Development of a multiplex polymerase chain reaction assay for detection of hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1

Table 1 List of different National Center for Biotechnology Information records of different geographic strains for hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1 that are involved in ClustalW and entropy analyses

Virus	Taxon ID	Classification	Country of isolation	NCBI accession number
HCV	2847144 (genotype 1a)	Isolate ZS30	China	KC844049
	11103 (genotype 1b)	Isolate 2000621	Israel	MT632133
	31649 (genotype 2)	Subtype 2a, isolate PR63	China	KF676351
	356426 (genotype 3)	Subtype 3a	India	GQ275355
	356418 (genotype 4)	Subtype 4a, strain ED43	Egypt	GU814265.1
	33746 (genotype 5)	Subtype 5a	United Kingdom	NC_009826
	356469 (genotype 6)	Subtype 6k, isolate KM41	China	DQ278893
HBV	489455 (genotype A)	Strain AON	Japan	LC488828
	489460 (genotype B)	Isolate 4265-Viet12	Viet Nam	LC064379
	2764122 (genotype C)	Isolate C173334	Cambodia	LC535933
	2847137 (genotype D)	Isolate B-H10-Ban	Bangladesh	LC519824
	2847138 (genotype E)	Isolate Mart-B84	Martinique	HE974384
	2847139 (genotype F)	Isolate VHB-PER036	France	LT935669
	2847140 (genotype G)	Isolate MEX918M	Mexico	AB625342
	2847141 (genotype H)	Isolate Itabashi	Japan	LC491577
	2847142 (genotype I)	Isolate 8290	Viet Nam	AF241411
HIV	11676 (HIV-1)	Isolate 99SE-MP1299 (subtype O)	Senegal	AJ302646
		Isolate 5104_SEB_AIM_E3	United States	MT190832
		Isolate 01AETH04BKM	Thailand	DQ314732
		Isolate RBF168	France	GU111555
		Clone pCMO2.3	Cameroon	AY618998
		Isolate 01ZATM45 (subtype: C)	South Africa	AY228557
		Isolate 193008 (subtype: AD)	Uganda	MW006063
		Isolate BI	Belgium	MN486005
		Isolate 99GR303	Greece	AY046058
		Isolate HK002 (subtype: B)	Hong Kong	FJ460499
		Isolate SE8646	Sweden	AY352654
		Isolate 01BRRJUD508 (subtype: F1)	Brazil	MG365771
		Isolate 04KBH8 (subtype: D)	South Korea	DQ054367
		Isolate D9451 (subtype: URF)	Japan	MN187301
		isolate C.IN.05.NIRT333.1 (subtype: C)	India	KF766540
		Isolate 98UA0116 (subtype: A; group: M)	Ukraine	AF413987
		Isolate M61	Spain	DQ854714
		Isolate MtBs.18	Russia	MK984159
		Isolate IIIB	United Kingdom	KJ925006
		Isolate MBC200	Australia	AF042100
		Isolate 60000 (subtype: A1 variant)	Italy	EU861977
		Isolate TV721	Canada	HM215249
		Isolate pXJDC6291-2-6 (subtype: CRF07_BC)	China	KC503852

HCV: Hepatitis C virus; HBV: Hepatitis B virus; HIV-1: Human immunodeficiency virus 1; NCBI: National Center for Biotechnology Information.

Table 2 In silico evaluation of selected primer-pairs that demonstrated their suitability for simultaneous detection of a wide range of subtypes for hepatitis C virus, hepatitis B virus, and human immunodeficiency virus 1 using triplex real-time polymerase chain reaction amplification

Virus	Primers		Primer Tm1(oC)	Intended matches	Amplicon size (bp)	Amplicon Tm2 (oC)	Ref.
HCV	Forward	GGTGCACGGTCTACGAGAC	60.15	HCV genotype 1 subtypes: 1a, 1b, 1c, 1g, and 1e. HCV genotype 2 subtypes: 2a, 2b, 2c, 2e, 2f, 2k, and 2m. HCV genotype 3 subtypes: 3a, 3b, 3g, 3i, and 3k. HCV genotype 4 subtypes: 4a, 4d, 4f, 4g, 4l, 4m, 4n, 4o, 4r, and 4v. HCV genotype 5 subtype: 5a. HCV genotype 6 subtypes: 6a, 6e, 6h, 6k, 6l, 6m, 6n, and 6r. HCV genotype 7 subtype: QC69. Unclassified HCV subtypes: 08.40.072, 08.80.075, 08.80.014, 08.80.070, 2b/1a, 2k/1b, and M2123. Recombinant HCV viruses	64	86.5	Chen et al[28], with modifications
	Reverse	GCCTTGTGGTACTGCCTGAT	60.04				Chen et al[28]
HBV	Forward	CTTCATCCTGCTGCTATGCCT	60.20	HBV genotypes A, A1, A2, and A3. HBV genotype B. HBV genotypes C and C1. HBV genotypes D and D4. HBV genotype E, including the relative Egyptian isolates AC# KU736891 and KU736892. HBV genotypes F, F2, and F4. HBV genotype G. HBV genotype H. HBV recombinant A/E. HBV recombinant B/C	71	80.5	Kishk et al[29]
	Reverse	GACAAACGGGCAACATACCTT	59.79				Prakash et al[30], with modifications
HIV	Forward	GCCTCAATAAAGCTTGCCTTGA	59.51	HIV type 1. Simian immunodeficiency virus	121	85.5	Rouet et al[31]
	Reverse	GGCGCCACTGCTAGAGATTTT	61.01

¹Primer melting temperature (Tm) and the amplicon size were determined using National Center for Biotechnology Information Primer-BLAST web-tool.

²Amplicon melting temperature was predicted using uMELT wed-based tool.

HCV: Hepatitis C virus; HBV: Hepatitis B virus; HIV-1: Human immunodeficiency virus 1.