BPG is committed to discovery and dissemination of knowledge
Prospective Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Exp Med. Dec 20, 2025; 15(4): 107843
Published online Dec 20, 2025. doi: 10.5493/wjem.v15.i4.107843
Association of inflammatory, genetic, and epigenetic markers with Kellgren-Lawrence grading in post-traumatic osteoarthritis of knee: A protocol
Keerthy Rethinam Meenakshi Sundaram, Santhi Silambanan, Department of Biochemistry, Sri Ramachandra Institute of Higher Education and Research, Chennai 600116, Tamil Nādu, India
Thiagarajan Keddin Alwar, Department of Arthroscopy and Sports Medicine, Sri Ramachandra Institute of Higher Education and Research, Chennai 600116, Tamil Nādu, India
Ramchand Nannapan, Saksin Lifesciences Pvt Ltd, Chennai 600113, Tamil Nādu, India
Vinodhini Vellore Mohanakrishnan, Department of Biochemistry, SRM Medical College Hospital and Research Centre, Chennai 603203, Tamil Nādu, India
ORCID number: Keerthy Rethinam Meenakshi Sundaram (0000-0001-8911-3324); Thiagarajan Keddin Alwar (0000-0001-5675-0220); Ramchand Nannapan (0009-0005-0783-0976); Vinodhini Vellore Mohanakrishnan (0000-0002-2375-7917); Santhi Silambanan (0000-0003-0720-6063).
Author contributions: Sundaram KRM, Alwar TK, Nanappan R, Mohanakrishnan VV and Silambanan S designed the research study; Sundaram KRM, Alwar TK, Nanappan R and Silambanan S performed the research; Sundaram KRM, and Silambanan S contributed new reagents and analytic tools; Sundaram KRM, Alwar TK, Nanappan R, Mohanakrishnan VV and Silambanan S analyzed the data and wrote the manuscript; All authors have read and approved the final manuscript.
Supported by ICMR, No. U04M200059.
Institutional review board statement: The study is approved by the Institutional Ethics Committee of Sri Ramachandra Institute of Higher Education and Research, Porur, Chennai (CSP-MED/21/JAN/65/03, dated 11.02.2021).
Clinical trial registration statement: The study is registered with Indian Council of Medical Research, India, CTRI/2025/03/083060 (https://ctri.nic.in/Clinicaltrials/Login.php).
Informed consent statement: Written informed consent is obtained.
Conflict-of-interest statement: All authors declare that there were no conflicts of interest.
CONSORT 2010 statement: The authors have read the CONSORT 2010 statement, and the manuscript was prepared and revised according to the CONSORT 2010 statement.
Data sharing statement: All the required data are provided in the article itself.
Corresponding author: Santhi Silambanan, MD, Professor, Department of Biochemistry, Sri Ramachandra Institute of Higher Education and Research, Chennai 600116, Tamil Nādu, India. santhisilambanan@sriramachandra.edu.in
Received: April 2, 2025
Revised: May 14, 2025
Accepted: August 14, 2025
Published online: December 20, 2025
Processing time: 265 Days and 8.3 Hours

Abstract
BACKGROUND

Post-traumatic osteoarthritis (PTOA) occurs due to cartilage degeneration caused by injuries like bone fractures, ligament tears, and soft tissue injuries in and around the joint. It is diagnosed by X-ray in the later stages. Early diagnosis may be possible by analyzing biochemical and molecular markers, facilitating early management.

AIM

To characterize inflammatory, genetic, and epigenetic markers that aid in the diagnosis and prognosis of knee PTOA.

METHODS

The prospective cohort study is conducted at a tertiary care hospital, India. The study includes 140 participants: 70 (controls), and 70 (cases) sustained trauma to knee. Written informed consent is obtained. Serum interleukin (IL)-6, IL-1β, IL-10, cartilage oligomeric matrix protein, transforming growth factor-β1, matrix metalloproteinase-13, and oxidized-LDL and urine C-terminal cross-linked telopeptides of type II collagen are analyzed by ELISA. Genetic and epigenetic studies are done. Ethics approval is obtained. Statistical analysis by SPSS software version 16.

RESULTS

Biomarkers will be correlated with the X-ray grading as per the Kellgren-Lawrence scale.

CONCLUSION

These mediators can be potential markers to assess the disease burden, prognosis, and severity. They may also help as therapeutic targets to customize personalized therapy.

Key Words: Biomarkers; Cytokines; Inflammation; Knee joint; Osteoarthritis

Core Tip: Post-traumatic osteoarthritis (PTOA) is a secondary osteoarthritis that follows a joint injury. The knee is the most frequently affected joint, and the extent of injury ranges from simple to complex. PTOA is characterized by joint pain, swelling, and restricted movement. It is diagnosed beyond stage 2 of the Kellgren-Lawrence grading system, as evidenced by an X-ray. The disease begins after the joint injury, which further progresses due to complex biochemical interactions of cytokines, oxidative stress markers, enzymes, and collagen breakdown products. These markers can help us in a multidisciplinary approach thus emphasizing early intervention, biomarker-guided therapies, and mechanical stabilization thus, improving patient outcomes.



INTRODUCTION

Osteoarthritis (OA) is characterized by destruction of cartilage, bone and other structures involved in the joint. Various risk factors like advancing age, joint injuries, joint malformations, obesity, genetic factors, and autoimmune disorders contribute to the disease. Arthritis occurring after joint injury is called post-traumatic osteoarthritis (PTOA); and it has been recognized as a separate clinical entity of osteoarthritis. Worldwide, individuals affected by the disease has risen by 113%, from 1990 to 2019 (528 million)[1]. The year 2024 has highlighted the growing global impact of osteoarthritis, currently affecting around 7.6% of the world's population, with predictions indicating a 60% to 100% rise by 2050[2]. In India, approximately 23.46 million were found to have OA in 1990, which increased by almost three-fold in three decades. Also, disability adjusted life years because of OA raised from 0.79 to 2.12 million. Knee OA was the most common form of OA, followed by hand and hip OA[3]. The burden of PTOA is approximately 12% of all OA[4]. Individuals who have sustained knee injuries are 4.2 times more prone to the development of knee osteoarthritis compared to those who have not experienced such injuries[4]. Alterations in the joint biomechanics following an injury increase the patient's susceptibility to the gradual deterioration of the joint architecture and function.

