BPG is committed to discovery and dissemination of knowledge
Basic Research Open Access
©The Author(s) 2004. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. May 15, 2004; 10(10): 1495-1498
Published online May 15, 2004. doi: 10.3748/wjg.v10.i10.1495
Synthesis of ribozyme against vascular endothelial growth factor165 and its biological activity in vitro
Zhong-Ping Gu, Yun-Jie Wang, Yu Wu, Department of Thoracic Surgery, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province, China
Jin-Ge Li, Department of Infectious Disease, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province, China
Nong-An Chen, Shanghai Institute of Biochemistry, Academia Sinica, Shanghai 20020, China
Author contributions: All authors contributed equally to the work.
Correspondence to: Dr. Zhong-ping Gu, Department of Thoracic Surgery, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province, China. zhongpg@xaonline.com.cn
Telephone: +86-29-3541718
Received: December 10, 2003
Revised: January 24, 2004
Accepted: February 1, 2004
Published online: May 15, 2004

Abstract

AIM: To investigate the designation, synthesis and biological activity of against vascular endothelial growth factor165 (VEGF165) ribozyme.

METHODS: The ribozyme against VEGF165 was designed with computer. The transcriptional vector was constructed which included the anti-VEGF165 ribozyme and 5’, 3’ self-splicing ribozymes. The hammerhead ribozyme and substrate VEGF165 mRNA were synthesized through transcription in vitro. The cleavage activity of the ribozyme on target RNA was observed in a cell-free system.

RESULTS: The anti-VEGF165 ribozyme was released properly from the transcription of pGEMRz212 cleaved by 5’ and 3’ self-splicing ribozymes which retained its catalytic activity, and the cleavage efficiency of ribozyme reached 90.7%.

CONCLUSION: The anti-VEGF165 ribozyme designed with computer can cleave VEGF165 mRNA effectively.




INTRODUCTION

Ribozyme (Rz) is one kind of RNA with site-specific ligation and cleavage activities. Being sequence-specific binding and cleaving specific RNA of ribozyme, the target gene expression can be destructed by an artificially designed and synthesized ribozyme[1-5]. A great attention has been attracted into the field of gene therapy for cancers with the hammerhead ribozyme, by the virtue of its simple structure, small molecule, easy designation, site-specific mRNA cleavage activity, and catalytic potential[6-13]. Many studies have showed that the growth, metastasis and prognosis of solid tumors critically related to the angiogenesis. Tumor angiogenesis is a complex process. Among all of the known factors of tumor angiogenesis, vascular endothelial growth factor (VEGF) is a vascular endothelial cell-specific mitogen and the most important and direct one that can stimulate tumor angiogenesis. VEGF165 is the most effective angiogenic factor in the VEGF family[14-22]. Conversely, inhibition of VEGF expression and tumor angiogenesis to inhibit tumor growth and metastasis become a new hot spot of tumor treatment[23-34]. In this study, the ribozyme against VEGF165 site 212 was designed with computer, the transcriptional vector including the anti-VEGF165 ribozyme and self-splicing ribozymes were synthesized and constructed, and the cleavage effect of the ribozyme on target mRNA in cell-free system was observed.

MATERIALS AND METHODS
Vectors

The vector pGEM-3zf (+) VEGF (carrying full length amino acids cDNA of VEGF165) was kindly provided by Dr. Abraham (Columbia University, USA). Vector pGEMRzHBV and bacterium JM 109 were gift from Dr. Li (Department of Infectious Disease, Tangdu Hospital, Fourth Military Medical University, China).

Ribozyme design

The cleavage sites of ribozyme anti-VEGF165 were designed by computer analysis of the secondary structure of VEGF165 mRNA with a computer program (Chen Nong-an, Shanghai Institute of Biochemistry, Academia Sinica). According to Symon’s hammerhead ribozyme structural model, the sequences of the cleavage active core of ribozyme and the flanking sequences around the cleavage sites were designed.

Ribozyme synthesis

The hammerhead ribozyme was synthesized by 35 amplification cycles of PCR (TakaRa Biotechnology Co. Ltd. Dalian, China) with the following primer: 5’TGAAGATGCTGATGAGTCCGTGAGGACGAAACTCGAT3’ and purified by electrophoresis on a 100 g/L denaturing polyacrylamide gel.

