©The Author(s) 2024.
World J Virol. Mar 25, 2024; 13(1): 88164
Published online Mar 25, 2024. doi: 10.5501/wjv.v13.i1.88164
Published online Mar 25, 2024. doi: 10.5501/wjv.v13.i1.88164
Table 1 List of different National Center for Biotechnology Information records of different geographic strains for hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1 that are involved in ClustalW and entropy analyses
| Virus | Taxon ID | Classification | Country of isolation | NCBI accession number |
| HCV | 2847144 (genotype 1a) | Isolate ZS30 | China | KC844049 |
| 11103 (genotype 1b) | Isolate 2000621 | Israel | MT632133 | |
| 31649 (genotype 2) | Subtype 2a, isolate PR63 | China | KF676351 | |
| 356426 (genotype 3) | Subtype 3a | India | GQ275355 | |
| 356418 (genotype 4) | Subtype 4a, strain ED43 | Egypt | GU814265.1 | |
| 33746 (genotype 5) | Subtype 5a | United Kingdom | NC_009826 | |
| 356469 (genotype 6) | Subtype 6k, isolate KM41 | China | DQ278893 | |
| HBV | 489455 (genotype A) | Strain AON | Japan | LC488828 |
| 489460 (genotype B) | Isolate 4265-Viet12 | Viet Nam | LC064379 | |
| 2764122 (genotype C) | Isolate C173334 | Cambodia | LC535933 | |
| 2847137 (genotype D) | Isolate B-H10-Ban | Bangladesh | LC519824 | |
| 2847138 (genotype E) | Isolate Mart-B84 | Martinique | HE974384 | |
| 2847139 (genotype F) | Isolate VHB-PER036 | France | LT935669 | |
| 2847140 (genotype G) | Isolate MEX918M | Mexico | AB625342 | |
| 2847141 (genotype H) | Isolate Itabashi | Japan | LC491577 | |
| 2847142 (genotype I) | Isolate 8290 | Viet Nam | AF241411 | |
| HIV | 11676 (HIV-1) | Isolate 99SE-MP1299 (subtype O) | Senegal | AJ302646 |
| Isolate 5104_SEB_AIM_E3 | United States | MT190832 | ||
| Isolate 01AETH04BKM | Thailand | DQ314732 | ||
| Isolate RBF168 | France | GU111555 | ||
| Clone pCMO2.3 | Cameroon | AY618998 | ||
| Isolate 01ZATM45 (subtype: C) | South Africa | AY228557 | ||
| Isolate 193008 (subtype: AD) | Uganda | MW006063 | ||
| Isolate BI | Belgium | MN486005 | ||
| Isolate 99GR303 | Greece | AY046058 | ||
| Isolate HK002 (subtype: B) | Hong Kong | FJ460499 | ||
| Isolate SE8646 | Sweden | AY352654 | ||
| Isolate 01BRRJUD508 (subtype: F1) | Brazil | MG365771 | ||
| Isolate 04KBH8 (subtype: D) | South Korea | DQ054367 | ||
| Isolate D9451 (subtype: URF) | Japan | MN187301 | ||
| isolate C.IN.05.NIRT333.1 (subtype: C) | India | KF766540 | ||
| Isolate 98UA0116 (subtype: A; group: M) | Ukraine | AF413987 | ||
| Isolate M61 | Spain | DQ854714 | ||
| Isolate MtBs.18 | Russia | MK984159 | ||
| Isolate IIIB | United Kingdom | KJ925006 | ||
| Isolate MBC200 | Australia | AF042100 | ||
| Isolate 60000 (subtype: A1 variant) | Italy | EU861977 | ||
| Isolate TV721 | Canada | HM215249 | ||
| Isolate pXJDC6291-2-6 (subtype: CRF07_BC) | China | KC503852 |
Table 2 In silico evaluation of selected primer-pairs that demonstrated their suitability for simultaneous detection of a wide range of subtypes for hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1 using triplex real-time polymerase chain reaction amplification
| Virus | Primers | Primer Tm1 | Intended matches | Amplicon size (bp) | Amplicon Tm2 (oC) | Ref. | |
| HCV | Forward | GGTGCACGGTCTACGAGAC | 60.15 | HCV genotype 1 subtypes: 1a, 1b, 1c, 1g, and 1e. HCV genotype 2 subtypes: 2a, 2b, 2c, 2e, 2f, 2k, and 2m. HCV genotype 3 subtypes: 3a, 3b, 3g, 3i, and 3k. HCV genotype 4 subtypes: 4a, 4d, 4f, 4g, 4l, 4m, 4n, 4o, 4r, and 4v. HCV genotype 5 subtype: 5a. HCV genotype 6 subtypes: 6a, 6e, 6h, 6k, 6l, 6m, 6n, and 6r. HCV genotype 7 subtype: QC69. Unclassified HCV subtypes: 08.40.072, 08.80.075, 08.80.014, 08.80.070, 2b/1a, 2k/1b, and M2123. Recombinant HCV viruses | 64 | 86.5 | Chen et al[28], with modifications |
| Reverse | GCCTTGTGGTACTGCCTGAT | 60.04 | Chen et al[28] | ||||
| HBV | Forward | CTTCATCCTGCTGCTATGCCT | 60.20 | HBV genotypes A, A1, A2, and A3. HBV genotype B. HBV genotypes C and C1. HBV genotypes D and D4. HBV genotype E, including the relative Egyptian isolates AC# KU736891 and KU736892. HBV genotypes F, F2, and F4. HBV genotype G. HBV genotype H. HBV recombinant A/E. HBV recombinant B/C | 71 | 80.5 | Kishk et al[29] |
| Reverse | GACAAACGGGCAACATACCTT | 59.79 | Prakash et al[30], with modifications | ||||
| HIV | Forward | GCCTCAATAAAGCTTGCCTTGA | 59.51 | HIV type 1. Simian immunodeficiency virus | 121 | 85.5 | Rouet et al[31] |
| Reverse | GGCGCCACTGCTAGAGATTTT | 61.01 | |||||
- Citation: Nemr WA, Nashwa RK. Development of a multiplex polymerase chain reaction assay for detection of hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1. World J Virol 2024; 13(1): 88164
- URL: https://www.wjgnet.com/2220-3249/full/v13/i1/88164.htm
- DOI: https://dx.doi.org/10.5501/wjv.v13.i1.88164