Knee joint injuries

Knee injuries are a common occurrence, with the potential to significantly impact one's mobility and quality of life. In individuals with anatomically normal knee joints, dislocations generally result from severe traumatic events, including falls from height, automobile accidents, and contact injuries during athletic activities. The knee is a complex arrangement of many important structures. It is a modified hinge joint allowing flexion and extension with a small degree of medial and lateral rotation. Knee trauma primarily manifests as fractures affecting the surrounding bones, joint dislocations, and damage to soft tissue structures in the form of ligament sprains and tears. In many instances, injuries involve more than one structure in the knee. The time frame between the injury and the onset of clinical features of OA may range from six months to few years. On an average, it takes around 16 months after cruciate ligament injury, 12 months after meniscal tear and 8 months after fracture to develop PTOA. Individuals who have sustained knee injuries are at four-fold risk of the development of knee osteoarthritis compared to those who have not experienced such injuries[5]. Approximately 30% of knee post-traumatic osteoarthritis is attributed to fractures in the knee, while meniscal injuries and tears contribute to 26% of cases[6]. These injury patterns typically result from high-force traumatic events, including falls from heights and automobile accidents.

Among sports-related knee injuries, the anterior cruciate ligament (ACL) rupture is found to be the commonest injury[7]. Athletes who compete in physically demanding sports such as soccer, football, and basketball face a higher risk of sustaining ACL injuries. The extreme anterior force exerted on the flexed knee's proximal tibia is the primary cause of injuries to the posterior cruciate ligament. This often occurs in dashboard injuries during motor vehicle crashes and common sports-related injuries[8]. Other injuries, like injuries to collateral ligaments, are usually caused by contact injuries. ACL and meniscal injuries pose a substantial risk for the development of PTOA. Following an ACL injury, the likelihood of grade III or IV radiologic changes in the Kellgren-Lawrence (KL) classification system is nearly five times higher than the contralateral knee with no history of ACL injury[9]. Modified loading to the joint causes subsequent changes locally as well as systemically involving an imbalance in the catabolic and anabolic factors leading to osteoarthritis.

Diagnosis of osteoarthritis

Symptomatic osteoarthritis is characterized by the combination of radiographic evidence of OA along with clinical manifestations such as joint pain, stiffness, and functional limitations. It is important to note that not all the patients with radiographic osteoarthritis will develop symptomatic disease. Diagnosis of PTOA is done by history of trauma to the knee joint along with joint features like pain, swelling, and stiffness. Imaging studies such as magnetic resonance imaging (MRI) and X-ray can assess the extent and type of injury in the joint. The loss of cartilage and degeneration of joint is best visualized by these imaging studies. X-ray has been the investigation of choice to diagnose osteoarthritis. According to Kellgren and Lawrence in 1957, the X-ray findings of OA are categorized into four grades ranging from I to IV based on the radiological visualization of joint width and joint surface destruction (Figure 1 and Table 1). X-ray is cost-effective and readily available as an out-patient investigation tool. The KL scale does not consider the symptoms when defining the severity of OA; however, early stages do not present with clinical symptoms[9,10].

Figure 1
Figure 1 Kellgren Lawrence Grades 1 to 4 from left to right[10]. Citation: Kellgren JH, Lawrence JS. Radiological assessment of osteo-arthrosis. Ann Rheum Dis 1957; 16: 494–502 Copyright© The Authors 1957. Published by Elsevier. The authors have obtained the permission for figure using from the Elsevier (Supplementary material).
Table 1 Kellgren-Lawrence radiographic osteoarthritis grading[10].
Grades
Changes seen in X-ray
Grade 0None. Absence of X-ray changes
Grade 1Not severe. Doubtful narrowing of joint space and possible osteophytic lining
Grade 2Minimal severity. Definite osteophytes and possible narrowing of joint space
Grade 3Moderate severity. Moderate multiple osteophytes, definite narrowing of joint space and some sclerosis and possible deformity of bone ends
Grade 4Severe. Large osteophytes, marked narrowing of joint space, severe sclerosis and definite deformity of bone ends

The MRI is used to detect the presence of cartilage and bone marrow lesions, osteophytes, and effusion; but no standard MRI–based definition of OA exists and it also involves huge cost to the patient. The Western Ontario and McMaster Universities (WOMAC) index, which can be done by the patients themselves independently, represents the most widely utilized clinical assessment tool for evaluating the individuals with knee osteoarthritis. It consists of five questions about pain, two about stiffness, and 17 on the degree of disability of activities of daily living[11]. Visual analogue score (VAS) is used to assess the pain while WOMAC score is widely used score to assess the pain, function and disability[12].

Lacunae in research

The rising incidence, late-onset, heterogeneity in the rate of progression, and inherent natural course of PTOA necessitate a comprehensive and in-depth understanding of the pathology of the disease. The disease often progresses silently, with patients becoming symptomatic only after considerable damage has taken place. PTOA emerges after joint injuries, predominantly affecting the knee joint. Joint injuries lead to alterations in neuromuscular control and biomechanics surrounding the affected joint, potentially contributing to cartilage degradation. It also poses a substantial public health and economic burden. Radiographic techniques and physical examinations only detect few individuals, particularly in the advanced stages of KL grading. Also, the KL grading exhibit low inter-rater reliability. By the time radiographic evidence becomes evident, most likely significant joint damage would have occurred. The practical application of magnetic resonance imaging may be limited by financial considerations, accessibility issues, and the lack of a standardized, and validated MRI-based scoring system for osteoarthritis. The time frame in which clinically measurable PTOA develops varies widely, ranging from two years in cases of articular fractures to even decades for less severe joint injuries. Currently, there is no longitudinal prospective study in India that investigates the role of biomarkers and genetic markers in post-traumatic osteoarthritis. The research question of the study is -Can we predict the progression of PTOA based on the alterations in levels of inflammatory, genetic, and epigenetic markers? Do biomarkers have the potential to serve as a quantitative measure of the pathological processes linked to OA?

MATERIALS AND METHODS
Study design

It is a prospective cohort study, which includes 70 controls and 70 cases. Sample size is calculated based on the knee pain prevalence with OA and without OA[13].

Primary objectives

(1) To analyse the levels of pro- and anti-inflammatory markers, collagen and non-collagenous markers and oxidative stress markers in the blood and urine of individuals with knee injury; (2) To evaluate the association of these biomarkers with the KL grading; (3) To analyse the association of microRNAs in serum and gene polymorphisms with KL grading; and (4) To arrive at the cut-off levels of inflammatory and collagen markers in patients with knee injury.

