BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2020. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Clin Infect Dis. May 15, 2020; 10(1): 14-23
Published online May 15, 2020. doi: 10.5495/wjcid.v10.i1.14
GadE regulates fliC gene transcription and motility in Escherichia coli
William R Schwan, Nicole L Flohr, Abigail R Multerer, Jordan C Starkey, Department of Microbiology, University of Wisconsin-La Crosse, La Crosse, WI 54601, United States
ORCID number: William R Schwan (0000-0003-3076-1815); Nicole L Flohr (0000-0003-0445-124X); Abigail R Multerer (0000-0001-6789-6268); Jordan C Starkey (0000-0001-9160-8588).
Author contributions: Schwan WR, Flohr NL, Multerer AR, and Starkey JC designed the research, performed the research; Schwan WR, Flohr NL, and Multerer AR analyzed the data; Schwan WR wrote the paper.
Supported by the National Institutes of Health, No. 1R15AI-065432.
Institutional review board statement: No humans or samples from human were used in this study.
Institutional animal care and use committee statement: No animals were used in this study.
Conflict-of-interest statement: The authors report no conflict of interest.
Data sharing statement: No additional data are available.
Corresponding author: William R Schwan, PhD, Professor, Department of Microbiology, University of Wisconsin-La Crosse, 1725 State St, La Crosse, WI 54601, United States. wschwan@uwlax.edu
Received: February 7, 2020
Peer-review started: February 7, 2020
First decision: March 5, 2020
Revised: March 25, 2020
Accepted: May 5, 2020
Article in press: May 5, 2020
Published online: May 15, 2020
Processing time: 95 Days and 9.2 Hours

Abstract
BACKGROUND

Escherichia coli (E. coli) express flagella to ascend human urinary tracts. To survive in the acidic pH of human urine, E. coli uses the glutamate decarboxylase acid response system, which is regulated by the GadE protein.

AIM

To determine if growth in an acidic pH environment affected fliC transcription and whether GadE regulated that transcription.

METHODS

A fliC-lacZ reporter fusion was created on a single copy number plasmid to assess the effects of acidic pH on fliC transcription. Further, a ΔgadE mutant strain of a uropathogenic E. coli was created and tested for motility compared to the wild-type strain.

RESULTS

Escherichia coli cells carrying the fliC-lacZ fusion displayed significantly less fliC transcription when grown in an acidic pH medium compared to when grown in a neutral pH medium. Transcription of fliC fell further when the E. coli was grown in an acidic pH/high osmolarity environment. Since GadE is a critical regulator of one acid response system, fliC transcription was tested in a gadE mutant strain grown under acidic conditions. Expression of fliC was derepressed in the E. coli gadE mutant strain grown under acidic conditions compared to that in wild-type bacteria under the same conditions. Furthermore, a gadE mutation in a uropathogenic E. coli background exhibited significantly greater motility than the wild-type strain following growth in an acidic medium.

CONCLUSION

Together, our results suggest that GadE may down-regulate fliC transcription and motility in E. coli grown under acidic conditions.

Key Words: Escherichia coli; Flagella; GadE; Motility; Acid response; fliC

Core tip: Escherichia coli (E. coli) is the number one cause of urinary tract infections in women. The infections are the result of the E. coli cells ascending the urinary tract via flagella presented on the outside of the cells. In this study, we have shown that E. coli grown in a low pH/high-osmolarity environment display transcriptional repression of the fliC flagellin subunit gene. Furthermore, we demonstrate that GadE may regulate fliC transcription and subsequent motility of the E. coli cells.



Core tip: Escherichia coli (E. coli) is the number one cause of urinary tract infections in women. The infections are the result of the E. coli cells ascending the urinary tract via flagella presented on the outside of the cells. In this study, we have shown that E. coli grown in a low pH/high-osmolarity environment display transcriptional repression of the fliC flagellin subunit gene. Furthermore, we demonstrate that GadE may regulate fliC transcription and subsequent motility of the E. coli cells.


INTRODUCTION

In the United States, approximately 10.5 million women suffer from a urinary tract infection each year. Around 80% of urinary tract infection are caused by uropathogenic Escherichia coli (UPEC), resulting in over 100000 hospitalizations and an approximate cost of $ 3.5 billion per year[1-3]. UPEC sometimes ascend all of the way to the kidneys, causing life-threatening pyelonephritis in some of the women[2,3]. The ability of Escherichia coli (E. coli) to move up the human urinary tract is due to the presence of flagella expressed by the bacteria[4-7].

Bacterial flagella allow the directional movement of E. coli based upon a chemotactic response[8,9]. Several genes are involved in the expression of flagella, although fliC encodes the flagellin subunits that comprise the bulk of a flagellum structure[10]. Several studies have shown the importance of flagella in UPEC pathogenesis[4-7,11]. For instance, several studies have examined the prevalence of the fliC gene in UPEC strains. One study showed the prevalence of the fliC gene in UPEC strains varied from 84% (community-acquired) to 95% (nosocomial-acquired)[12], whereas another study reported that only 16% of the UPEC strains had the fliC gene[13]. Part of the disparity in the frequency of fliC gene prevalence could be due to the respective primers used in each study. Certainly, UPEC flagella are critical for ascension out of the bladder into the kidneys of an animal host. Within a mouse or human urinary tract, UPEC are continuously bathed in urine. Typically, human and murine urine will have a slightly acidic pH and variations in osmolality[14-16], although the osmolality within murine urine is usually higher than human urine[15]. Hence, pH is one critical environmental factor found in the urinary tract.

