Antioxidant enzyme profile of two clinical isolates of Entamoeba histolytica varying in sensitivity to antiamoebic drugs

Table 1 Primers used in RT-PCR of Entamoeba histolytica thioredoxin reductase, peroxiredoxin, FeSOD and 18SrRNA

S.No.	Primer	Sequence	Tm	Amplicon size	Ref.
1	Thioredoxin reductase (TrxR)	F-5’GTAATATTCATGATGTTGT3’	48 °C	204 bp	[4]
	Accession no (EHI_155440)	R-5’CATCATTAATTCATTTTCCA3’	48 °C
2	Eh Peroxiredoxin (Prx)	F 5’AAATCAATTGTGAAGTTATTGG3’	53.6 °C	100 bp	[16]
		R 5’TCCTACTCCTCCTTTACTTTTA3’	56.8 °C
3	FeSOD	F 5’ACAATTACCTTATGCTTATAA3’	52 °C	240 bp	[16]
	Accession number (XM_643735.2)	F 5’TCCACATCCACACATACAAT3’	54 °C
4	Entamoeba histolytica 18s ribosomal RNA gene	F 5’TCAGCCTTGTGACCATACTC3’	61.7 °C	200 bp	[16]
		F 5’AAGACGATCAGATACCGTCG3’	68.9 °C

Table 2 Representative minimum inhibitory concentration plate tests of clinical isolates of Entamoeba histolytica to antiamoebic drugs

Concentration	15 h			24 h			48 h
	W-1	W-2	W-3	W-1	W-2	W-3	W-1	W-2	W-3
MIC of Entamoeba histolytica clinical isolate 980 to auranofin = 3 μmol/L
Control	+++	++++	+++	+++	+++	+++	+++	++	++
DMSO control	+++	+++	++++	+++	+++	+++	+++	++	++
1 μmol/L	++	+++	++	++	++	++	++	++	++
2 μmol/L	+	++	++	++	++	++	++	+	+
3 μmol/L	+	+	+	+	+	-	+	-	+
4 μmol/L	+	+	+	-	-	-	-	-	-
MIC of of Entamoeba histolytica clinical isolate 980 to metronidazole = 80 μmol/L
Control	+++	++++	+++	+++	+++	+++	+++	++	++
DMSO control	+++	+++	++++	+++	+++	+++	+++	++	++
50 μmol/L	++	+++	+++	++	++	++	++	++	++
60 μmol/L	++	++	++	++	++	++	++	++	+
70 μmol/L	+	++	++	++	++	++	++	+	+
80 μmol/L	++	+	++	++	+	+	+	+	-
90 μmol/L	+	+	+	+	-	-	-	-	-
MIC of Entamoeba histolytica clinical isolate 989 to auranofin = 1 μmol/L (MIC determined to be 2 μmol/L)
Control	+++	++++	+++	+++	+++	+++	+++	++	++
DMSO control	+++	+++	+++	+++	+++	+++	+++	++	++
1 μmol/L	++	+++	+++	++	+	+	+	+	+
2 μmol/L	++	++	+	+	+	+	+	-	-
3 μmol/L	+	+	+	-	-	-	-	-	-
4 μmol/L	-	-	-	-	-	-	-	-	-
MIC of of Entamoeba histolytica clinical isolate 989 to metronidazole = 30 μmol/L
Control	+++	++++	+++	+++	+++	+++	+++	++	++
DMSO control	+++	+++	+++	+++	+++	+++	+++	++	++
10 μmol/L	++	+++	+++	++	++	++	++	++	++
20 μmol/L	++	+++	++	+	++	++	++	++	+
30 μmol/L	++	++	+	+	+	+	+	+	-
40 μmol/L	+	+	+	-	-	-	-	-	-

The lowest concentration giving a + score, after 48 h, was the minimum inhibitory concentration. W-1, W-2, and W-3, represent the triplicate wells. Scores are ++++: Confluent well, covered with live motile cells; +++: 50%-70% almost confluent well filled with live motile cells; ++: 30%-50% well coverage, few cells motile); +: ≤ 20% well coverage with rounded cells; -: Dead and disintergrated cells.

Table 3 Minimum inhibitory concentrations for clinical isolates of Entamoeba histolytica to metronidazole and auranofin in drug susceptibity assays

Isolate	MIC metronidazole	Range (µmol/L)	MIC auranofin	Range (µmol/L)	No. of attempts
654	50 μmol/L	50-60	2 μmol/L	2-3	3
812	40 μmol/L	30-40	2 μmol/L	2-3	3
980	80 μmol/L	80-100	3 μmol/L	80-100	5 (auranofin)
					10 (metronidazole)
989	30 μmol/L	30-40	1 μmol/L	1-2	5
5132	50 μmol/L	50-60	2 μmol/L	2-3	3
MS-96:3382	24 μmol/L	20-30	5 μmol/L	4-5	4

Table 4 Percent viability of clinical isolate 980 and 989 after treatment with metronidazole and auranofin

	15 h	24 h	48 h
Percent viability of clinical isolate 980 after treatment with metronidazole
50 μmol/L metronidazole	61.8 ± 0.13	74.12 ± 14.1	70.23 ± 3.66
70 μmol/L metronidazole	53.06 ± 14.1	69.38 ± 3.13	60.68 ± 6.74
90 μmol/L metronidazole	47.31 ± 6.2	26.39 ± 10.7	24.3 ± 14.75
Percent viability of clinical isolate 980 after treatment with auranofin
1 μmol/L auranofin	91.5 ± 0.26	25.17 ± 5.85	12.88 ± 1.63
2 μmol/L auranofin	56.6 ± 5.81	27.92 ± 5.84	0
3 μmol/L auranofin	47.74 ± 7.67	22.41 ± 4.62	0
Percent viability of clinical isolate 989 after treatment with metronidazole
20 μmol/L	-	92.51 ± 2.79	65.22 ± 18.5
30 μmol/L	-	76.11 ± 17.13	25.39 ± 5.33
40 μmol/L	-	54.81 ± 0.57	0
Percent viability of clinical isolate 989 after treatment with auranofin
0.5 μmol/L	-	45.47 ± 0.26	43.01 ± 2.33
1 μmol/L	-	36.63 ± 3.00	19.4 ± 2.95
2 μmol/L	-	29.16 ± 2.95	0

Values are expressed as percent of controls.