Inclusion criteria

Individuals of age between 20 and 50 years of both genders; control participants include individuals with (1) No family history of OA; and (2) No history of trauma to the knee joints; and cases included patients with history of injury to the knee joint (unilateral) within three months in the past.

Exclusion criteria (both cases and controls)

Individuals with autoimmune disorders, post -menopausal women, osteomyelitis/tumor/septic arthritis, metabolic/systemic illnesses- hyperthyroidism, hyperparathyroidism, Cushing’s syndrome, liver, renal and cardiovascular diseases, diabetes mellitus, hypertension, infections anywhere in the body, intake of anticancer, anti-metabolite drugs, hormone replacement therapy, oral contraceptives, calcium, vitamin D supplements, intra-articular steroids, and visco supplementation (hyaluronan) in the past three months.

Ethics statement

All procedures conducted involving human participants will be adhered to the ethical guidelines set by the institutional and/or national research committee, as well as the principles outlined in the 1964 Helsinki Declaration and its subsequent amendments or equivalent ethical standards. The study is approved by the Institutional Ethics Committee of Sri Ramachandra Institute of Higher Education and Research, Porur, Chennai (CSP-MED/21/JAN/65/03, dated 11.02.2021).

Induction of patients into the study

The study participants will be inducted into the study after giving written informed consent. They are identified by the consultants in the departments of Arthroscopy and Sports Medicine. All the participants are subjected to clinical examination, objective pain scoring, standard knee outcome score - VAS and WOMAC. The detailed protocol is given in Figure 2.

Figure 2
Figure 2 Flowchart of induction of participants into research. OA: Osteoarthritis; VAS: Visual analog score; WOMAC: Western Ontorio and McMaster universities osteoarthritis index; KL: Kellgren Lawrence; SNP: Single nucleotide polymorphism.
Analysis of biochemical markers

Biochemical markers namely serum IL-1beta, IL-6, TGF-beta 1, IL-10, COMP, oxidized-LDL, and MMP-13 are analyzed by ELISA methods. The details of the method and the method specifications are given in Tables 2 and 3.

Table 2 List of biomarkers to be analyzed in the study.
Biomarkers
Variable
Method of analysis
CytokinesSerum IL-1β, IL-6, IL-10ELISA
Collagen markersUrine CTX-IIELISA
Non collagenous proteinsSerum COMPELISA
Growth factorsSerum TGF-beta1ELISA
Oxidative stress markersSerum oxidized-LDLELISA
EnzymesSerum MMP13ELISA
miRNAPlasma miR-146a-5p, miR-34a-5pqRT-PCR
Genetic studies- SNPPlasma GDF5, SMAD4PCR
Table 3 Method specifications of analysis of biomarkers.
Biomarker
Company code no
Measurement range
Sensitivity
CV% (Intra assay)
CV% (Inter assay)
IL-6Elabscience E-EL-H61561.56-100 pg/mL0.94 pg/mL4.4-5.73.0-6.4
IL-1Diaclone 850.006.09615.6-500 pg/mL6.6 pg/mL4.5-5.38.7-9.9
IL-10Diaclone 950.06012.5-400 pg/mL4.9 pg/mL3.5-6.57.5-10.0
TGF-beta 1Elabscience E-EL-01620.16-10 ng/mL0.1 ng/mL4.4-4.84.7-6.3
MMP13Elabscience E-El-H602315.63-1000 pg/mL9.38 pg/mL4.5-5.34.7-5.7
Oxidized LDLElabscience E-EL-H-065462.5-4000 pg/mL37.5 pg/mL4.6-5.84.8-5.3
CTX-IIElabscience E-EL-H08370.16-10 ng/mL0.09 ng/mL3.0-6.04.76-6
COMPElabsience E-EL-H06540.63-40 ng/mL0.38 ng/mL 4.8-6.85.8-8.6
Analysis of microRNAs

MicroRNAs are obtained from serum of all the participants. Relative gene expression of miR-146a-5p and miR-34a-5p are analyzed. Extraction of microRNA is done by PureFast® miRNA mini spin purification kit. Kit contains Carrier RNA, Lysis buffer, Wash Buffer-1, Wash Buffer-2, Spin columns with collection tube and elution buffer. The analysis is done by HELINI miRNA Real-time kit from HELINI Biomolecules, Chennai, India.

RNA extraction from serum samples: In a 2 mL centrifuge tube, 0.2 mL of serum is mixed briefly, and incubated at room temperature for five minutes. Then, 0.2 mL of chloroform is added, followed by vigorous vortexing, then incubated for five minutes at room temperature. The sample is centrifuged at 12000 rpm for five minutes at 4 ℃ to allow phase separation. The upper aqueous phase, containing RNA, is transferred to a fresh 2 mL microcentrifuge tube without disturbing the interphase. The 1.5 volumes of 100% ethanol will be added, and mixed thoroughly. The solution is loaded in two batches onto a Purefast® spin column, followed by centrifugation at 10000 rpm for one minute at room temperature after each load. The flow-through will be discarded after each spin.

The spin column is washed as follows: A 500 μL of wash buffer 1 is added and centrifuged at 10000 rpm for one minute. A 500 μL of wash buffer 2 is added and centrifuged again at 10000 rpm for one minute. A final dry spin will be performed at 12000 rpm for two minutes to remove residual ethanol. For elution, 30 μL of elution buffer is added to the center of the spin column membrane. After incubation for two minutes at room temperature, the column is centrifuged at 10000 rpm for one minute to elute the RNA. The purified RNA is stored at -80 °C until further analysis.

Method of analysis

miRNA selection and primer D design: The primers to be used are TGAGAACTGAATTCCATAGGCT for miR-146a-5p and: TGGCAGTGTCTTAGCTGGTTGT for miR-34a-5p.

cDNA synthesis: cDNA is synthesized from the total RNA using the following mix with components- cDNA Mix-6 μL; miRNA cDNA Primer Mix -2 μL; RT Enzyme Mix -2 μL; Purified RNA sample -10 μL; 2 μL of Water is added instead of purified RT-enzyme mix. Samples are centrifuged briefly and subjected to thermal cycling; 25 ℃ for 15 minutes; 42 ℃ for one hour.

Quantitative polymerase chain reaction reaction: The real time polymerase chain reaction (PCR) is prepared with mix of components as follows: Probe PCR Master Mix-10 μL; miRNA PP Mix-5 μL; PCR grade water-7.5 μL; cDNA -2.5 μL.

