©The Author(s) 2017.
World J Clin Infect Dis. May 25, 2017; 7(2): 21-31
Published online May 25, 2017. doi: 10.5495/wjcid.v7.i2.21
Published online May 25, 2017. doi: 10.5495/wjcid.v7.i2.21
Table 1 Primers used in RT-PCR of Entamoeba histolytica thioredoxin reductase, peroxiredoxin, FeSOD and 18SrRNA
| S.No. | Primer | Sequence | Tm | Amplicon size | Ref. |
| 1 | Thioredoxin reductase (TrxR) | F-5’GTAATATTCATGATGTTGT3’ | 48 °C | 204 bp | [4] |
| Accession no (EHI_155440) | R-5’CATCATTAATTCATTTTCCA3’ | 48 °C | |||
| 2 | Eh Peroxiredoxin (Prx) | F 5’AAATCAATTGTGAAGTTATTGG3’ | 53.6 °C | 100 bp | [16] |
| R 5’TCCTACTCCTCCTTTACTTTTA3’ | 56.8 °C | ||||
| 3 | FeSOD | F 5’ACAATTACCTTATGCTTATAA3’ | 52 °C | 240 bp | [16] |
| Accession number (XM_643735.2) | F 5’TCCACATCCACACATACAAT3’ | 54 °C | |||
| 4 | Entamoeba histolytica 18s ribosomal RNA gene | F 5’TCAGCCTTGTGACCATACTC3’ | 61.7 °C | 200 bp | [16] |
| F 5’AAGACGATCAGATACCGTCG3’ | 68.9 °C |
Table 2 Representative minimum inhibitory concentration plate tests of clinical isolates of Entamoeba histolytica to antiamoebic drugs
| Concentration | 15 h | 24 h | 48 h | ||||||
| W-1 | W-2 | W-3 | W-1 | W-2 | W-3 | W-1 | W-2 | W-3 | |
| MIC of Entamoeba histolytica clinical isolate 980 to auranofin = 3 μmol/L | |||||||||
| Control | +++ | ++++ | +++ | +++ | +++ | +++ | +++ | ++ | ++ |
| DMSO control | +++ | +++ | ++++ | +++ | +++ | +++ | +++ | ++ | ++ |
| 1 μmol/L | ++ | +++ | ++ | ++ | ++ | ++ | ++ | ++ | ++ |
| 2 μmol/L | + | ++ | ++ | ++ | ++ | ++ | ++ | + | + |
| 3 μmol/L | + | + | + | + | + | - | + | - | + |
| 4 μmol/L | + | + | + | - | - | - | - | - | - |
| MIC of of Entamoeba histolytica clinical isolate 980 to metronidazole = 80 μmol/L | |||||||||
| Control | +++ | ++++ | +++ | +++ | +++ | +++ | +++ | ++ | ++ |
| DMSO control | +++ | +++ | ++++ | +++ | +++ | +++ | +++ | ++ | ++ |
| 50 μmol/L | ++ | +++ | +++ | ++ | ++ | ++ | ++ | ++ | ++ |
| 60 μmol/L | ++ | ++ | ++ | ++ | ++ | ++ | ++ | ++ | + |
| 70 μmol/L | + | ++ | ++ | ++ | ++ | ++ | ++ | + | + |
| 80 μmol/L | ++ | + | ++ | ++ | + | + | + | + | - |
| 90 μmol/L | + | + | + | + | - | - | - | - | - |
| MIC of Entamoeba histolytica clinical isolate 989 to auranofin = 1 μmol/L (MIC determined to be 2 μmol/L) | |||||||||
| Control | +++ | ++++ | +++ | +++ | +++ | +++ | +++ | ++ | ++ |
| DMSO control | +++ | +++ | +++ | +++ | +++ | +++ | +++ | ++ | ++ |
| 1 μmol/L | ++ | +++ | +++ | ++ | + | + | + | + | + |
| 2 μmol/L | ++ | ++ | + | + | + | + | + | - | - |
| 3 μmol/L | + | + | + | - | - | - | - | - | - |