Within E. coli, homeostasis in an acidic environment is mediated by at least five acid response (AR) systems[17-21]. System two (AR2) is induced in stationary phase and requires a glutamate decarboxylase and a glutamate: γ-aminobutyric acid antiporter. AR2 is the predominant and best characterized of the five AR system pathways[22-25]. The AR2 requires the antiporter GadC and two inducible glutamate decarboxylases: GadA and GadB. The antiporter is responsible for transporting glutamate into the cell while transporting the product of glutamate decarboxylation, glutamate: γ-aminobutyric acid, out of the cell[22,24-30]. GadE, belonging to the LuxR family of regulatory proteins[31], has been identified as the central transcriptional activator of gadA/BC, and provides the primary means of gadA/BC activation[32,33]. Microarray studies done under acidic conditions originally identified the yhiE gene (renamed gadE), which was found to encode for this transcriptional regulator protein[31]. GadE binds to a 20-bp sequence (GAD box: 5’-TTAGGATTTTGTTATTTAAA-3’) located -63 bp from the transcriptional start site of both gadA and the gadBC operon and is necessary for expression of these genes under all conditions[28,34,35].

In this study, we have studied the role GadE may play in E. coli flagella expression. Through the use of a gadE mutant, a fliC-lacZ reporter system, and a motility assay; we demonstrate that GadE regulates transcription of fliC in E. coli, which in turn affects bacterial motility.

MATERIALS AND METHODS
Bacterial strains, plasmids, and media

All of the bacterial strains and plasmids used in this study are listed in Table 1. E. coli strain NU149 is a clinical isolate obtained from a patient with cystitis[36]. The E. coli strain DH5α was used to construct the fliC-lacZ reporter system. E. coli strains MC4100 (supplied by Linda Kenney) and EK227 (supplied by John Foster) were subsequently tested under various pH and osmotic conditions with the fliC-lacZ reporter system. The ΔgadE strain EF1007 and ΔgadE/pPCRScript Amp gadE strain EF1083 were also supplied by John Foster. Multicopy plasmid pUJ9[37] and single copy plasmid pPP2-6[38] were used for cloning. The pUJ9 plasmid contains a promoterless lacZ gene and an ampicillin antibiotic resistance gene. Plasmid pPP2-6 is a single copy plasmid with a multiple cloning site that possesses a chloramphenicol resistance gene[38]. The pPCRScript Amp gadE plasmid had the gadE gene cloned into the multicopy plasmid pPCRScript Amp[33]. Luria Agar (LA) supplemented with 12.5 μg/mL chloramphenicol was used to grow the recombinant E. coli cells containing the reporter system. Luria Bertani (LB) broth containing 1% glycerol at pH’s ranging from 5.5 to 8.0 was used to test pH ranges, and LB broth (pH 5.5 and pH 7.0, 1% glycerol, 0.1 mol/L Na3PO4 buffering) coupled with osmotic variation of 0 to 400 mmol/L NaCl was used to gauge pH plus osmotic changes[38]. Under these growth conditions, the recombinant E. coli strains were assayed for β-galactosidase activity.

Table 1 Bacterial strains and plasmids used in the study.
Strain/plasmidDescriptionSource
Strain
DH5a MCRTransformation efficient strainGibco/BRL
MC4100E. coli K-12 strainLinda Kenney
EK227E. coli K-12 strain[53]
EF1007gadE::Km in EK227[54]
EF1083gadE::Km/pPCRScript Amp gadE[33]
NU149Clinical isolate[36]
NU149 gadEΔgadE mutation in NU149This study
NU149 LacZ1ΔlacZ mutation in NU149This study
Plasmid
pUJ9Promoterless lacZ gene, ApR[37]
pPP2-6Single copy plasmid, CmR[38]
pKD4Flp recombinase sites, KmR[40]
pKD46Red recombinase, ApR[40]
pCP20Flp recombinase, ApR[40]
pNK2-29fliC::lacZ on pPP2-6, ApRThis study
pPCRScript Amp gadEgadE on pPCRScript Amp[33]
Construction of the fliC-lacZ fusion

Oligonucleotide primers FliC1 (5’-GAGAGAATTCGATGAAATACTTGCCATGC-3’) and FliC2 (5’-AGAAGGATCCAGACGCTGGATAGAACTC-3’) specific for a 397-bp segment of the E. coli strain NU149 fliC promoter were amplified with the BamHI and EcoRI restriction endonuclease sites flanking the DNA promoter sequence. Polymerase chain reaction (PCR) amplification using these primers was set up as follows: An initial denaturation of five minutes, then 35 cycles 1 min at 94 ºC, 1 min at 55 ºC, and 1 min at 72 ºC, finishing with a 7 min elongation at 72 ºC after the 35th cycle. Chromosomal DNA from E. coli strain NU149 extracted with a PurElute Bacterial Genomic kit (Edge Biosystems, Mountain View, CA, United States) served as the template in the PCR. The 397-bp product was visualized on a 0.8% agarose gel containing ethidium bromide with a 1 kb ladder (New England Biolabs, Ipswich, MA, United States) served as the molecular weight standard.

The PCR amplified 397-bp fliC promoter DNA fragment was passed through a Microcon 30 filter (MilliporeSigma, Burlington, VT, United States) to concentrate the DNA. Subsequently, the DNA was digested with the restriction endonucleases EcoRI and BamHI (New England Biolabs). The digested DNA fragment was ligated to EcoRI/BamHI digested pUJ9 plasmid DNA and transformed into competent DH5α cells. The resulting transformants were selected on LA containing 100 μg/mL ampicillin and X-Gal (Promega, Madison, WI, United States). Blue colonies were screened for β-galactosidase[39] and the plasmid DNA was extracted with a QIAPrep kit (Qiagen, Valencia, CA, United States) to verify the appropriate size. One recombinant plasmid, pNK1-1, was carried further in the process. This plasmid DNA was digested with the restriction endonuclease NotI (New England Biolabs) and ligated to NotI cut pPP2-6 DNA. Following ligation, the DNA was transformed into DH5α and clones were selected on LA containing 12.5 μg/mL chloramphenicol and X-Gal. One clone, pNK2-29, was selected for in vitro analysis.