Negative controls use nuclease free water, and the positive control includes manufacturer -supplied positive miRNA controls. Quantitative polymerase chain reaction (qPCR) is performed using the FAM detection channel under the following thermal profile: Taq enzyme activation -95 ℃-15 minutes -45 cycles; Denaturation -95 ℃-20 seconds; Annealing/Data collection-60 ℃-20 seconds; Extension-72 ℃-20 seconds. Relative quantification of miRNA is performed using the qPCR software.

Genomic DNA extraction and single nucleotide polymorphism genotyping

DNA extraction: DNA is isolated from EDTA -blood using QIAamp® DNA Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol. Briefly, RBCs are lysed using AL buffer and Proteinase K, followed by ethanol precipitation and spin column purification. DNA quality and quantity is verified using Nanodrop spectrophotometry and Agarose gel electrophoresis.

Single nucleotide polymorphism analysis

Two single nucleotide polymorphisms (SNPs) are analyzed: SMAD3 rs12901499: 1290F- TTAAAGCAGGGGAGTGGCAC, 1290R- TAATTTGGGGGCCTGTGCTT; GDF5 rs143383: 1433F- CAGGCCTGTGAGTGTGTGTG, 1433R- CAGCAGTAGCAGCAGAAGGA.

PCR is performed with a total of 20 mL reaction mixture containing 40 ng DNA, 2 mL of 10 pmole/mL concentration of each primer, with 10 mL of Promega 2× Go Taq master mix. The Protocol consists of an initial denaturation step at 95 °C for 5 minutes; 30 cycles of 30 seconds denaturation step at 95 °C, 30 seconds annealing step at each annealing temperature at 55 °C, and 30 seconds extension step at 72 °C, and with a 5-minute final extension step at 72 °C. Gel electrophoresis is carried out to detect the amplified product. The amplified PCR products are purified using Qiaquick DNA purification kit and sequenced with separate forward and reverse primers using the Sanger dideoxy sequencing method. Raw data is analysed using appropriate softwares.

The frequency distributions (genotype and alleles) and Hardy-Weinberg equilibrium test are calculated. Odds ratio greater than one indicates that an event is more likely to occur in a group that is exposed than in a group that is not exposed.

Financial declaration

The project is funded by Indian Council of Medical Research as Talent Search Scheme -Scheme for MD/MS-PhD program. A pilot project has been completed and submitted as an MD thesis. The complete protocol for conducting research has been mentioned here (Figure 2).

Statistical analysis

The obtained data will be checked for normality of the distribution by Kolmogorov-Smirnov test. Depending on this, parametric or nonparametric tests will be analyzed using SPSS software version 16. Continuous variables will be expressed as mean and standard deviation or median and interquartile range. Categorical variables will be expressed as frequency and percentage. Receiver operating characteristic curve will be done to get the cut-off value of the variables based on the Youden index. P value less than 0.05 will be considered statistically significant.

RESULTS

Levels of inflammatory markers will likely correlate with the disease progression and severity. Incremental increase in the levels of the biomarkers may signal accelerated cartilage degradation. Elevated levels shortly after trauma will be able to predict the likelihood of PTOA development. Altered expression of epigenetic markers serve as potential biomarkers for diagnosis, prognosis as well as for implementing targeted therapies. Single nucleotide polymorphisms will identify the individuals who are at risk of developing PTOA.

DISCUSSION

Circulating biomarkers are promising indicators of various pathological osteoarthritis-related processes. Biomarkers are detectable in the biological fluids such as blood, urine, and synovial fluid (SF) and involved tissues. These include cytokines, collagen markers, enzymes, oxidative stress markers, microRNAs, or genetic markers. They provide insights into both the local and the systemic pathology. Biomarkers in osteoarthritis can be classified based on the burden of disease, investigative purposes, prognostic indicators, intervention efficacy, diagnostic criteria, and safety considerations. In addition to predicting diagnosis and prognosis, the levels help in assessing the therapeutic efficacy, thus aiding the clinicians to decide which and when therapy is not effective and to try alternative modalities[14]. Knee trauma triggers a coordinated pathological response involving mechanical, cellular, and molecular pathways. Initial tissue damage provokes an inflammatory cascade, leading to progressive degradation of joint structures.

Cytokines

Acute synovial inflammation leads to cellular infiltration, resulting in the release of proinflammatory mediators like interleukin (IL)-1β, IL-6, IL-8, tumor necrosis factor-alpha (TNF-α), and transforming growth factor-beta1[15-19]. Levels of these mediators in SF have been correlated with clinical symptoms. IL-1β is a proinflammatory cytokine that is involved in decreased synthesis and degradation of existing extracellular matrix (ECM) like collagen and aggrecan. The signaling pathway of IL-1β has attracted as a therapeutic target for osteoarthritis[20]. It stimulates the production of matrix metalloproteinases (MMPs) and aggrecanases (ADAMTS-4 and ADAMTS-5) leading to the degradation of type II collagen[21]. It downregulates the anabolic factors like type II collagen and aggrecan synthesis by chondrocytes, impairing the intrinsic repair capacity of cartilage[22]. It stimulates the release of other inflammatory factors amplifying the response and perpetuating joint degradation. And, cytokines sensitize neurons contributing to chronic pain[23].

IL-6 exacerbates osteoarthritis progression via its receptor, IL-6R and downstream Janus Kinase (JAK) 2 signaling, which disrupts cartilage homeostasis by impairing SRY-box transcription factor 9 nuclear localization[24]. While both IL-6 and IL-1β-targeting therapies are effective in mitigating PTOA pathology, IL-6 inhibitors may offer broader immunological and regenerative benefits. The release of proinflammatory mediators is counteracted by anti-inflammatory mediators like IL-4 and IL-10[25]. A systematic review highlighted that IL-10, alongside IL-4 exhibits protective effects on osteoarthritis cartilage, suggesting a synergistic action when combined[25]. Serum IL-10 concentrations are significantly lower in patients with severe knee osteoarthritis compared to moderate cases. Additionally, IL-10 levels are compromised in individuals predisposed to developing osteoarthritis following ligamentous trauma, indicating its role in the inflammatory processes[26]. IL-10 has a role in antagonizing TNF-α in the knee joint environment, suggesting its potential therapeutic effects in preventing osteoarthritis following ACL injury and reconstruction[27].

Non collagenous glycoprotein

Cartilage oligomeric matrix protein (COMP) is a pentameric glycoprotein expressed in cartilage, ligaments, tendons, menisci, and synovial membranes. It plays a role in influencing the formation of collagen I and II fibrils by facilitating the early association of collagen molecules, thereby speeding up fibril organization. Additionally, COMP interacts with aggrecan, a key component of the cartilage extracellular matrix, and supports matrix molecule interactions essential for structuring the cartilage matrix to perform its function effectively. It is considered a marker of cartilage breakdown and has the potential to be a diagnostic and prognostic indicator. Serum levels correlate with age, synovitis, and severity of OA[28].

