©The Author(s) 2016.
World J Gastrointest Pathophysiol. Feb 15, 2016; 7(1): 138-149
Published online Feb 15, 2016. doi: 10.4291/wjgp.v7.i1.138
Published online Feb 15, 2016. doi: 10.4291/wjgp.v7.i1.138
Table 1 Primer sequences used for quantitative real-time polymerase chain reaction and northern blot analyses
| Name | Sequence |
| Pdx1 | F: ACCAAAGCTCACGCGTGGAAA |
| R: TGATGTGTCTCTCGGTCAAGTT | |
| Insulin 1 | F: TTGCCCTCTGGGAGCCCAAA |
| R: CAGATGCTGGTGCAGCACTG | |
| Insulin 2 | F: TCTTCCTCTGGGAGTCCCAC |
| R: CAGATGCTGGTGCAGCACTG | |
| Glut2 | F: CATTGCTGGAAGAAGCGTATCAG |
| R: GAGACCTTCTGCTCAGTCGACG | |
| Amylase | F: TTAACGATAATAAATGTAATGGAGAA |
| R: CCCTGCTACTCCAATGTCAA | |
| Trypsin | F: TGAGCAGTTTGTCAATTCTGCC |
| R: GCATGATGTCGTTGTTCAGGG | |
| Elastase | F: GTAGTTGCAGCCCAGAGAGG |
| R: TCTGCTATGTCACAGGCTGG | |
| Gp2 | F: TCCCTGCCAGAATCACACGGT |
| R: GGAGGTCCTGCCTACAGACACA | |
| L32 | F: GATCTAGCGGCCGCCATCTGTTTACGGCATCATG |
| R: TAGATCGCGGCCGCCGCTCCCATAACCGATGTTGG |
Table 2 Genes with the highest levels of differential expression in the Nkcc1-null intestine
| Gene symbol | Description | Average intensity | Fold change | P value |
| Cpa1 | Carboxypeptidase A1, pancreatic | 1811 | 15.86 | 0.00001 |
| Elane | Elastase 2 | 2118 | 12.05 | 0.00001 |
| Glb1l3 | Galactosidase, beta 1 like 3 | 234 | 10.27 | 0.0001 |
| Try4 | Trypsin 4 | 2251 | 9.91 | 0.00001 |
| Rnase1 | Ribonuclease 1, pancreatic RNase A | 592 | 9.28 | 0.00001 |
| Cpb1 | Carboxypeptidase B1 | 866 | 9.15 | 0.00001 |
| Amy2a5 | Amylase 2, pancreatic | 691 | 8.75 | 0.00001 |
| Try10 | Trypsin 10 | 2306 | 8.33 | 0.00001 |
| Ctrc | Chymotrypsin C (caldecrin) | 397 | 7.79 | 0.0003 |
| Ctrb1 | Chymotrypsinogen B1 | 3360 | 7.66 | 0.00001 |
| Pnlip | Pancreatic lipase | 1938 | 7.24 | 0.00001 |
| Prss1 | Protease, serine 1 (trypsin 1) | 1481 | 6.93 | 0.00001 |
| Cel | Bile salt activated lipase, pancreatic | 356 | 6.73 | 0.00001 |
| Cela3b | Elastase 3B, pancreatic | 1576 | 6.69 | 0.00001 |
| Prss2 | Protease, serine 2 (trypsin II) | 716 | 6.52 | 0.0001 |
| Pnliprp1 | Pancreatic lipase related protein 1 | 574 | 5.83 | 0.0001 |
| Muc6 | Mucin 6, gastric | 152 | 5.78 | 0.0053 |
| Tff2 | Trefoil factor 2 | 1391 | 5.77 | 0.0200 |
| Cela1 | Elastase 1, pancreatic | 549 | 4.84 | 0.0002 |
| V1rh10 | Vomeronasal 1 receptor, H10 | 107 | 4.66 | 0.0008 |
| Calb3 | Calbindin D9K | 609 | 4.64 | 0.00001 |
| Reg1 | Lithostathine 1 (pancreatic stone protein 1) | 5648 | 4.56 | 0.0008 |
| Pdia2 | Protein disulfide isomerase, pancreatic | 292 | 4.47 | 0.0004 |
| Akp3 | Alkaline phosphatase 3, intestine | 366 | 4.02 | 0.00001 |
