©The Author(s) 2025.
World J Clin Pediatr. Dec 9, 2025; 14(4): 108068
Published online Dec 9, 2025. doi: 10.5409/wjcp.v14.i4.108068
Published online Dec 9, 2025. doi: 10.5409/wjcp.v14.i4.108068
Table 1 Sequence of primers used for MEFV gene analysis
| Primer | Target | Sequence (5'–3') | Amplicon length (bp) |
| MF-1-5 | Exon 1 (F) | CACATGTCTGCCAAGGCATG | 420 |
| MF-1-8 | Exon 1 (R) | TCAGAGTGAGCTGCTCTGAGCTC | 420 |
Table 2 Demographic and clinical data
| Variable | FMF patients (n = 40) | Controls (n = 40) | P value |
| Age (years) | 10.2 ± 2.8 | 10.0 ± 2.6 | 0.807 |
| Male (%) | 52.5 | 50% | 0.796 |
| Fever (%) | 95 | – | – |
| Abdominal pain (%) | 75 | – | – |
Table 3 Genotypic frequencies and statistical associations
| Mutation | Chromosome position | Mutation type | Frequency (%) | OR (95%CI) | P value |
| M694I | Chr16: 3290405 | Missense | 57.1 | 3.25 (1.6–6.5) | 0.002 |
| M694V | Chr16: 3290408 | Missense | 17.8 | 1.98 (0.9–4.2) | 0.07 |
Table 4 Laboratory data of familial Mediterranean fever patients and controls
| Characteristic | Attack (n = 40) | Attack-Free (n = 40) | Controls (n = 40) | P1 | P2 | P3 |
| TLC (× 10³/μL) | 9.91 ± 1.78 | 8.67 ± 1.01 | 6.84 ± 1.26 | < 0.001a | < 0.001a | 0.009a |
| ESR 1st hour (mm) | 50.27 ± 18.98 | 10.95 ± 6.21 | 2.35 ± 1.36 | < 0.001a | < 0.001a | < 0.001a |
| ESR 2nd hour (mm) | 75.03 ± 14.79 | 33.25 ± 6.29 | 17.58 ± 3.09 | < 0.001a | < 0.001a | < 0.001a |
| CRP (mg/L) | 60.93 ± 17.98 | 26.13 ± 6.54 | 10.07 ± 1.82 | < 0.001a | < 0.001a | < 0.001a |
| Amyloid A (mg/L) | 114.95 ± 82.27 | 6.73 ± 1.57 | 4.25 ± 1.10 | < 0.001a | < 0.001a | < 0.001a |
| Resistin (ng/mL) | 28.57 ± 6.94 | 17.33 ± 3.05 | 11.16 ± 5.24 | < 0.001a | < 0.001a | < 0.001a |
| Fibrinogen (mg/dL) | 630.55 ± 124.44 | 302.77 ± 74.18 | 234.38 ± 99.73 | < 0.001a | < 0.001a | 0.042a |
Table 5 Resistin levels by MEFV genotype
| Genotype | mean ± SD (ng/mL) | Range (ng/mL) |
| E148Q | 21.9 ± 6.3 | 15.6–28.2 |
| hoE148Q | 20.0 | 20.0–20.0 |
| hoM680I | 20.9 | 20.9–20.9 |
| M/M694V | 17.1 ± 3.7 | 12.1–21.0 |
| M/V726 | 15.9 ± 1.2 | 14.4–17.3 |
| M680I | 19.7 ± 2.2 | 18.1–21.2 |
| M694I | 16.9 ± 3.5 | 9.9–23.0 |
| M694V | 17.9 ± 3.4 | 11.8–20.0 |
| V726A | 15.1 ± 1.1 | 14.3–15.9 |
Table 6 Receiver operating characteristic curve analysis of resistin in patients with familial Mediterranean fever
| Parameter | Cut-off (ng/mL) | Sensitivity | Specificity | AUC | P value |
| Resistin | 14.95 | 90% | 77.5% | 0.929 | < 0.001 |
Table 7 Correlation between resistin and inflammatory markers
- Citation: Morad LM, Elsaadany E, Qassem SS, Elnady MS, Abdel-Kareem AA, Al-Beltagi M. Serum resistin levels in pediatric familial Mediterranean fever: Potential biomarker for inflammatory activity. World J Clin Pediatr 2025; 14(4): 108068
- URL: https://www.wjgnet.com/2219-2808/full/v14/i4/108068.htm
- DOI: https://dx.doi.org/10.5409/wjcp.v14.i4.108068