Matrix metalloproteinases

MMPs are a family of zinc-dependent proteolytic enzymes that play a pivotal role in the remodeling and degradation of ECM in articular cartilage. In osteoarthritis, dysregulation of MMP expression and activity are key contributors to cartilage degradation, joint space narrowing, and joint dysfunction. MMP13 targets collagen II as its primary substrate, thus linked to cartilage degradation. MMP13 levels are positively associated with KL grading. Hence, MMP13 is valuable for diagnosing, measuring disease severity, and predicting OA in the advanced period of the disease, suggesting that it has potential possibility as a biomarker for OA. Because of their distinctive chemical properties, free radicals can initiate and intensify the progressive sequence of joint degradation across all the affected tissues. These properties make markers such as oxidized LDL as a crucial factor involved in all the diseases of joint tissues. Therapeutic outcomes of these mechanisms may be a promising area for further research that may lead to a better understanding and therefore arrest of disease progression[29].

MicroRNA

In recent years, noncoding RNAs have emerged as valuable biomarkers for OA, with microRNAs (miRNAs) being particularly significant. These miRNAs function by binding to mRNA and either facilitating its degradation or inhibiting protein translation, playing a crucial role in maintaining cartilage homeostasis. Notably, PTOA patients exhibit elevated serum levels of specific miRNAs—miR-497, miR-146a, and miR-365—compared to those with OA unrelated to joint injury. This suggests that analyzing miRNA profiles in various biofluids could aid in diagnosing OA and understanding its associated pathologies. miR-140-3p and miR-140-5p, normally expressed in cartilage and chondrocytes, are the key players in OA and represent promising treatment targets[30]. Meanwhile, miR-30b-5p shows upregulation in osteoarthritic joint tissues and correlates with pro-inflammatory responses[31].

Both mechanical injury and pro-inflammatory cytokines from synovium or meniscus potentially contribute to miR-146a induction in OA cartilage. In the cartilage of OA patients, the induction of miR-146a by IL-1β is much more than by TNF-α and IL-17[32]. Subsequently, miR-146a contributes to human chondrocyte apoptosis by increasing vascular endothelial growth factor (VEGF) levels and impairing the transforming growth factor-beta signaling pathway through targeted inhibition of signal transduction protein- SMAD4[33]. MicroRNA-146a-5p has been implicated in the pathogenesis and potential treatment of knee OA, largely through its regulation of inflammation, cartilage degradation, and chondrocyte homeostasis[34]. Experimental silencing of miR-146a-5p in mouse models protected against injury-induced OA, reducing inflammation and cartilage destruction. However, the role of miR-146a-5p appears complex—some evidence suggests therapeutic potential through CXCR4/SDF-1 inhibition, while other findings indicate a pro-degenerative role by promoting chondrocyte apoptosis and inhibiting autophagy through NUMB targeting[35,36].

MicroRNA-34a-5p also plays a critical role in the OA progression by modulating chondrocyte apoptosis, inflammation, and autophagy. Research indicates that oxidative stress-induced upregulation of miR-34a-5p contributes to cartilage degeneration via the SIRT1/p53 pathway, triggering chronic chondrocyte injury and inflammatory responses[37]. miR-34a-5p is involved in the pathogenesis and joint destruction of primary knee OA[38]. In knee OA patients, miR-34a-5p expression is significantly elevated in plasma, indicating its potential as a biomarker for disease severity and joint destruction[38,39]. Bioinformatics analysis has identified miR-34a-5p as a core miRNA in the OA pathogenesis, interacting with long non-coding RNAs and mRNAs to regulate cartilage metabolism[39].

Genetic polymorphisms

Numerous genome-wide association studies and research on specific candidate genes have identified genetic variants in the form of single nucleotide polymorphisms (SNP) contributing to OA development. These include variants in the ALDH1A2, GDF5, VDR, IGF-1, COL11A1, and VEGF genes, highlighting the complex genetic factors influencing OA pathogenesis[40-42]. GDF5 is a key regulator of chondrogenesis and skeletal development, making it a potential target in OA pathogenesis. Variations in the 5’UTR of GDF5 result in reduced transcriptional activity, leading to impaired cartilage repair[43]. It promotes chondrocyte differentiation and extracellular matrix synthesis via the SMAD -dependent signalling pathway[44]. It interacts with BMP receptors, activating anabolic processes essential for cartilage maintenance[45]. Dysregulation of GDF5 expression contributes to OA progression by reducing chondrocyte proliferation and increasing apoptosis[46]. A study by Kania et al[47] found that GDF5 expression increases in articular cartilage following joint injury and is regulated by downstream sequences, suggesting its involvement in chondrogenic specification and OA risk. GDF5 has an important role in joint formation. Recent studies indicate that genetic variations in GDF5, particularly the +104T>C polymorphism, influence OA susceptibility across different populations. A meta-analysis encompassing 47 case -control studies revealed that this polymorphism is associated with a protective effect against knee and hand OA but not hip OA[48]. GDF5 has shown promise in enhancing tendon healing and potentially mitigating joint degeneration by promoting extracellular matrix remodelling and chondrogenesis[49].

SMAD3 inhibition can increase miRNA-140 expression, which in turn suppresses ADAMTS-5 expression. Simultaneously, SMAD3 inhibition has been shown to decrease ADAMTS-5 expression both in vitro and in vivo, both at the gene and protein levels. ADAMTS5 is a critical enzyme in the cartilage degradation, indicating that targets of SMAD3, could slow early OA progression[50]. SMAD3 genetic variations influence OA risk by affecting protein expression in serum and cartilage, particularly in north Indian populations[51]. In the SMAD3 gene, there is no statistically significant correlation with the genetic variation rs12901499. As a result, various hereditary and environmental variables may be responsible for the prevalence of osteoarthritis in the knees in older Indonesian women[52]

CONCLUSION

The development of PTOA involves a complex interplay of mechanical, biological, and biochemical factors. After an initial injury to the joint, there can be damage to the articular cartilage, subchondral bone, and synovium, leading to an increased risk of developing osteoarthritis in the affected joint over time. Biological fluids may contain molecules released during the matrix metabolism of articular cartilage, subchondral bone, and synovial tissue, potentially acting as biochemical indicators for OA. The release of mediators can serve to comprehend the disease burden, offering insights into its investigative and predictive aspects, the efficacy of the intervention, and diagnostic purposes.