| Gp2 | Glycoprotein 2 (zymogen granule membrane) | 377 | 3.92 | 0.0001 |
| Cep350 | Centrosomal protein 350 | 141 | 3.92 | 0.0003 |
| Bmper | BMP-binding endothelial regulator | 318 | 3.78 | 0.0011 |
| Olfr846 | Olfactory receptor 846 | 432 | 3.66 | 0.0001 |
| Reg2 | Lithostathine 2 (pancreatic stone protein 2) | 253 | 3.58 | 0.0383 |
| Ctrl | Chymotrypsin like; chymotrypsin A | 1431 | 3.49 | 0.0030 |
Table 3 Significantly enriched Gene Ontology categories
| GO category | P-value | Enrichment | (N, B, n, b) |
| Single ranked list | |||
| GO:0008236 Serine-type peptidase activity | 3.38E-14 | 35.6 | (13551, 135, 31, 11) |
| GO:0008233 Peptidase activity | 7.66E-11 | 12.6 | (13551, 451, 31, 13) |
| GO:0007586 Digestion | 1.82E-10 | 209.8 | (13551, 19, 17, 5) |
| GO:0007600 Sensory perception | 3.45E-8 | 1.67 | (13551, 817, 1270, 128) |
| GO:0006508 Proteolysis | 4.01E-8 | 7.65 | (13551, 743, 31, 13) |
| GO:0004984 Olfactory receptor activity | 7.11E-8 | 1.82 | (13551, 552, 1270, 94) |
| GO:0004806 Triglyceride lipase activity | 7.01E-7 | 271.0 | (13551, 10, 15, 3) |
| GO:0004930 GPCR activity | 3.86E-5 | 2.41 | (13551, 512, 352, 32) |
| Two unranked lists (target and background) | |||
| GO:0008236 Serine-type peptidase activity | 6.03E-8 | 4.63 | (13551, 135, 390, 18) |
| GO:0007586 Digestion | 5.79E-7 | 12.8 | (13551, 19, 390, 7) |
| GO:0004930 GPCR activity | 1.30E-5 | 2.24 | (13551, 512, 390, 33) |
| GO:0004984 Olfactory receptor activity | 5.86E-5 | 2.08 | (13551, 552, 390,3 3) |
| GO:0004806 Triglyceride lipase activity | 1.24E-4 | 13.9 | (13551, 10, 390, 4) |
| GO:0008233 Peptidase activity | 2.71E-4 | 2.08 | (13551, 451, 390, 27) |
Table 4 Digestive enzymes and peptidases altered in small intestine of Nkcc1-/- mice
| Gene symbol | Description | Average intensity | Fold change | P-value |
| Cpa1 | Carboxypeptidase A1, pancreatic | 1811 | 15.86 | 0.00001 |
| Elane | Elastase 2 | 2118 | 12.05 | 0.00001 |
| Try4 | Trypsin 4 | 2251 | 9.91 | 0.00001 |
| Cpb1 | Carboxypeptidase B1 (tissue) | 866 | 9.15 | 0.00001 |
| Try10 | Trypsin 10 | 2306 | 8.33 | 0.00001 |
| Ctrc | Chymotrypsin C (caldecrin) | 397 | 7.79 | 0.0003 |
| Ctrb1 | Chymotrypsinogen B | 3360 | 7.66 | 0.00001 |
| Pnlip | Pancreatic lipase | 1938 | 7.24 | 0.00001 |
| Prss1 | Protease, serine 1 (trypsin 1) | 1481 | 6.93 | 0.00001 |
| Cel | Carboxyester lipase, pancreatic | 356 | 6.73 | 0.00001 |
| Cela3b | Elastase 3B, pancreatic | 1576 | 6.69 | 0.00001 |
| Prss2 | Trypsin II, anionic | 716 | 6.52 | 0.0001 |
| Pnliprp1 | Pancreatic lipase related protein 1 | 574 | 5.83 | 0.0001 |