Galactosidase assays

Galactosidase assays were performed on DH5α/pNK2-29 and MC4100/pPP2-6 cells grown in LB media at various pH and in the presence and absence of NaCl at pH 5.5 and 7.0[39]. Bacteria were grown mid-logarithmically and β-galactosidase activity on the sodium dodecyl sulfate and CHCl3 permeabilized cells. The mean values + standard deviation was calculated from at least three separate experiments for each bacterial strain.

Creation of a ΔgadE mutation in uropathogenic E. coli strain NU149

To create a deletion mutation of the gadE gene, the red recombinase system described by Datsenko and Wanner[40] was used. Briefly, the primer pair GadE1 (5’GATGACATATTCGAAACGATAACGGCTAAGGAGCAAGTTTGTGTAGGCTGGAGCTGCTTCG-3’) and GadE2 (5’TCGTCATGCCAGCCATGAATTTCAGTTGCTTATGTCCTGACATATGAATATCCTCCTTAG-3’) was used to create a PCR product, using pKD4 plasmid DNA as a template. The PCR conditions that were used were an initial denaturation at 95 ºC for 5 min followed by 35 cycles of 95 ºC, 1 min; 57 ºC, 1 min; and 72 ºC, 2 min. The resulting PCR product was concentrated and separated on a 0.8% agarose gel, cut out, and the DNA extracted from the agarose gel. With this purified PCR product, an electroporation was performed on strain NU149/pKD46 cells as described previously[40], selecting for transformants on LA with 40 μg/mL kanamycin. One transformant, NU149 gadE, was chosen for further analysis. To remove the kanamycin resistance gene, plasmid pCP20 was introduced into NU149 gadE by electroporation. The resulting strain was processed as noted previously[6]. To confirm the gadE deletion, a PCR-based assay was used with the GadE5 (5’-ACAGGGCTTTTGGCAGTTGAA-3’) and GadE6 (5’-AAATATTAGCGTCGACGTGA-3’) primers. The PCR conditions that were used were an initial denaturation at 95 ºC for 5 min followed by 30 cycles of 95 ºC, 1 min; 57 ºC, 1 min; and 72 ºC, 2 min. This ΔgadE mutation was complemented by electroporating the pPCRScript Amp gadE plasmid into NU149 gadE and selecting for transformants on LA with 100 μg/mL ampicillin. The wild-type NU149 strain was used a positive control and Staphylococcus aureus genomic DNA was used as a negative control.

Construction of ΔlacZ mutation in uropathogenic E. coli strain NU149

To construct the ΔlacZ mutation in UPEC strain NU149, the procedure described above was used. The LacZ1 (5’-CCTTACGCGAAATACGGGCAGACATGGCCTGCCCGGTTAT

TACATATGAATATCCTCCTTAG-3’) and LacZ2 (5’-TGGAATTGTGAGCGGATAACAA

TTTCACACAGGAAACAGCTTGTGTAGGCTGGAGCTGCTTCG-3’) primer pair were used to create the PCR product using the amplification conditions noted above. To confirm the ΔlacZ mutation, the LacZ3 (5’-ATGAAACGCCGAGTTAACGC-3’) and LacZ4 (5’-AGCTGGCGTAATAGCGAAGA-3’) primers were used in the PCR amplification conditions described above. Plasmid pNK2-29 was electroporated into strain NU149 and colonies were selected on MacConkey containing 12.5 mg/mL chloramphenicol.

Soft agar assay for motility

A soft agar motility test was performed as previously described[41] for the wild-type vs gadE mutant and complemented mutant analysis. Each strain was inoculated into the center of the agar plate and the amount of bacterial spread measured after 24 h post-inoculation. The motility assays were repeated two more times on separate days.

Statistical analyses

A two-tailed Student’s t-test was used to calculate statistical variation with a P < 0.05 considered significant.

RESULTS
Examination of the fliC::lacZ fusion at different pHs

To assess whether pH affected the transcription of our fliC-lacZ fusion plasmid, the pH of buffered LB medium was adjusted to 5.5 to 8.0 by using 0.1 M Na3PO4 buffering and glycerol to maintain the pH[38]. The resulting media were inoculated with MC4100/pNK2-29 and theβ-galactosidase activities of mid-logarithmic-phase cells were determined. The optimal pH for fliC expression was found to be at pH 7.0 (1111 Miller units; Table 2). As the pH shifted to the acidic range, fliC transcription declined until there was a significant 3.9-fold difference observed comparing fliC transcription at pH 7.0 compared to pH 5.5 (288 Miller units, P < 0.01). When the pH of the buffered LB was raised into the alkaline range, there was a slight decline in fliC transcription that was 1.5-fold lower at pH 8.0 (738 Miller units, P < 0.05) vs growth in pH 7.0 medium. These results indicate that pH alone affects fliC transcription.