Perspectives of scientific research

The primary objective of PTOA biomarker research is to create predictive tests rather than relying on reactive measures. Biomarkers hold the promise of early detection, particularly in the initial stages of PTOA, enabling the identification of individuals at risk. Due to the limitations of radiographic techniques, there is a shift towards exploring alternative measures for early detection of osteochondral damage. Molecular biomarkers, if identified, could play a pivotal role in diagnosing and monitoring diseases, facilitating drug development, and assessing the effectiveness of targeted therapies. Identification and characterization of circulating biomarkers in body fluids have the potential to play a crucial role in early diagnosis and assessing prognosis at various stages of PTOA. Diagnosing PTOA in the early stages of KL grading facilitates early interventions, preserving joint architecture and function. Implementing these strategies may contribute to the delay or prevention of PTOA, promoting optimal long-term joint health after an injury.

ACKNOWLEDGEMENTS

The authors thank Sri Ramachandra Institute of Higher Education and Research for providing the necessary infrastructure for conducting this research.

References
1.  Long H, Liu Q, Yin H, Wang K, Diao N, Zhang Y, Lin J, Guo A. Prevalence Trends of Site-Specific Osteoarthritis From 1990 to 2019: Findings From the Global Burden of Disease Study 2019. Arthritis Rheumatol. 2022;74:1172-1183.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 960]  [Cited by in RCA: 780]  [Article Influence: 195.0]  [Reference Citation Analysis (1)]
2.  Courties A, Kouki I, Soliman N, Mathieu S, Sellam J. Osteoarthritis year in review 2024: Epidemiology and therapy. Osteoarthritis Cartilage. 2024;32:1397-1404.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 267]  [Cited by in RCA: 206]  [Article Influence: 103.0]  [Reference Citation Analysis (0)]
3.  Singh A, Das S, Chopra A, Danda D, Paul BJ, March L, Mathew AJ, Shenoy P, Gotay C, Palmer AJ, Antony B. Burden of osteoarthritis in India and its states, 1990-2019: findings from the Global Burden of disease study 2019. Osteoarthritis Cartilage. 2022;30:1070-1078.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 48]  [Article Influence: 12.0]  [Reference Citation Analysis (0)]
4.  Thomas AC, Hubbard-Turner T, Wikstrom EA, Palmieri-Smith RM. Epidemiology of Posttraumatic Osteoarthritis. J Athl Train. 2017;52:491-496.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 148]  [Cited by in RCA: 261]  [Article Influence: 26.1]  [Reference Citation Analysis (0)]
5.  Snoeker B, Turkiewicz A, Magnusson K, Frobell R, Yu D, Peat G, Englund M. Risk of knee osteoarthritis after different types of knee injuries in young adults: a population-based cohort study. Br J Sports Med. 2020;54:725-730.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 60]  [Cited by in RCA: 160]  [Article Influence: 22.9]  [Reference Citation Analysis (1)]
6.  Maia CR, Annichino RF, de Azevedo E Souza Munhoz M, Machado EG, Marchi E, Castano-Betancourt MC. Post-traumatic osteoarthritis: the worst associated injuries and differences in patients' profile when compared with primary osteoarthritis. BMC Musculoskelet Disord. 2023;24:568.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 25]  [Article Influence: 8.3]  [Reference Citation Analysis (0)]
7.  Mancino F, Kayani B, Gabr A, Fontalis A, Plastow R, Haddad FS. Anterior cruciate ligament injuries in female athletes: risk factors and strategies for prevention. Bone Jt Open. 2024;5:94-100.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 12]  [Cited by in RCA: 59]  [Article Influence: 29.5]  [Reference Citation Analysis (0)]
8.  Janousek AT, Jones DG, Clatworthy M, Higgins LD, Fu FH. Posterior cruciate ligament injuries of the knee joint. Sports Med. 1999;28:429-441.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 55]  [Cited by in RCA: 49]  [Article Influence: 1.8]  [Reference Citation Analysis (1)]
9.  Ajuied A, Wong F, Smith C, Norris M, Earnshaw P, Back D, Davies A. Anterior cruciate ligament injury and radiologic progression of knee osteoarthritis: a systematic review and meta-analysis. Am J Sports Med. 2014;42:2242-2252.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 394]  [Cited by in RCA: 335]  [Article Influence: 27.9]  [Reference Citation Analysis (1)]
10.  Kellgren JH, Lawrence JS. Radiological assessment of osteo-arthrosis. Ann Rheum Dis. 1957;16:494-502.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10209]  [Cited by in RCA: 9235]  [Article Influence: 133.8]  [Reference Citation Analysis (0)]
11.  Ebrahimzadeh MH, Makhmalbaf H, Birjandinejad A, Keshtan FG, Hoseini HA, Mazloumi SM. The Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) in Persian Speaking Patients with Knee Osteoarthritis. Arch Bone Jt Surg. 2014;2:57-62.  [PubMed]  [DOI]
12.  da Costa BR, Saadat P, Basciani R, Agarwal A, Johnston BC, Jüni P. Visual Analogue Scale has higher assay sensitivity than WOMAC pain in detecting between-group differences in treatment effects: a meta-epidemiological study. Osteoarthritis Cartilage. 2021;29:304-312.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 61]  [Article Influence: 12.2]  [Reference Citation Analysis (0)]
13.  Arunrukthavon P, Heebthamai D, Benchasiriluck P, Chaluay S, Chotanaphuti T, Khuangsirikul S. Can urinary CTX-II be a biomarker for knee osteoarthritis? Arthroplasty. 2020;2:6.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 16]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
14.  Sandhu A, Rockel JS, Lively S, Kapoor M. Emerging molecular biomarkers in osteoarthritis pathology. Ther Adv Musculoskelet Dis. 2023;15:1759720X231177116.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 8]  [Cited by in RCA: 25]  [Article Influence: 8.3]  [Reference Citation Analysis (0)]
15.  Scanzello CR, Goldring SR. The role of synovitis in osteoarthritis pathogenesis. Bone. 2012;51:249-257.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1052]  [Cited by in RCA: 942]  [Article Influence: 67.3]  [Reference Citation Analysis (0)]