Plasmid construction

In the down stream of T7 promoter, plasmid pGEMRzHBV included 5’cis-self-splicing ribozyme, RzHBV and 3’ cis-self-splicing ribozyme in order. The pGEMRzHBV was digested with Xba I and Aat II, then the linear vector was purified by 10 g/L agarose gel electrophoresis by using plasmid purification kit (Gibco, USA) according to the manufacturer’s instruction. The two complementary strands of designed ribozyme gene cDNA ends were prepared by adding linkers to create sticky ends (Xba I and Aat II). The double-stranded DNA was then subcloned into the multicloning site ( at Xba I and Aat II) of pGEM by using T4 DNA ligase (Promega, USA) to create the self-splicing transcriptional plasmid pGEMRz212 (Figure 1). After being transformed competent JM109 cells with pGEMRz212 and blue-white screening, the plasmids were extracted from the positive colonies. The sequences of the VEGF165 ribozyme and self-splicing ribozymes were confirmed by restriction enzyme and DNA sequencing.

Figure 1
Figure 1 Diagram of construction of the vector pGEMRz212.
Ribozyme transcription and cleavage activity in vitro

The pGEM-3zf (+)VEGF was cut by EcoR I, and pGEMRz212 by Xba I and Aat II. The ribozyme and substrate RNAs were prepared from the cDNA templates with T7 RNA polymerase (Gibco-BRL, USA) with [α-32P]UTP (Yahui Co., Beijing) by in vitro transcription. Both the ribozyme and substrate mRNA were synthesized by using T7 in vitro transcriptional kit (Gibco-BRL, USA). Equal amounts of ribozyme and substrate were mixed in 10 μL of reaction buffer (10 mmol/L MgCl2 and pH7.6, 75 mmol/L Tris-HCl ) at 95 °C for one minute and cooled in ice immediately. The mixture was then reacted at 37 °C for 2 h. The reaction was quenched with EDTA. The cleavage products were detected by autoradiography after 60 g/L denaturing polyacrylamide gel electrophoresis.

RESULTS
Ribozyme designation with computer

The topography of the substrate RNA could be simulated by analyzing the cleavage site and the region surrounding the cleavage site by using an RAN secondary structure folding program. In this way, it might be possible to determine whether or not the target site is buried within an obvious thermodynamically stable region of secondary structure. Among the VEGF165 mRNA, there were four hammerhead ribozyme cleavage sites. The site 212 was selected as the optimal cleavage site due to its in single chain region of substrate RNA secondary structure and its both binding arms forming a loop structure to expose for ribozyme cleavage interaction as well as site 212 creating the ribozyme essential core (Figure 2). We called the ribozyme Rz212.

Figure 2
Figure 2 Sequencing of the Rz212 and the target mRNA of VEGF165.
Synthesis and transcription Rz212

The synthesized ribozyme was confirmed by restriction enzyme and sequencing analysis. The ribozyme molecule was transcribed in vitro. Autoradiography showed three fragments after electrophoresis. The fragments were 5’cis ribozyme (64 nt), 3’cis ribozyme (54 nt) and Rz212 (47 nt), respectively (Figure 3). The results indicated synthesized ribozyme presenting self-cleavage and releasing the desired ribozyme.

Figure 3
Figure 3 Transcription of pGEMRz212.
Cleavage activity of Rz212

The cleavage reaction was carried out in vitro in a cell-free system. Rz212 cleaved the substrate VEGF165 mRNA into 2 fragments (259 nt and 380 nt) (Figure 4) consistent with anticipatation. After being cleaved by ribozyme, the density was analyzed by using laser density scanner and the substrate residue was just about 9.3%, indicating that the substrate was nearly cleaved completely by ribozyme.

Figure 4
Figure 4 Cleavage activity of VEGF165 mRNA with Rz212.
DISCUSSION

The cleavage site and both binding arms must be considered attentively while designing ribozyme. First of all, the cleavage site should be in the important functional region of the target gene assuring the corresponding protein function lost after being cleaved. In addition, the flanking sequences around the cleavage site should be as conserved as possible so that the ribozyme cleavage spectrum become broader. The ribozyme arms sequence context can also influence cleavage rate significantly. In a simple term, the longer the binding arms, the lower the turnover in cleavage of short substrate[35]. Results from various studies have indicated that ribozyme activity is closely related to the arms length and this depends somewhat on the sequence context[36,37]. The ribozyme design program we used was approved and improved continuously by experiments. It can resolve the cleavage site design and the sequence surrounding the cleavage site as well as the predicting of ribozyme secondary structure. In this study, we designed successfully the ribozyme target VEGF165 mRNA site 212 using the program, synthesized Rz212 and constructed self-cleavage plasmid pGEMRz212. In vitro transcription and cleavage experiment showed that the designed ribozyme was released and cut the target mRNA into two fragments.