Table 2 Effect of pH on fliC::lacZ gene transcription in Escherichia coli strain MC4100/pNK2-29 grown in buffered Luria Bertani media.
pHGal activity1
5.5288 ± 81.5
6528 ± 82.5
6.5629 ± 114
71111 ± 110
7.5932 ± 190
8738 ± 125
Effects of pH and osmotic conditions together on fliC::lacZ transcription

In an environment such as the the human or murine urinary tract, fluctuations in both pH and osmolarity can occur[14-16]. To determine if the combination of acidic pH and high osmolarity affect fliC transcription, MC4100/pNK2-29 was grown in buffered pH with variation in both the pH (5.5 and 7.0) and the osmolarity (0 to 400 mmol/L NaCl). When MC4100/pNK2-29 was grown in pH 7.0/low-osmolarity (0 mmol/L NaCl) LB, fliC transcription was the highest (1,132 Miller units, Table 3). An increase in the osmolarity to 400 mmol/L NaCl in the pH 7.0 LB caused fliC transcription to significantly fall by 2.5-fold (454 Miller units, P < 0.01) compared to growth in the pH 7.0 low-osmolarity LB. E. coli with the pNK2-29 plasmid grown in pH 5.5/low-osmolarity conditions displayed fliC transcription of 308 Miller units (Table 3); however, fliC transcription dropped almost 5-fold to 62 Miller Units (P < 0.01) as the osmolarity increased to 400 mmol/L NaCl. A comparison of fliC transcription in E. coli grown in pH 7.0/low-osmolarity LB to the E. coli population grown in pH 5.5/high-osmolarity LB showed a highly significant 18.2-fold change (P < 0.001). Thus, a growth environment possessing both an acidic pH and high osmolarity substantially repressed fliC transcription in the E. coli K-12 strain.

Table 3 Effect of osmolarity on fliC::lacZ gene transcription in Escherichia coli grown in buffered pH 5.5 and 7.0 Luria Bertani media with different osmolarities.
E. coli strainNaCl (mmol/L)Gal activity1
pH 5.5pH 7.0
MC4100/pNK2-290308 ± 10421132 ± 130
MC4100/pNK2-29100338 ± 128806 ± 41
MC4100/pNK2-29200251 ± 68.5689 ± 173
MC4100/pNK2-2940062 ± 22.0454 ± 71
NU149 LacZ1/pNK2-290442 ± 721353 ± 98
NU149 LacZ1/pNK2-29100418 ± 61976 ± 52
NU149 LacZ1/pNK2-29200293 ± 43811 ± 75
NU149 LacZ1/pNK2-29400147 ± 39489 ± 61

To determine if the same fliC transcriptional changes occurred in a UPEC strain, a ΔlacZ mutation was created in UPEC strain NU149. The pNK2-29 plasmid containing the fliC-lacZ fusion was moved into E. coli strain NU149 LacZ1 and the same environmental conditions tested for the E. coli K-12 strain were used. Growth of NU149 LacZ1/pNK2-29 in pH 7.0 with no added NaCl displayed the highest fliC transcription (1353 Miller Units, Table 3), whereas fliC transcription significantly fell 3.06-fold when the strain was grown in pH 5.5 LB (442 Miller Units, P < 0.01). An increase in the osmolarity to 400 mM NaCl in pH 7.0 LB caused fliC transcription to fall 2.77-fold (489 Miller Units, P < 0.01). Moreover, the growth of NU149 LacZ1/pNK2-29 in pH 5.5 LB with 400 mM added NaCl showed the lowest level of fliC transcription (147 Miller Units) that was 9.2-fold lower than when grown in pH 7.0 no added salt medium (P < 0.01). Overall, the fliC transcription results in the UPEC strain mirrored the E. coli K-12 strain’s results.

Transcription of fliC was affected by the gadE mutation in E. coli grown in acidic pH media

As shown above, acidic pH growth conditions led to lower fliC transcription compared to transcription in neutral pH growth conditions. Previous work has shown that the glutamate decarboxylase system is critical for acid resistance in E. coli and GadE is an important regulator of this AR system[31-33]. We then asked whether GadE might also regulate fliC transcription under acidic growth conditions. We examined an E. coli K-12 wild-type strain, a gadE mutant strain as well as a complemented gadE mutant strain all of which contained the fliC-lacZ pNK2-29 plasmid. The strains were grown in buffered LB set at pH 5.5 or 7.0 with (400 mmol/L) or without (0 mmol/L) added NaCl and monitored for galactosidase activity. Derepression of fliC transcription occurred in the gadE mutant grown in acidic pH LB (Table 4). After growth in pH 5.5/low-osmolarity medium, the gadE mutant strain (1742 Miller units) exhibited a 3.2-fold increase in fliC transcription, compared to the wild-type strain (540 Miller units, P < 0.001), which indicated that GadE repressed fliC under acidic conditions. Complementation with an intact gadE gene reduced the activity below the wild-type levels to 295 Miller units, below even wild-type levels, confirming the repressive effect of GadE on fliC expression. The repressive effect of GadE on fliC expression was reduced in pH 7.0/low-osmolarity medium with the gadE mutant strain showing only slightly higher fliC transcription (2196 Miller units) vs the gadE+ wild-type strain (1520 Miller units, P < 0.01). However, when the growth conditions were changed to a high osmolarity environment (400 mmol/L NaCl), the gadE mutation had no significant effect on fliC transcription (540 Miller units). A change to a pH 5.5/ high-osmolarity environment caused a further repression of fliC transcription (165 Miller units, P < 0.05) that was significant.