16.  Blom AB, van Lent PL, Holthuysen AE, van der Kraan PM, Roth J, van Rooijen N, van den Berg WB. Synovial lining macrophages mediate osteophyte formation during experimental osteoarthritis. Osteoarthritis Cartilage. 2004;12:627-635.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 237]  [Cited by in RCA: 277]  [Article Influence: 12.6]  [Reference Citation Analysis (0)]
17.  Bondeson J, Wainwright SD, Lauder S, Amos N, Hughes CE. The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis. Arthritis Res Ther. 2006;8:R187.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 439]  [Cited by in RCA: 399]  [Article Influence: 20.0]  [Reference Citation Analysis (0)]
18.  Attur M, Samuels J, Krasnokutsky S, Abramson SB. Targeting the synovial tissue for treating osteoarthritis (OA): where is the evidence? Best Pract Res Clin Rheumatol. 2010;24:71-79.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 58]  [Cited by in RCA: 59]  [Article Influence: 3.7]  [Reference Citation Analysis (0)]
19.  Sanchez-Adams J, Leddy HA, McNulty AL, O'Conor CJ, Guilak F. The mechanobiology of articular cartilage: bearing the burden of osteoarthritis. Curr Rheumatol Rep. 2014;16:451.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 167]  [Cited by in RCA: 231]  [Article Influence: 21.0]  [Reference Citation Analysis (0)]
20.  Riggs KC, Sankar U. Inflammatory mechanisms in post-traumatic osteoarthritis: a role for CaMKK2. Immunometabolism (Cobham). 2023;5:e00031.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 8]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
21.  Goldring MB, Otero M. Inflammation in osteoarthritis. Curr Opin Rheumatol. 2011;23:471-478.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1192]  [Cited by in RCA: 1090]  [Article Influence: 72.7]  [Reference Citation Analysis (2)]
22.  van den Bosch MHJ. Inflammation in osteoarthritis: is it time to dampen the alarm(in) in this debilitating disease? Clin Exp Immunol. 2019;195:153-166.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 48]  [Cited by in RCA: 90]  [Article Influence: 11.3]  [Reference Citation Analysis (0)]
23.  Vanderwall AG, Milligan ED. Cytokines in Pain: Harnessing Endogenous Anti-Inflammatory Signaling for Improved Pain Management. Front Immunol. 2019;10:3009.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 99]  [Cited by in RCA: 166]  [Article Influence: 23.7]  [Reference Citation Analysis (1)]
24.  Zhao X, Lin J, Liu F, Zhang Y, Shi B, Ma C, Wang Z, Xue S, Xu Q, Shao H, Yang J, Gao Y. Targeting p21-Positive Senescent Chondrocytes via IL-6R/JAK2 Inhibition to Alleviate Osteoarthritis. Adv Sci (Weinh). 2025;12:e2410795.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 13]  [Reference Citation Analysis (0)]
25.  van Helvoort EM, van der Heijden E, van Roon JAG, Eijkelkamp N, Mastbergen SC. The Role of Interleukin-4 and Interleukin-10 in Osteoarthritic Joint Disease: A Systematic Narrative Review. Cartilage. 2022;13:19476035221098167.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 31]  [Article Influence: 7.8]  [Reference Citation Analysis (0)]
26.  Barker T, Rogers VE, Henriksen VT, Trawick RH, Momberger NG, Lynn Rasmussen G. Circulating IL-10 is compromised in patients predisposed to developing and in patients with severe knee osteoarthritis. Sci Rep. 2021;11:1812.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 32]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
27.  Bigoni M, Zanchi N, Omeljaniuk RJ, Zatti G, Locatelli V, Torsello A, Turati M. Role of interleukin-10 in the synovial fluid of the anterior cruciate ligament injured knee. Eur Rev Med Pharmacol Sci. 2019;23:932-940.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 10]  [Reference Citation Analysis (0)]
28.  Tseng S, Reddi AH, Di Cesare PE. Cartilage Oligomeric Matrix Protein (COMP): A Biomarker of Arthritis. Biomark Insights. 2009;4:33-44.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 75]  [Cited by in RCA: 130]  [Article Influence: 7.6]  [Reference Citation Analysis (0)]
29.  Xin X, Tan Q, Li F, Chen Z, Zhang K, Li F, Yang B, Xing Z, Zhou F, Tian Y, Lv Y, Zhu T. Potential Value of Matrix Metalloproteinase-13 as a Biomarker for Osteoarthritis. Front Surg. 2021;8:750047.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 14]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
30.  Szala D, Kopańska M, Trojniak J, Jabłoński J, Hanf-Osetek D, Snela S, Zawlik I. The Role of MicroRNAs in the Pathophysiology of Osteoarthritis. Int J Mol Sci. 2024;25:6352.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 18]  [Reference Citation Analysis (0)]
31.  Xu H, Zhang J, Shi X, Li X, Zheng C. NF-κB inducible miR-30b-5p aggravates joint pain and loss of articular cartilage via targeting SIRT1-FoxO3a-mediated NLRP3 inflammasome. Aging (Albany NY). 2021;13:20774-20792.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 32]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
32.  Zhang X, Wang C, Zhao J, Xu J, Geng Y, Dai L, Huang Y, Fu SC, Dai K, Zhang X. miR-146a facilitates osteoarthritis by regulating cartilage homeostasis via targeting Camk2d and Ppp3r2. Cell Death Dis. 2017;8:e2734.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 55]  [Cited by in RCA: 81]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
33.  Jin L, Zhao J, Jing W, Yan S, Wang X, Xiao C, Ma B. Role of miR-146a in human chondrocyte apoptosis in response to mechanical pressure injury in vitro. Int J Mol Med. 2014;34:451-463.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 95]  [Cited by in RCA: 87]  [Article Influence: 7.3]  [Reference Citation Analysis (0)]
34.  Skrzypa M, Szala D, Gablo N, Czech J, Pajak J, Kopanska M, Trzeciak M, Gargasz K, Snela S, Zawlik I. miRNA-146a-5p is upregulated in serum and cartilage samples of patients with osteoarthritis. Pol Przegl Chir. 2019;91:1-5.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 35]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
35.  Qin H, Wang C, He Y, Lu A, Li T, Zhang B, Shen J. Silencing miR-146a-5p Protects against Injury-Induced Osteoarthritis in Mice. Biomolecules. 2023;13:123.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 20]  [Article Influence: 6.7]  [Reference Citation Analysis (0)]