| Cela1 | Elastase 1, pancreatic | 549 | 4.84 | 0.0002 |
| 2210010C04Rik | RIKEN cDNA 2210010C04 gene | 125 | 3.89 | 0.0005 |
| Ctrl | Chymotrypsin like; chymotrypsin A | 1431 | 3.49 | 0.0030 |
| Klk1 | Kallikrein 1 | 278 | 1.82 | 0.0180 |
| Klk1b26 | Kallikrein 1-related petidase b26 | 988 | 1.80 | 0.0030 |
| Pnliprp2 | Pancreatic lipase related protein 2 | 833 | 1.74 | 0.0181 |
| Klk1b21 | Kallikrein 21 | 386 | 1.66 | 0.0036 |
| Cyp7b1 | Cytochrome P450 7B1 | 100 | 1.53 | 0.0229 |
| Prcp | Prolyl carboxypeptidase (angiotensinase C) | 566 | 1.51 | 0.0047 |
| Amz1 | Archaelysin family metallopeptidase 1 | 887 | 1.35 | 0.0121 |
| Otud4 | OTU domain containing 4 | 524 | -1.34 | 0.0221 |
| Pga5 | Pepsinogen 5, group I | 168 | -1.42 | 0.0198 |
| Dpep3 | Dipeptidase 3 | 301 | -1.48 | 0.0197 |
| Hpn | Serine protease hepsin | 206 | -1.99 | 0.0211 |
Table 5 G-protein coupled, olfactory, and vomeronasal receptors
| Gene symbol | Description | Average intensity | Fold change | P-value |
| V1rh10 | Vomeronasal 1 receptor, H10 | 107 | 4.66 | 0.0008 |
| Olfr846 | Olfactory receptor 846 | 432 | 3.66 | 0.0001 |
| Olfr491 | Olfactory receptor 491 | 79 | 3.18 | 0.0051 |
| Olfr419 | Olfactory receptor 419 | 477 | 3.12 | 0.0004 |
| Olfr827 | Olfactory receptor 827 | 122 | 2.65 | 0.0001 |
| Olfr992 | Olfactory receptor 992 | 300 | 2.53 | 0.0005 |
| Olfr506 | Olfactory receptor 506 | 143 | 2.48 | 0.0049 |
| Olfr812 | Olfactory receptor 812 | 53 | 2.37 | 0.0048 |
| Gpr63 | G protein-coupled receptor 63 | 42 | 2.08 | 0.0023 |
| Olfr1080 | Olfactory receptor 1080 | 66 | 1.90 | 0.0107 |
| V1rh1 | Vomeronasal 1 receptor, H2 | 60 | 1.88 | 0.0071 |
| Olfr344 | Olfactory receptor 344 | 50 | 1.87 | 0.0057 |
| Olfr1340 | Olfactory receptor 1340 | 79 | 1.83 | 0.0123 |
| Olfr378 | Olfactory receptor 378 | 67 | 1.81 | 0.0072 |
| Olfr643 | Olfactory receptor 643 | 77 | 1.72 | 0.0080 |
| Olfr1000 | Olfactory receptor 996 | 475 | 1.72 | 0.0127 |
| Olfr1134 | Olfactory receptor 1134 | 139 | 1.71 | 0.0101 |
| Olfr906 | Olfactory receptor 906 | 134 | 1.68 | 0.0038 |
| Olfr736 | Olfactory receptor 736 | 92 | 1.67 | 0.0166 |
| Olfr433 | Olfactory receptor 433 | 189 | 1.65 | 0.0039 |
| Olfr78 | Olfactory receptor 78 | 125 | 1.62 | 0.0087 |
| Olfr90 | Olfactory receptor 90 | 106 | 1.56 | 0.0235 |
| Prokr1 | Prokineticin receptor 1 | 196 | 1.56 | 0.0096 |
| Olfr1494 | Olfactory receptor 1494 | 457 | 1.54 | 0.0180 |
| Olfr1462 | Olfactory receptor 1462 | 260 | 1.52 | 0.0183 |
| Olfr444 | Olfactory receptor 444 | 252 | 1.52 | 0.0154 |
| Nmur1 | Neuromedin U receptor 1 | 196 | 1.51 | 0.0177 |
| Olfr1366 | