BPG is committed to discovery and dissemination of knowledge
Basic Study
Copyright ©The Author(s) 2024.
World J Virol. Mar 25, 2024; 13(1): 88164
Published online Mar 25, 2024. doi: 10.5501/wjv.v13.i1.88164
Table 1 List of different National Center for Biotechnology Information records of different geographic strains for hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1 that are involved in ClustalW and entropy analyses
Virus
Taxon ID
Classification
Country of isolation
NCBI accession number
HCV2847144 (genotype 1a)Isolate ZS30ChinaKC844049
11103 (genotype 1b)Isolate 2000621IsraelMT632133
31649 (genotype 2)Subtype 2a, isolate PR63ChinaKF676351
356426 (genotype 3)Subtype 3aIndiaGQ275355
356418 (genotype 4)Subtype 4a, strain ED43EgyptGU814265.1
33746 (genotype 5)Subtype 5aUnited KingdomNC_009826
356469 (genotype 6)Subtype 6k, isolate KM41ChinaDQ278893
HBV489455 (genotype A)Strain AONJapanLC488828
489460 (genotype B)Isolate 4265-Viet12Viet NamLC064379
2764122 (genotype C)Isolate C173334CambodiaLC535933
2847137 (genotype D)Isolate B-H10-BanBangladeshLC519824
2847138 (genotype E)Isolate Mart-B84MartiniqueHE974384
2847139 (genotype F)Isolate VHB-PER036FranceLT935669
2847140 (genotype G)Isolate MEX918MMexicoAB625342
2847141 (genotype H)Isolate ItabashiJapanLC491577
2847142 (genotype I)Isolate 8290Viet NamAF241411
HIV11676 (HIV-1)Isolate 99SE-MP1299 (subtype O)SenegalAJ302646
Isolate 5104_SEB_AIM_E3United StatesMT190832
Isolate 01AETH04BKMThailandDQ314732
Isolate RBF168FranceGU111555
Clone pCMO2.3CameroonAY618998
Isolate 01ZATM45 (subtype: C)South AfricaAY228557
Isolate 193008 (subtype: AD)UgandaMW006063
Isolate BIBelgiumMN486005
Isolate 99GR303GreeceAY046058
Isolate HK002 (subtype: B)Hong KongFJ460499
Isolate SE8646SwedenAY352654
Isolate 01BRRJUD508 (subtype: F1)BrazilMG365771
Isolate 04KBH8 (subtype: D)South KoreaDQ054367
Isolate D9451 (subtype: URF)JapanMN187301
isolate C.IN.05.NIRT333.1 (subtype: C)IndiaKF766540
Isolate 98UA0116 (subtype: A; group: M)UkraineAF413987
Isolate M61SpainDQ854714
Isolate MtBs.18RussiaMK984159
Isolate IIIBUnited KingdomKJ925006
Isolate MBC200 AustraliaAF042100
Isolate 60000 (subtype: A1 variant)ItalyEU861977
Isolate TV721 CanadaHM215249
Isolate pXJDC6291-2-6 (subtype: CRF07_BC)ChinaKC503852
Table 2 In silico evaluation of selected primer-pairs that demonstrated their suitability for simultaneous detection of a wide range of subtypes for hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1 using triplex real-time polymerase chain reaction amplification
Virus
Primers
Primer Tm1(oC)
Intended matches
Amplicon size (bp)
Amplicon Tm2 (oC)
Ref.
HCVForwardGGTGCACGGTCTACGAGAC60.15HCV genotype 1 subtypes: 1a, 1b, 1c, 1g, and 1e. HCV genotype 2 subtypes: 2a, 2b, 2c, 2e, 2f, 2k, and 2m. HCV genotype 3 subtypes: 3a, 3b, 3g, 3i, and 3k. HCV genotype 4 subtypes: 4a, 4d, 4f, 4g, 4l, 4m, 4n, 4o, 4r, and 4v. HCV genotype 5 subtype: 5a. HCV genotype 6 subtypes: 6a, 6e, 6h, 6k, 6l, 6m, 6n, and 6r. HCV genotype 7 subtype: QC69. Unclassified HCV subtypes: 08.40.072, 08.80.075, 08.80.014, 08.80.070, 2b/1a, 2k/1b, and M2123. Recombinant HCV viruses6486.5Chen et al[28], with modifications
ReverseGCCTTGTGGTACTGCCTGAT60.04Chen et al[28]
HBVForwardCTTCATCCTGCTGCTATGCCT60.20HBV genotypes A, A1, A2, and A3. HBV genotype B. HBV genotypes C and C1. HBV genotypes D and D4. HBV genotype E, including the relative Egyptian isolates AC# KU736891 and KU736892. HBV genotypes F, F2, and F4. HBV genotype G. HBV genotype H. HBV recombinant A/E. HBV recombinant B/C7180.5Kishk et al[29]
ReverseGACAAACGGGCAACATACCTT59.79Prakash et al[30], with modifications
HIVForwardGCCTCAATAAAGCTTGCCTTGA59.51HIV type 1. Simian immunodeficiency virus12185.5Rouet et al[31]
ReverseGGCGCCACTGCTAGAGATTTT61.01