BPG is committed to discovery and dissemination of knowledge
Basic Study
Copyright ©The Author(s) 2017.
World J Clin Infect Dis. May 25, 2017; 7(2): 21-31
Published online May 25, 2017. doi: 10.5495/wjcid.v7.i2.21
Table 1 Primers used in RT-PCR of Entamoeba histolytica thioredoxin reductase, peroxiredoxin, FeSOD and 18SrRNA
S.No.PrimerSequenceTmAmplicon sizeRef.
1Thioredoxin reductase (TrxR)F-5’GTAATATTCATGATGTTGT3’48 °C204 bp[4]
Accession no (EHI_155440)R-5’CATCATTAATTCATTTTCCA3’48 °C
2Eh Peroxiredoxin (Prx)F 5’AAATCAATTGTGAAGTTATTGG3’53.6 °C100 bp[16]
R 5’TCCTACTCCTCCTTTACTTTTA3’56.8 °C
3FeSODF 5’ACAATTACCTTATGCTTATAA3’52 °C240 bp[16]
Accession number (XM_643735.2)F 5’TCCACATCCACACATACAAT3’54 °C
4Entamoeba histolytica 18s ribosomal RNA geneF 5’TCAGCCTTGTGACCATACTC3’61.7 °C200 bp[16]
F 5’AAGACGATCAGATACCGTCG3’68.9 °C
Table 2 Representative minimum inhibitory concentration plate tests of clinical isolates of Entamoeba histolytica to antiamoebic drugs
Concentration15 h
24 h
48 h
W-1W-2W-3W-1W-2W-3W-1W-2W-3
MIC of Entamoeba histolytica clinical isolate 980 to auranofin = 3 μmol/L
Control++++++++++++++++++++++++++
DMSO control++++++++++++++++++++++++++
1 μmol/L+++++++++++++++++++
2 μmol/L+++++++++++++++
3 μmol/L+++++-+-+
4 μmol/L+++------
MIC of of Entamoeba histolytica clinical isolate 980 to metronidazole = 80 μmol/L
Control++++++++++++++++++++++++++
DMSO control++++++++++++++++++++++++++
50 μmol/L++++++++++++++++++++
60 μmol/L+++++++++++++++++
70 μmol/L+++++++++++++++
80 μmol/L+++++++++++-
90 μmol/L++++-----
MIC of Entamoeba histolytica clinical isolate 989 to auranofin = 1 μmol/L (MIC determined to be 2 μmol/L)
Control++++++++++++++++++++++++++
DMSO control+++++++++++++++++++++++++
1 μmol/L+++++++++++++++
2 μmol/L+++++++++--
3 μmol/L+++------
4 μmol/L---------
MIC of of Entamoeba histolytica clinical isolate 989 to metronidazole = 30 μmol/L
Control++++++++++++++++++++++++++
DMSO control+++++++++++++++++++++++++
10 μmol/L++++++++++++++++++++
20 μmol/L+++++++++++++++++
30 μmol/L++++++++++-
40 μmol/L+++------
Table 3 Minimum inhibitory concentrations for clinical isolates of Entamoeba histolytica to metronidazole and auranofin in drug susceptibity assays
IsolateMIC metronidazoleRange (µmol/L)MIC auranofinRange (µmol/L)No. of attempts
65450 μmol/L50-602 μmol/L2-33
81240 μmol/L30-402 μmol/L2-33
98080 μmol/L80-1003 μmol/L80-1005 (auranofin)
10 (metronidazole)
98930 μmol/L30-401 μmol/L1-25
513250 μmol/L50-602 μmol/L2-33
MS-96:338224 μmol/L20-305 μmol/L4-54
Table 4 Percent viability of clinical isolate 980 and 989 after treatment with metronidazole and auranofin
15 h24 h48 h
Percent viability of clinical isolate 980 after treatment with metronidazole
50 μmol/L metronidazole61.8 ± 0.1374.12 ± 14.170.23 ± 3.66
70 μmol/L metronidazole53.06 ± 14.169.38 ± 3.1360.68 ± 6.74
90 μmol/L metronidazole47.31 ± 6.226.39 ± 10.724.3 ± 14.75
Percent viability of clinical isolate 980 after treatment with auranofin
1 μmol/L auranofin91.5 ± 0.2625.17 ± 5.8512.88 ± 1.63
2 μmol/L auranofin56.6 ± 5.8127.92 ± 5.840
3 μmol/L auranofin47.74 ± 7.6722.41 ± 4.620
Percent viability of clinical isolate 989 after treatment with metronidazole
20 μmol/L-92.51 ± 2.7965.22 ± 18.5
30 μmol/L-76.11 ± 17.1325.39 ± 5.33
40 μmol/L-54.81 ± 0.570
Percent viability of clinical isolate 989 after treatment with auranofin
0.5 μmol/L-45.47 ± 0.2643.01 ± 2.33
1 μmol/L-36.63 ± 3.0019.4 ± 2.95
2 μmol/L-29.16 ± 2.950