Practically, ribozyme gene was constructed in the transcriptional and eukaryotic vector. The ribozyme molecule was transcribed in cells. But there are some long additional sequence in the both arms of ribozyme. The long additional sequence has a strong secondary structure and influenced ribozyme catalytic core, resulted in forming the incorrect secondary structure, even blocking ribozyme binding site. The long additional sequence also influenced ribozyme dissociation from the cleaved target mRNA and reduced cleavage rate[38,39]. In order to cleave the long additional sequence, we designed and constructed the trimming plasmid pGEMRz212, which included 5’cis-self-splicing ribozyme, Rz212 and 3’cis-self-splicing ribozyme in order. The long additional sequence was cleaved while pGEMRz212 transcription in vitro and VEGF165 mRNA specific ribozyme released without long additional sequence. The result showed 5’ and 3’cis ribozyme neither cleaved the substrate and nor influenced Rz212 cleavage efficacy.

Compared with antisense RNA, ribozyme can not only block target mRNA but also cleave the target mRNA in a sequence-specific manner. Ribozyme has received much attention for their potential use due to their inherent simplicity, relatively small size, repetition use and the ability to be incorporated into a variety of flanking sequence motifs without changing site-specific cleavage capacities[40-42]. In this experiment, the cleavage efficacy of ribozyme we designed and synthesized reached up to 90.7%. It can suppress effectively the expression of substrate. This research may facilitate the development of ribozyme anti-angiogenesis gene therapy for the treatment in the tumors. Further studies are required for therapeutic application of anti-angiogenesis in human cancer.