| 4 μmol/L | - | - | - | - | - | - | - | - | - |
| MIC of of Entamoeba histolytica clinical isolate 989 to metronidazole = 30 μmol/L | |||||||||
| Control | +++ | ++++ | +++ | +++ | +++ | +++ | +++ | ++ | ++ |
| DMSO control | +++ | +++ | +++ | +++ | +++ | +++ | +++ | ++ | ++ |
| 10 μmol/L | ++ | +++ | +++ | ++ | ++ | ++ | ++ | ++ | ++ |
| 20 μmol/L | ++ | +++ | ++ | + | ++ | ++ | ++ | ++ | + |
| 30 μmol/L | ++ | ++ | + | + | + | + | + | + | - |
| 40 μmol/L | + | + | + | - | - | - | - | - | - |
Table 3 Minimum inhibitory concentrations for clinical isolates of Entamoeba histolytica to metronidazole and auranofin in drug susceptibity assays
| Isolate | MIC metronidazole | Range (µmol/L) | MIC auranofin | Range (µmol/L) | No. of attempts |
| 654 | 50 μmol/L | 50-60 | 2 μmol/L | 2-3 | 3 |
| 812 | 40 μmol/L | 30-40 | 2 μmol/L | 2-3 | 3 |
| 980 | 80 μmol/L | 80-100 | 3 μmol/L | 80-100 | 5 (auranofin) |
| 10 (metronidazole) | |||||
| 989 | 30 μmol/L | 30-40 | 1 μmol/L | 1-2 | 5 |
| 5132 | 50 μmol/L | 50-60 | 2 μmol/L | 2-3 | 3 |
| MS-96:3382 | 24 μmol/L | 20-30 | 5 μmol/L | 4-5 | 4 |
Table 4 Percent viability of clinical isolate 980 and 989 after treatment with metronidazole and auranofin
| 15 h | 24 h | 48 h | |
| Percent viability of clinical isolate 980 after treatment with metronidazole | |||
| 50 μmol/L metronidazole | 61.8 ± 0.13 | 74.12 ± 14.1 | 70.23 ± 3.66 |
| 70 μmol/L metronidazole | 53.06 ± 14.1 | 69.38 ± 3.13 | 60.68 ± 6.74 |
| 90 μmol/L metronidazole | 47.31 ± 6.2 | 26.39 ± 10.7 | 24.3 ± 14.75 |
| Percent viability of clinical isolate 980 after treatment with auranofin | |||
| 1 μmol/L auranofin | 91.5 ± 0.26 | 25.17 ± 5.85 | 12.88 ± 1.63 |
| 2 μmol/L auranofin | 56.6 ± 5.81 | 27.92 ± 5.84 | 0 |
| 3 μmol/L auranofin | 47.74 ± 7.67 | 22.41 ± 4.62 | 0 |
| Percent viability of clinical isolate 989 after treatment with metronidazole | |||
| 20 μmol/L | - | 92.51 ± 2.79 | 65.22 ± 18.5 |
| 30 μmol/L | - | 76.11 ± 17.13 | 25.39 ± 5.33 |
| 40 μmol/L | - | 54.81 ± 0.57 | 0 |
| Percent viability of clinical isolate 989 after treatment with auranofin | |||
| 0.5 μmol/L | - | 45.47 ± 0.26 | 43.01 ± 2.33 |
| 1 μmol/L | - | 36.63 ± 3.00 | 19.4 ± 2.95 |
| 2 μmol/L | - | 29.16 ± 2.95 | 0 |
- Citation: Iyer LR, Banyal N, Naik S, Paul J. Antioxidant enzyme profile of two clinical isolates of Entamoeba histolytica varying in sensitivity to antiamoebic drugs. World J Clin Infect Dis 2017; 7(2): 21-31
- URL: https://www.wjgnet.com/2220-3176/full/v7/i2/21.htm
- DOI: https://dx.doi.org/10.5495/wjcid.v7.i2.21