36.  Zhang H, Zheng W, Li D, Zheng J. miR-146a-5p Promotes Chondrocyte Apoptosis and Inhibits Autophagy of Osteoarthritis by Targeting NUMB. Cartilage. 2021;13:1467S-1477S.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 46]  [Article Influence: 9.2]  [Reference Citation Analysis (0)]
37.  Zhou M, Liu B, Ye HM, Hou JN, Huang YC, Zhang P, Gao L, Qin HT, Yang YF, Zeng H, Kang B, Yu F, Wang DL, Lei M. ROS-induced imbalance of the miR-34a-5p/SIRT1/p53 axis triggers chronic chondrocyte injury and inflammation. Heliyon. 2024;10:e31654.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 10]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
38.  Mohamed DS, Azab NI, Fawzy RM, Khalil M, Mohammed LA, Baghdady S. The Expression Pattern of miR-34a-5p in Primary knee osteoarthritis Patients. Benha J Appl Sci. 2023;8:28-31.  [PubMed]  [DOI]  [Full Text]
39.  Endisha H, Datta P, Sharma A, Nakamura S, Rossomacha E, Younan C, Ali SA, Tavallaee G, Lively S, Potla P, Shestopaloff K, Rockel JS, Krawetz R, Mahomed NN, Jurisica I, Gandhi R, Kapoor M. MicroRNA-34a-5p Promotes Joint Destruction During Osteoarthritis. Arthritis Rheumatol. 2021;73:426-439.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 21]  [Cited by in RCA: 93]  [Article Influence: 18.6]  [Reference Citation Analysis (0)]
40.  Wang T, Liang Y, Li H, Li H, He Q, Xue Y, Shen C, Zhang C, Xiang J, Ding J, Qiao L, Zheng Q. Single Nucleotide Polymorphisms and Osteoarthritis: An Overview and a Meta-Analysis. Medicine (Baltimore). 2016;95:e2811.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 33]  [Cited by in RCA: 38]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
41.  Loughlin J. Genetic contribution to osteoarthritis development: current state of evidence. Curr Opin Rheumatol. 2015;27:284-288.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 65]  [Cited by in RCA: 59]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
42.  Spector TD, MacGregor AJ. Risk factors for osteoarthritis: genetics. Osteoarthritis Cartilage. 2004;12 Suppl A:S39-S44.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 303]  [Cited by in RCA: 308]  [Article Influence: 14.0]  [Reference Citation Analysis (0)]
43.  Southam L, Rodriguez-Lopez J, Wilkins JM, Pombo-Suarez M, Snelling S, Gomez-Reino JJ, Chapman K, Gonzalez A, Loughlin J. An SNP in the 5'-UTR of GDF5 is associated with osteoarthritis susceptibility in Europeans and with in vivo differences in allelic expression in articular cartilage. Hum Mol Genet. 2007;16:2226-2232.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 136]  [Cited by in RCA: 151]  [Article Influence: 7.9]  [Reference Citation Analysis (0)]
44.  Daans M, Luyten FP, Lories RJ. GDF5 deficiency in mice is associated with instability-driven joint damage, gait and subchondral bone changes. Ann Rheum Dis. 2011;70:208-213.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 71]  [Cited by in RCA: 72]  [Article Influence: 4.8]  [Reference Citation Analysis (0)]
45.  Jaswal AP, Kumar B, Roelofs AJ, Iqbal SF, Singh AK, Riemen AHK, Wang H, Ashraf S, Nanasaheb SV, Agnihotri N, De Bari C, Bandyopadhyay A. BMP signaling: A significant player and therapeutic target for osteoarthritis. Osteoarthritis Cartilage. 2023;31:1454-1468.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 21]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
46.  Sun K, Guo J, Yao X, Guo Z, Guo F. Growth differentiation factor 5 in cartilage and osteoarthritis: A possible therapeutic candidate. Cell Prolif. 2021;54:e12998.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 32]  [Cited by in RCA: 43]  [Article Influence: 8.6]  [Reference Citation Analysis (0)]
47.  Kania K, Colella F, Riemen AHK, Wang H, Howard KA, Aigner T, Dell'Accio F, Capellini TD, Roelofs AJ, De Bari C. Regulation of Gdf5 expression in joint remodelling, repair and osteoarthritis. Sci Rep. 2020;10:157.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 42]  [Cited by in RCA: 62]  [Article Influence: 10.3]  [Reference Citation Analysis (0)]
48.  Alijanpour K, Dastgheib SA, Azizi L, Shiri A, Bahrami M, Aghasipour M, Miri S, Aghili K, Dehghani-Manshadi Z, Neamatzadeh H, Khajehnoori S. Correlation of growth differentiation factor-5 + 104T>C polymorphism with the risk of knee, hand, and hip osteoarthritis: a case-control study and meta-analysis based on 47 case-control studies. Nucleosides Nucleotides Nucleic Acids. 2024;43:1215-1240.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
49.  Li H, Li Y, Xiang L, Luo S, Zhang Y, Li S. Therapeutic potential of GDF5 for enhancing tendon regenerative healing. Regen Ther. 2024;26:290-298.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
50.  Xiang W, Wang C, Zhu Z, Wang D, Qiu Z, Wang W. Inhibition of SMAD3 effectively reduces ADAMTS-5 expression in the early stages of osteoarthritis. BMC Musculoskelet Disord. 2023;24:130.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 7]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
51.  Sharma A, Srivastava R, Srivastava S, Raj S. SMAD3 genepolymorphisms and expression in serum and cartilage influence the risk of knee osteoarthritis. Osteoarthr Cartil. 2018;26:S186.  [PubMed]  [DOI]  [Full Text]
52.  Zaki A, Adhiyanto C, Hendarmin LA, Naqiya FI, Karni D, Harriyati Z. Association of SMAD3 Gene rs12901499 Variation with Knee Osteoarthritis in Indonesian Aged Women. J Prof Medika. 2023;17.  [PubMed]  [DOI]  [Full Text]
Footnotes

Provenance and peer review: Invited article; Externally peer reviewed.

Peer-review model: Single blind

Corresponding Author's Membership in Professional Societies: Association of Clinical Biochemists of India, No. 2518/LM/JOUR; Association of Medical Biochemists of India, No. TN-18; Indian Medical Association, No. TN/8241/94/319/82943/2000-01/L.

Specialty type: Sport sciences

Country of origin: India

Peer-review report’s classification

Scientific Quality: Grade A, Grade B

Novelty: Grade B, Grade B

Creativity or Innovation: Grade B, Grade C

Scientific Significance: Grade B, Grade C

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Li B, PhD, Associate Professor, China S-Editor: Liu JH L-Editor: A P-Editor: Zhang YL

Write to the Help Desk