References
1.  Doherty EA, Doudna JA. Ribozyme structures and mechanisms. Annu Rev Biophys Biomol Struct. 2001;30:457-475.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 168]  [Cited by in RCA: 129]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
2.  Takagi Y, Warashina M, Stec WJ, Yoshinari K, Taira K. Recent advances in the elucidation of the mechanisms of action of ribozymes. Nucleic Acids Res. 2001;29:1815-1834.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 96]  [Cited by in RCA: 84]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
3.  Aigner A, Renneberg H, Bojunga J, Apel J, Nelson PS, Czubayko F. Ribozyme-targeting of a secreted FGF-binding protein (FGF-BP) inhibits proliferation of prostate cancer cells in vitro and in vivo. Oncogene. 2002;21:5733-5742.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 27]  [Cited by in RCA: 28]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
4.  Li JG, Lian JQ, Jia ZS, Feng ZH, Nie QH, Wang JP, Huang CX, Bai XF. Effect of ribozymes on inhibiting expression of HBV mRNA in HepG2 cells. Shijie Huaren Xiaohua Zazhi. 2003;11:161-164.  [PubMed]  [DOI]
5.  Tekur S, Ho SM. Ribozyme-mediated downregulation of human metallothionein II(a) induces apoptosis in human prostate and ovarian cancer cell lines. Mol Carcinog. 2002;33:44-55.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 29]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
6.  Lin JS, Song YH, Kong XJ, Li B, Liu NZ, Wu XL, Jin YX. Preparation and identification of anti-transforming growth factor beta1 U1 small nuclear RNA chimeric ribozyme in vitro. World J Gastroenterol. 2003;9:572-577.  [PubMed]  [DOI]  [Full Text]
7.  Zheng Y, Zhang J, Qu L. Effects of anti-HPV16E6-ribozyme on phenotype and gene expression of a cervical cancer cell line. Chin Med J (Engl). 2002;115:1501-1506.  [PubMed]  [DOI]
8.  Jia ZS, Chen L, Hao CQ, Feng ZH, Li JG, Wang JP, Cao YZ, Zhou YX. Intracellular immunization by hammerhead ribozyme against HCV. Shijie Huaren Xiaohua Zazhi. 2003;11:148-150.  [PubMed]  [DOI]
9.  Castanotto D, Li JR, Michienzi A, Langlois MA, Lee NS, Puymirat J, Rossi JJ. Intracellular ribozyme applications. Biochem Soc Trans. 2002;30:1140-1145.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 12]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
10.  Liu XJ, Wu QM, Liu CZ, Yu JP, Wang Q. Construction and assessment of eukaryotic expression plasmid pBBS212Rz con-taining ribozyme gene against hTR. Shijie Huaren Xiaohua Zazhi. 2002;10:1261-1263.  [PubMed]  [DOI]
11.  Tong Q, Zhao J, Chen Z, Zeng F, Lu G. Effects of blocking androgen receptor expression with specific hammerhead ribozyme on in vitro growth of prostate cancer cell line. Chin Med J (Engl). 2003;116:1515-1518.  [PubMed]  [DOI]
12.  Goodchild J. Hammerhead ribozymes for target validation. Expert Opin Ther Targets. 2002;6:235-247.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 7]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
13.  Goodchild J. Hammerhead ribozymes: biochemical and chemical considerations. Curr Opin Mol Ther. 2000;2:272-281.  [PubMed]  [DOI]
14.  Carmeliet P. Angiogenesis in health and disease. Nat Med. 2003;9:653-660.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3317]  [Cited by in RCA: 3009]  [Article Influence: 130.8]  [Reference Citation Analysis (1)]
15.  Gu ZP, Wang YJ, Li JG, Zhou YA. VEGF165 antisense RNA suppresses oncogenic properties of human esophageal squamous cell carcinoma. World J Gastroenterol. 2002;8:44-48.  [PubMed]  [DOI]
16.  Hughes GC, Biswas SS, Yin B, Coleman RE, DeGrado TR, Landolfo CK, Lowe JE, Annex BH, Landolfo KP. Therapeutic angiogenesis in chronically ischemic porcine myocardium: comparative effects of bFGF and VEGF. Ann Thorac Surg. 2004;77:812-818.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 71]  [Cited by in RCA: 67]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
17.  Fernandez M, Vizzutti F, Garcia-Pagan JC, Rodes J, Bosch J. Anti-VEGF receptor-2 monoclonal antibody prevents portal-systemic collateral vessel formation in portal hypertensive mice. Gastroenterology. 2004;126:886-894.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 220]  [Cited by in RCA: 169]  [Article Influence: 7.7]  [Reference Citation Analysis (1)]
18.  Willett CG, Boucher Y, di Tomaso E, Duda DG, Munn LL, Tong RT, Chung DC, Sahani DV, Kalva SP, Kozin SV. Direct evidence that the VEGF-specific antibody bevacizumab has antivascular effects in human rectal cancer. Nat Med. 2004;10:145-147.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1573]  [Cited by in RCA: 1417]  [Article Influence: 64.4]  [Reference Citation Analysis (5)]
19.  Fondevila C, Metges JP, Fuster J, Grau JJ, Palacín A, Castells A, Volant A, Pera M. p53 and VEGF expression are independent predictors of tumour recurrence and survival following curative resection of gastric cancer. Br J Cancer. 2004;90:206-215.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 138]  [Cited by in RCA: 142]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
20.  Van Trappen PO, Steele D, Lowe DG, Baithun S, Beasley N, Thiele W, Weich H, Krishnan J, Shepherd JH, Pepper MS. Expression of vascular endothelial growth factor (VEGF)-C and VEGF-D, and their receptor VEGFR-3, during different stages of cervical carcinogenesis. J Pathol. 2003;201:544-554.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 107]  [Cited by in RCA: 100]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
21.  Büchler P, Reber HA, Ullrich A, Shiroiki M, Roth M, Büchler MW, Lavey RS, Friess H, Hines OJ. Pancreatic cancer growth is inhibited by blockade of VEGF-RII. Surgery. 2003;134:772-782.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 43]  [Cited by in RCA: 41]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