Table 4 Assessing a gadE and mutation and complementation on fliC::lacZ gene transcription in Escherichia coli grown in buffered pH 5.5 and 7.0 Luria Bertani media with different osmolarities.
E. coli strainGal activity1
pH 5.5pH 5.52pH 7.0pH 7.0
EK227/pNK2-29540 ± 513165 ± 591520 ± 144540 ± 66
EF1007/pNK2-2941742 ± 109470 ± 1062196 ± 173681 ± 135
EF1083/pNK2-29295 ± 93131 ± 20794 ± 145404 ± 41
A gadE mutation affects uropathogenic E. coli motility

The data above suggested that GadE may repress fliC transcription when E. coli is grown under acidic pH conditions. Since transcriptional differences do not always translate into protein level differences or functional differences, the effects of a gadE mutation on E. coli motility was next tested. First, motility was tested using the E. coli K-12 strain EF227 (wild-type), EK1007 (gadE mutation), and EF1083 (gadE mutation complemented with the pPCRScript Amp gadE plasmid). All strains were grown in pH 5.5 buffered LB and spotted onto motility agar plates. Wild-type E. coli strain EF227 displayed an 8.33 mm spread diameter, whereas strain EF1007 showed a significantly larger spread diameter of 45 mm (P < 0.001, Table 5). When the gadE mutation was complemented in strain 1083, the spread diameter dropped below the wild-type level (6.67 mm diameter).

Table 5 Motility of Escherichia coli strains NU149 and EK227, their gadE mutants, and complemented gadE mutants grown in pH 5.5 Luria Bertani.
StrainMotility (mm)1
NU14910.67 ± 1.252
NU149 gadE57.34 ± 10.21
NU149 gadE/pPCRScript gadE7.00 ± 0.82
EK2278.33 ± 1.52
EF1007 (gadE)45.00 ± 2.00
EF1083 (gadE/pPCRScript gadE)6.67 ± 1.53

A gadE mutation was also created in the uropathogenic E. coli clinical isolate NU149 using a λred recombinase system. The NU149, NU149 gadE, and NU149 gadE/pPCRScript Amp gadE strains were grown in pH 5.5 buffered LB and spotted onto motility agar plates. Wild-type E. coli strain NU149 had a 10.67 mm spread diameter, whereas strain NU149 gadE had a 57.34 mm spread diameter that was significantly wider (P < 0.05). Complementation of the gadE mutation brought the spread diameter back down to a wild-type level (7.00 mm). These results indicate that GadE also affects UPEC motility.

DISCUSSION

The production of flagella in UPEC is vital for their pathogenesis in a human host, enabling the bacteria to ascend the urinary tract[4-7,11]. A transcriptome study of a UPEC strain in the murine urinary tract over time demonstrated that several genes that are involved in flagella biosynthesis and chemotaxis, including the fliC structural gene, had their transcription down-regulated in this environment[42]. Within the urinary tract, the E. coli encounter an environment that typically has a slightly acidic pH and osmotic changes that increase as the bacteria move into the kidneys of the host[14-16]. E. coli is able to survive in acidic pH environments that include the human and murine urinary tracts because of AR systems that include the glutamate decarboxylase system[15-18]. GadE is an important protein that regulates this AR system[31-33]. Since GadE is important for regulating genes in one AR system, could the GadE regulator of the glutamate decarboxylase AR system also be involved in the down-regulation of fliC in uropathogenic E. coli growing in the murine urinary tract?

To answer the question above, we designed a fliC-lacZ reporter system on a single copy number plasmid to measure fliC transcription within E. coli growing in various environments that might be encountered in the urinary tract. Our results showed fliC transcription fell in both E. coli strains grown in a pH 5.5 environment compared to a neutral pH environment, suggesting one or more proteins produced by E. coli growing in an acidic pH environment represses fliC transcription. A previous study revealed a substantial drop in motility by E. coli grown in an acidic environment vs a neutral pH environment[43] that correlates with our experimental observations in this study. Moreover, E. coli growth in a high salt concentration medium also caused repression of fliC transcription. Li et al[44] observed that E. coli grown in a high-osmolarity medium were less motile compared to E. coli grown in a low-osmolarity medium.

A combination of pH changes and osmolarity changes was also examined using our fliC-lacZ system. In a low pH/high-osmolarity medium, the growing E. coli exhibited an additive level of repression of fliC transcription that is in line with the previous transcriptome study[42].

Two environmental variables are at play in a low pH/high-osmolarity environment. To adapt to acidic pH conditions, E. coli rely on AR systems and their corresponding regulators, such as GadE. On the other hand, the OmpR-EnvZ two-component system is the main osmotic stress regulatory system in E. coli[45]. OmpR has been shown to regulate flagella expression[46,47] and is likely partially responsible for repressing fliC transcription in the high-osmolarity environment that we tested. Furthermore, OmpR-regulated genes are tied to the acid response in E. coli and Salmonella enterica[48,49].

Since GadE is a central player in AR system regulation, we examined fliC transcription and motility in gadE mutant strains vs the wild-type strains. By deleting the gadE gene, E. coli fliC transcription was derepressed, particularly in E. coli growing in an acidic pH environment. Complementation of the gadE mutation with the gadE gene on a multicopy plasmid caused additional suppression of fliC transcription that was below wild-type levels. Furthermore, a ΔgadE mutation in K-12 and UPEC strains led to significantly greater motility compared to the wild-type strain. Together, these data suggest that GadE represses fliC transcription either by directly binding to the fliC promoter to repress transcription or acting in an indirect manner by influencing expression of FlhD that in turn regulates fliC[50,51]. However, GadE does not appear to affect osmotic control of fliC transcription.

What would be the advantage of a loss of flagella expression in E. coli growing in the human kidney? Flagella protruding from the surface of E. coli cells represent a target of the host’s immune system. Flagellated E. coli cells are more likely to be phagocytized than no-flagellated cells[52]. E. coli that have reached the kidneys would be in a low pH/high-osmolarity environment where the flagella are no longer needed and may in fact be a detriment to their survival. Through the regulatory effects of the GadE and OmpR proteins, fliC transcription may be shut down, causing the bacterial cells to lose their flagella and be able to hide behind their anti-phagocytic capsules.

ARTICLE HIGHLIGHTS
Research background

Uropathogenic Escherichia coli (UPEC) is the number one cause of urinary tract infection in women. Motility driven by the action of flagella is critical for UPEC pathogenesis. How Escherichia coli (E. coli) adapts to a low pH/high osmolarity environment is essential for the species survival. Acid tolerance systems, such as the System two system, are important for UPEC survival in a low pH environment.

Research motivation

Our key problem to be solved was whether GadE, a part of the acid response two system, regulates transcription of the fliC gene, and in turn, UPEC motility.

Research objectives

Determine whether GadE regulated fliC transcription and subsequent motility of the E. coli.

Research methods

We created a fliC-lacZ reporter system on a single-copy number plasmid and measured b-galactosidase levels in both a K-12 and UPEC clinical isolate. Furthermore, motility was assessed in both E. coli strains by inoculating wild-type, gadE mutant, and complemented gadE mutant strains onto motility agar.

Research results

Transcription of fliC was significantly lower in E. coli grown in pH 5.5 Luria Bertani compared to pH 7.0 Luria Bertani. A mutation in the gadE gene led to higher fliC expression in that strain vs wild-type bacteria. Motility was significantly higher in the gadE mutant strain compared to the wild-type strain.

Research conclusions

We confirmed that fliC transcription was down-regulated in E. coli grown in a low pH/high osmolarity environment compared to a neutral pH/low osmolarity environment. GadE appears to either directly or indirectly regulate fliC transcription in E. coli.

Research perspectives

Future work could be done to affirm the GadE regulation of flagella expression in E. coli.

ACKNOWLEDGEMENTS

The authors wish to thank John Foster for a critical reading of the manuscript. We wish to thank Linda Kenney (MC4100) and John Foster (EK227, EF1007, EF1083) for strains used in this study.

