Serum resistin levels in pediatric familial Mediterranean fever: Potential biomarker for inflammatory activity

Table 1 Sequence of primers used for MEFV gene analysis

Primer	Target	Sequence (5'–3')	Amplicon length (bp)
MF-1-5	Exon 1 (F)	CACATGTCTGCCAAGGCATG	420
MF-1-8	Exon 1 (R)	TCAGAGTGAGCTGCTCTGAGCTC	420

F: Forward; R: Reverse.

Table 2 Demographic and clinical data

Variable	FMF patients (n = 40)	Controls (n = 40)	P value
Age (years)	10.2 ± 2.8	10.0 ± 2.6	0.807
Male (%)	52.5	50%	0.796
Fever (%)	95	–	–
Abdominal pain (%)	75	–	–

Table 3 Genotypic frequencies and statistical associations

Mutation	Chromosome position	Mutation type	Frequency (%)	OR (95%CI)	P value
M694I	Chr16: 3290405	Missense	57.1	3.25 (1.6–6.5)	0.002
M694V	Chr16: 3290408	Missense	17.8	1.98 (0.9–4.2)	0.07

OR: Odds ratio.

Table 4 Laboratory data of familial Mediterranean fever patients and controls

Characteristic	Attack (n = 40)	Attack-Free (n = 40)	Controls (n = 40)	P1	P2	P3
TLC (× 10³/μL)	9.91 ± 1.78	8.67 ± 1.01	6.84 ± 1.26	< 0.001a	< 0.001a	0.009a
ESR 1st hour (mm)	50.27 ± 18.98	10.95 ± 6.21	2.35 ± 1.36	< 0.001a	< 0.001a	< 0.001a
ESR 2nd hour (mm)	75.03 ± 14.79	33.25 ± 6.29	17.58 ± 3.09	< 0.001a	< 0.001a	< 0.001a
CRP (mg/L)	60.93 ± 17.98	26.13 ± 6.54	10.07 ± 1.82	< 0.001a	< 0.001a	< 0.001a
Amyloid A (mg/L)	114.95 ± 82.27	6.73 ± 1.57	4.25 ± 1.10	< 0.001a	< 0.001a	< 0.001a
Resistin (ng/mL)	28.57 ± 6.94	17.33 ± 3.05	11.16 ± 5.24	< 0.001a	< 0.001a	< 0.001a
Fibrinogen (mg/dL)	630.55 ± 124.44	302.77 ± 74.18	234.38 ± 99.73	< 0.001a	< 0.001a	0.042a

^aP values < 0.05.

P1 = Attack vs attack-free; P2 = Attack vs controls; P3 = Attack-Free vs controls. TLC: Total leukocyte count; CRP: C-reactive protein; ESR: Erythrocyte sedimentation rate.

Table 5 Resistin levels by MEFV genotype

Genotype	mean ± SD (ng/mL)	Range (ng/mL)
E148Q	21.9 ± 6.3	15.6–28.2
hoE148Q	20.0	20.0–20.0
hoM680I	20.9	20.9–20.9
M/M694V	17.1 ± 3.7	12.1–21.0
M/V726	15.9 ± 1.2	14.4–17.3
M680I	19.7 ± 2.2	18.1–21.2
M694I	16.9 ± 3.5	9.9–23.0
M694V	17.9 ± 3.4	11.8–20.0
V726A	15.1 ± 1.1	14.3–15.9

ho: Homozygous; M/M or M/V: Compound heterozygous; MEFV: Familial Mediterranean fever gene.

Table 6 Receiver operating characteristic curve analysis of resistin in patients with familial Mediterranean fever

Parameter	Cut-off (ng/mL)	Sensitivity	Specificity	AUC	P value
Resistin	14.95	90%	77.5%	0.929	< 0.001

AUC: Area under the curve; ROC curve: Receiver operating characteristic curve.

Table 7 Correlation between resistin and inflammatory markers

Parameter	Correlation coefficient (r)	95%CI	P value
TLC	0.453	(0.154, 0.676)	0.0031
ESR 1st hour	0.516	(0.234, 0.718)	0.0011
ESR 2nd hour	0.614	(0.365, 0.781)	< 0.0011
CRP	0.591	(0.333, 0.767)	< 0.0011
Amyloid A	0.484	(0.193, 0.697)	0.0021
Fibrinogen	0.295	(-0.029, 0.563)	0.064

¹Significant at P < 0.05. CRP: C-reactive protein; ESR: Erythrocyte sedimentation rate; TLC: Total leukocyte count.