage, which might be related to the ability of antiviral therapy to suppress the replication of HCV or to eliminate HCV. Thus, diminishing or eradicating the viral load of the liver may improve liver disease[2].

Although the percentage of and average time for restoring ALT levels to the normal range and the percentage of HCV RNA turned negative in the I + R group were slightly better than those in the IFN group, the differences were not statistically significant. The reasons for this lack of significance might be that (1) the course of treatment with ribavirin was too short or the dosage of ribavirin was too small; and (2) ribavirin could not enhance the antiviral effect of interferon.

ACKNOWLEDGEMENT

We thank Dr. Ferencik S of the Institute of Immunology, University Hospital of Essen, Federal Republic of Germany, for supplying us with primers and other reagents.

References
1.  Diodati G, Bonetti P, Noventa F, Casarin C, Rugge M, Scaccabarozzi S, Tagger A, Pollice L, Tremolada F, Davite C. Treatment of chronic hepatitis C with recombinant human interferon-alpha 2a: results of a randomized controlled clinical trial. Hepatology. 1994;19:1-5.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 43]  [Cited by in RCA: 36]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
2.  Gil B, Qian C, Riezu-Boj JI, Civeira MP, Prieto J. Hepatic and extrahepatic HCV RNA strands in chronic hepatitis C: different patterns of response to interferon treatment. Hepatology. 1993;18:1050-1054.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 44]  [Cited by in RCA: 38]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
3.  He Y, Liu W, Zeng L. [The effect of interferon in combination with ribavirin on the plus and minus strands of hepatitis C virus RNA in patients with hepatitis]. Zhonghua Neike Zazhi. 1996;35:32-35.  [PubMed]  [DOI]
4.  Fong TL, Shindo M, Feinstone SM, Hoofnagle JH, Di Bisceglie AM. Detection of replicative intermediates of hepatitis C viral RNA in liver and serum of patients with chronic hepatitis C. J Clin Invest. 1991;88:1058-1060.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 147]  [Cited by in RCA: 147]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
5.  Bouffard P, Hayashi PH, Acevedo R, Levy N, Zeldis JB. Hepatitis C virus is detected in a monocyte/macrophage subpopulation of peripheral blood mononuclear cells of infected patients. J Infect Dis. 1992;166:1276-1280.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 129]  [Cited by in RCA: 121]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
6.  Wang JT, Sheu JC, Lin JT, Wang TH, Chen DS. Detection of replicative form of hepatitis C virus RNA in peripheral blood mononuclear cells. J Infect Dis. 1992;166:1167-1169.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 128]  [Cited by in RCA: 130]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
Footnotes

Reported at the 5th National Congress of Infectious Diseases and Parasitosis, Beijing, China, May 1995.

Original title: China National Journal of New Gastroenterology (1995-1997) renamed World Journal of Gastroenterology (1998-).

S- Editor: Tao T L- Editor: Filipodia E- Editor: Li RF

Write to the Help Desk