References
1.  Foxman B. The epidemiology of urinary tract infection. Nat Rev Urol. 2010;7:653-660.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1335]  [Cited by in RCA: 1082]  [Article Influence: 67.6]  [Reference Citation Analysis (0)]
2.  Foxman B. Urinary tract infection syndromes: occurrence, recurrence, bacteriology, risk factors, and disease burden. Infect Dis Clin North Am. 2014;28:1-13.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1088]  [Cited by in RCA: 887]  [Article Influence: 73.9]  [Reference Citation Analysis (0)]
3.  Schappert SM, Rechtsteiner EA. Ambulatory medical care utilization estimates for 2007. Vital Health Stat 13. 2011;1-38.  [PubMed]  [DOI]
4.  Lane MC, Alteri CJ, Smith SN, Mobley HL. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci USA. 2007;104:16669-16674.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 366]  [Cited by in RCA: 324]  [Article Influence: 17.1]  [Reference Citation Analysis (0)]
5.  Lane MC, Lockatell V, Monterosso G, Lamphier D, Weinert J, Hebel JR, Johnson DE, Mobley HL. Role of motility in the colonization of uropathogenic Escherichia coli in the urinary tract. Infect Immun. 2005;73:7644-7656.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 212]  [Cited by in RCA: 184]  [Article Influence: 8.8]  [Reference Citation Analysis (0)]
6.  Schwan WR. Flagella allow uropathogenic Escherichia coli ascension into murine kidneys. Int J Med Microbiol. 2008;298:441-447.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 35]  [Cited by in RCA: 34]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
7.  Wright KJ, Seed PC, Hultgren SJ. Uropathogenic Escherichia coli flagella aid in efficient urinary tract colonization. Infect Immun. 2005;73:7657-7668.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 204]  [Cited by in RCA: 183]  [Article Influence: 8.7]  [Reference Citation Analysis (0)]
8.  Iino T. Genetics of structure and function of bacterial flagella. Annu Rev Genet. 1977;11:161-182.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 120]  [Cited by in RCA: 113]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
9.  Jones CJ, Aizawa S. The bacterial flagellum and flagellar motor: structure, assembly and function. Adv Microb Physiol. 1991;32:109-172.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 144]  [Cited by in RCA: 117]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
10.  Silverman M, Simon MI. Bacterial flagella. Annu Rev Microbiol. 1977;31:397-419.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 138]  [Cited by in RCA: 117]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
11.  Haugen BJ, Pellett S, Redford P, Hamilton HL, Roesch PL, Welch RA. In vivo gene expression analysis identifies genes required for enhanced colonization of the mouse urinary tract by uropathogenic Escherichia coli strain CFT073 dsdA. Infect Immun. 2007;75:278-289.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 77]  [Cited by in RCA: 68]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
12.  De Souza GM, Neto ERDS, da Silva AM, Iacia MVMS, Rodrigues MVP, Cataneli Pereira V, Winkelstroter LK. Comparative Study Of Genetic Diversity, Virulence Genotype, Biofilm Formation And Antimicrobial Resistance Of Uropathogenic Escherichia coli (UPEC) Isolated From Nosocomial And Community Acquired Urinary Tract Infections. Infect Drug Resist. 2019;12:3595-3606.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 20]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
13.  Zhao L, Gao S, Huan H, Xu X, Zhu X, Yang W, Gao Q, Liu X. Comparison of virulence factors and expression of specific genes between uropathogenic Escherichia coli and avian pathogenic E. coli in a murine urinary tract infection model and a chicken challenge model. Microbiology. 2009;155:1634-1644.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 96]  [Cited by in RCA: 88]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
14.  Kunin CM, Chambers ST, Kass E, Svanborg Eden C. Osmoprotective properties for bacteria of renal papilla and urine: role of betaines as osmoprotectant molecules. In: Kass E, Svanborg Eden C. Host-parasite interactions in urinary tract infections. Kass E, Svanborg Eden C.  Illinois: Chicago, 1989: 327-332.  [PubMed]  [DOI]
15.  Loeb WF, Quimby FW. The clinical chemistry of laboratory animals.  Pergamon Press: New York, 1989.  [PubMed]  [DOI]
16.  Ross DL, Neely AE. Textbook of urinalysis and bodily fluids.  Virginia: Norwalk, 1983.  [PubMed]  [DOI]
17.  Foster JW. Escherichia coli acid resistance: tales of an amateur acidophile. Nat Rev Microbiol. 2004;2:898-907.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 804]  [Cited by in RCA: 669]  [Article Influence: 30.4]  [Reference Citation Analysis (0)]
18.  Lin J, Lee IS, Frey J, Slonczewski JL, Foster JW. Comparative analysis of extreme acid survival in Salmonella typhimurium, Shigella flexneri, and Escherichia coli. J Bacteriol. 1995;177:4097-4104.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 467]  [Cited by in RCA: 409]  [Article Influence: 13.2]  [Reference Citation Analysis (0)]
19.  Lin J, Smith MP, Chapin KC, Baik HS, Bennett GN, Foster JW. Mechanisms of acid resistance in enterohemorrhagic Escherichia coli. Appl Environ Microbiol. 1996;62:3094-3100.  [PubMed]  [DOI]
20.  Richard HT, Foster JW. Acid resistance in Escherichia coli. Adv Appl Microbiol. 2003;52:167-186.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 141]  [Cited by in RCA: 121]  [Article Influence: 5.3]  [Reference Citation Analysis (0)]
21.  Li Z, Jiang B, Zhang X, Yang Y, Hardwidge PR, Ren W, Zhu G. The role of bacterial cell envelope structures in acid stress resistance in E. coli. Appl Microbiol Biotechnol. 2020;104:2911-2921.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 25]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
22.  Castanie-Cornet MP, Penfound TA, Smith D, Elliott JF, Foster JW. Control of acid resistance in Escherichia coli. J Bacteriol. 1999;181:3525-3535.  [PubMed]  [DOI]
23.  Foster JW. When protons attack: microbial strategies of acid adaptation. Curr Opin Microbiol. 1999;2:170-174.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 151]  [Cited by in RCA: 124]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
24.  Pennacchietti E, D'Alonzo C, Freddi L, Occhialini A, De Biase D. The Glutaminase-Dependent Acid Resistance System: Qualitative and Quantitative Assays and Analysis of Its Distribution in Enteric Bacteria. Front Microbiol. 2018;9:2869.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 56]  [Cited by in RCA: 42]  [Article Influence: 5.3]  [Reference Citation Analysis (0)]
25.  Chen L, Zhao X, Wu J, Liu Q, Pang X, Yang H. Metabolic characterisation of eight Escherichia coli strains including "Big Six" and acidic responses of selected strains revealed by NMR spectroscopy. Food Microbiol. 2020;88:103399.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 77]  [Cited by in RCA: 63]  [Article Influence: 10.5]  [Reference Citation Analysis (0)]
26.  De Biase D, Pennacchietti E. Glutamate decarboxylase-dependent acid resistance in orally acquired bacteria: function, distribution and biomedical implications of the gadBC operon. Mol Microbiol. 2012;86:770-786.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 167]  [Cited by in RCA: 131]  [Article Influence: 9.4]  [Reference Citation Analysis (0)]
27.  De Biase D, Tramonti A, John RA, Bossa F. Isolation, overexpression, and biochemical characterization of the two isoforms of glutamic acid decarboxylase from Escherichia coli. Protein Expr Purif. 1996;8:430-438.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 88]  [Cited by in RCA: 82]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
28.  Hersh BM, Farooq FT, Barstad DN, Blankenhorn DL, Slonczewski JL. A glutamate-dependent acid resistance gene in Escherichia coli. J Bacteriol. 1996;178:3978-3981.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 203]  [Cited by in RCA: 188]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