22.  Belotti D, Paganoni P, Manenti L, Garofalo A, Marchini S, Taraboletti G, Giavazzi R. Matrix metalloproteinases (MMP9 and MMP2) induce the release of vascular endothelial growth factor (VEGF) by ovarian carcinoma cells: implications for ascites formation. Cancer Res. 2003;63:5224-5229.  [PubMed]  [DOI]
23.  Li Q, Dong X, Gu W, Qiu X, Wang E. Clinical significance of co-expression of VEGF-C and VEGFR-3 in non-small cell lung cancer. Chin Med J (Engl). 2003;116:727-730.  [PubMed]  [DOI]
24.  Qi JH, Ebrahem Q, Moore N, Murphy G, Claesson-Welsh L, Bond M, Baker A, Anand-Apte B. A novel function for tissue inhibitor of metalloproteinases-3 (TIMP3): inhibition of angiogenesis by blockage of VEGF binding to VEGF receptor-2. Nat Med. 2003;9:407-415.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 542]  [Cited by in RCA: 502]  [Article Influence: 21.8]  [Reference Citation Analysis (0)]
25.  LeCouter J, Lin R, Ferrara N. Endocrine gland-derived VEGF and the emerging hypothesis of organ-specific regulation of angiogenesis. Nat Med. 2002;8:913-917.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 85]  [Cited by in RCA: 73]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
26.  Riedel F, Götte K, Li M, Hörmann K, Grandis JR. Abrogation of VEGF expression in human head and neck squamous cell carcinoma decreases angiogenic activity in vitro and in vivo. Int J Oncol. 2003;23:577-583.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 2]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
27.  Ferrara N. Role of vascular endothelial growth factor in physi-ologic and pathologic angiogenesis: therapeutic implications. Semin Oncol. 2002;29:10-14.  [PubMed]  [DOI]  [Full Text]
28.  Bikfalvi A, Bicknell R. Recent advances in angiogenesis, anti-angiogenesis and vascular targeting. Trends Pharmacol Sci. 2002;23:576-582.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 108]  [Cited by in RCA: 94]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
29.  Dvorak HF. Vascular permeability factor/vascular endothelial growth factor: a critical cytokine in tumor angiogenesis and a potential target for diagnosis and therapy. J Clin Oncol. 2002;20:4368-4380.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1274]  [Cited by in RCA: 1135]  [Article Influence: 47.3]  [Reference Citation Analysis (3)]
30.  Ferrara N. VEGF and the quest for tumour angiogenesis factors. Nat Rev Cancer. 2002;2:795-803.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1228]  [Cited by in RCA: 1109]  [Article Influence: 46.2]  [Reference Citation Analysis (0)]
31.  Hasan J, Byers R, Jayson GC. Intra-tumoural microvessel density in human solid tumours. Br J Cancer. 2002;86:1566-1577.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 243]  [Cited by in RCA: 219]  [Article Influence: 9.1]  [Reference Citation Analysis (0)]
32.  Chiarug V, Ruggiero M, Magnelli L. Angiogenesis and the unique nature of tumor matrix. Mol Biotechnol. 2002;21:85-90.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 14]  [Article Influence: 0.6]  [Reference Citation Analysis (3)]
33.  Carmeliet P, Jain RK. Angiogenesis in cancer and other diseases. Nature. 2000;407:249-257.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7237]  [Cited by in RCA: 6398]  [Article Influence: 246.1]  [Reference Citation Analysis (3)]
34.  Yancopoulos GD, Davis S, Gale NW, Rudge JS, Wiegand SJ, Holash J. Vascular-specific growth factors and blood vessel formation. Nature. 2000;407:242-248.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2921]  [Cited by in RCA: 2633]  [Article Influence: 101.3]  [Reference Citation Analysis (3)]
35.  Sun LQ, Cairns MJ, Saravolac EG, Baker A, Gerlach WL. Catalytic nucleic acids: from lab to applications. Pharmacol Rev. 2000;52:325-347.  [PubMed]  [DOI]
36.  Takagi Y, Suyama E, Kawasaki H, Miyagishi M, Taira K. Mechanism of action of hammerhead ribozymes and their applications in vivo: rapid identification of functional genes in the post-genome era by novel hybrid ribozyme libraries. Biochem Soc Trans. 2002;30:1145-1149.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 13]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
37.  Blount KF, Uhlenbeck OC. The hammerhead ribozyme. Biochem Soc Trans. 2002;30:1119-1122.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 31]  [Cited by in RCA: 25]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
38.  Amarzguioui M, Prydz H. Hammerhead ribozyme design and application. Cell Mol Life Sci. 1998;54:1175-1202.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 45]  [Cited by in RCA: 36]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
39.  Pennati M, Binda M, Colella G, Zoppe' M, Folini M, Vignati S, Valentini A, Citti L, De Cesare M, Pratesi G. Ribozyme-mediated inhibition of survivin expression increases spontaneous and drug-induced apoptosis and decreases the tumorigenic potential of human prostate cancer cells. Oncogene. 2004;23:386-394.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 64]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
40.  Weng DE, Usman N. Angiozyme: a novel angiogenesis inhibitor. Curr Oncol Rep. 2001;3:141-146.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 86]  [Cited by in RCA: 60]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
41.  Brattstrom D, Bergqvist M, Hesselius P, Larsso n A, Wagenius G, Brodin O. Serum VEGF and bFGF adds prog-nostic information in patients with normal platelet counts when sampled before, during and after treatment for lo-cally advanced non-small cell lung cancer. Lung Cancer. 2004;43:55-62.  [PubMed]  [DOI]  [Full Text]
42.  Im SA, Kim JS, Gomez-Manzano C, Fueyo J, Liu TJ, Cho MS, Seong CM, Lee SN, Hong YK, Yung WK. Inhibition of breast cancer growth in vivo by antiangiogenesis gene therapy with adenovirus-mediated antisense-VEGF. Br J Cancer. 2001;84:1252-1257.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 30]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
Footnotes

Edited by Kumar M Proofread by Xu FM

Write to the Help Desk