29.  Masuda N, Church GM. Regulatory network of acid resistance genes in Escherichia coli. Mol Microbiol. 2003;48:699-712.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 245]  [Cited by in RCA: 214]  [Article Influence: 9.3]  [Reference Citation Analysis (0)]
30.  Smith DK, Kassam T, Singh B, Elliott JF. Escherichia coli has two homologous glutamate decarboxylase genes that map to distinct loci. J Bacteriol. 1992;174:5820-5826.  [PubMed]  [DOI]
31.  Hommais F, Krin E, Coppée JY, Lacroix C, Yeramian E, Danchin A, Bertin P. GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli. Microbiology. 2004;150:61-72.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 157]  [Cited by in RCA: 143]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
32.  Castanie-Cornet MP, Foster JW. Escherichia coli acid resistance: cAMP receptor protein and a 20 bp cis-acting sequence control pH and stationary phase expression of the gadA and gadBC glutamate decarboxylase genes. Microbiology. 2001;147:709-715.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 141]  [Cited by in RCA: 130]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
33.  Ma Z, Gong S, Richard H, Tucker DL, Conway T, Foster JW. GadE (YhiE) activates glutamate decarboxylase-dependent acid resistance in Escherichia coli K-12. Mol Microbiol. 2003;49:1309-1320.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 170]  [Cited by in RCA: 149]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
34.  Castanié-Cornet MP, Treffandier H, Francez-Charlot A, Gutierrez C, Cam K. The glutamate-dependent acid resistance system in Escherichia coli: essential and dual role of the His-Asp phosphorelay RcsCDB/AF. Microbiology. 2007;153:238-246.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 64]  [Cited by in RCA: 60]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
35.  Castanié-Cornet MP, Cam K, Bastiat B, Cros A, Bordes P, Gutierrez C. Acid stress response in Escherichia coli: mechanism of regulation of gadA transcription by RcsB and GadE. Nucleic Acids Res. 2010;38:3546-3554.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 130]  [Cited by in RCA: 112]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
36.  Schaeffer AJ, Schwan WR, Hultgren SJ, Duncan JL. Relationship of type 1 pilus expression in Escherichia coli to ascending urinary tract infections in mice. Infect Immun. 1987;55:373-380.  [PubMed]  [DOI]
37.  de Lorenzo V, Herrero M, Jakubzik U, Timmis KN. Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria. J Bacteriol. 1990;172:6568-6572.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1151]  [Cited by in RCA: 1113]  [Article Influence: 30.9]  [Reference Citation Analysis (0)]
38.  Schwan WR, Lee JL, Lenard FA, Matthews BT, Beck MT. Osmolarity and pH growth conditions regulate fim gene transcription and type 1 pilus expression in uropathogenic Escherichia coli. Infect Immun. 2002;70:1391-1402.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 119]  [Cited by in RCA: 106]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
39.  Miller JH. Experiments in molecular genetics.  Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1972.  [PubMed]  [DOI]
40.  Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA. 2000;97:6640-6645.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 13901]  [Cited by in RCA: 12454]  [Article Influence: 479.0]  [Reference Citation Analysis (0)]
41.  Craven RC, Montie TC. Motility and chemotaxis of three strains of Pseudomonas aeruginosa used for virulence studies. Can J Microbiol. 1981;27:458-460.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 37]  [Cited by in RCA: 34]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
42.  Snyder JA, Haugen BJ, Buckles EL, Lockatell CV, Johnson DE, Donnenberg MS, Welch RA, Mobley HL. Transcriptome of uropathogenic Escherichia coli during urinary tract infection. Infect Immun. 2004;72:6373-6381.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 334]  [Cited by in RCA: 299]  [Article Influence: 13.6]  [Reference Citation Analysis (0)]
43.  Adler J, Templeton B. The effect of environmental conditions on the motility of Escherichia coli. J Gen Microbiol. 1967;46:175-184.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 335]  [Cited by in RCA: 276]  [Article Influence: 4.7]  [Reference Citation Analysis (0)]
44.  Li C, Louise CJ, Shi W, Adler J. Adverse conditions which cause lack of flagella in Escherichia coli. J Bacteriol. 1993;175:2229-2235.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 82]  [Cited by in RCA: 79]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
45.  Igo MM, Slauch JM, Silhavy TJ. Signal transduction in bacteria: kinases that control gene expression. New Biol. 1990;2:5-9.  [PubMed]  [DOI]
46.  Shin S, Park C. Modulation of flagellar expression in Escherichia coli by acetyl phosphate and the osmoregulator OmpR. J Bacteriol. 1995;177:4696-4702.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 253]  [Cited by in RCA: 236]  [Article Influence: 7.6]  [Reference Citation Analysis (0)]
47.  Prüss BM, Wolfe AJ. Regulation of acetyl phosphate synthesis and degradation, and the control of flagellar expression in Escherichia coli. Mol Microbiol. 1994;12:973-984.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 139]  [Cited by in RCA: 137]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
48.  Bang IS, Audia JP, Park YK, Foster JW. Autoinduction of the ompR response regulator by acid shock and control of the Salmonella enterica acid tolerance response. Mol Microbiol. 2002;44:1235-1250.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 100]  [Cited by in RCA: 94]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
49.  Chakraborty S, Kenney LJ. A New Role of OmpR in Acid and Osmotic Stress in Salmonella and E. coli. Front Microbiol. 2018;9:2656.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 101]  [Cited by in RCA: 79]  [Article Influence: 9.9]  [Reference Citation Analysis (0)]
50.  Prüß BM. Involvement of Two-Component Signaling on Bacterial Motility and Biofilm Development. J Bacteriol. 2017;199:e00259-17.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 93]  [Cited by in RCA: 77]  [Article Influence: 8.6]  [Reference Citation Analysis (0)]
51.  Prüss BM, Besemann C, Denton A, Wolfe AJ. A complex transcription network controls the early stages of biofilm development by Escherichia coli. J Bacteriol. 2006;188:3731-3739.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 139]  [Cited by in RCA: 122]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
52.  Sharon N, Eshdat Y, Silverblatt FJ, Ofek I. Bacterial adherence to cell surface sugars. Ciba Found Symp. 1981;80:119-141.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 17]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
53.  McCann MP, Kidwell JP, Matin A. The putative sigma factor KatF has a central role in development of starvation-mediated general resistance in Escherichia coli. J Bacteriol. 1991;173:4188-4194.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 275]  [Cited by in RCA: 252]  [Article Influence: 7.2]  [Reference Citation Analysis (0)]
54.  Tucker DL, Tucker N, Conway T. Gene expression profiling of the pH response in Escherichia coli. J Bacteriol. 2002;184:6551-6558.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 200]  [Cited by in RCA: 191]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
Footnotes

Open-Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/

Manuscript source: Invited Manuscript

Specialty type: Infectious diseases

Country/Territory of origin: United States

Peer-review report’s scientific quality classification

Grade A (Excellent): 0

Grade B (Very good): B, B

Grade C (Good): C

Grade D (Fair): 0

Grade E (Poor): 0

P-Reviewer: García-Elorriaga G, Nagata T, Song G S-Editor: Wang J L-Editor: A E-Editor: Liu JH

Write to the Help Desk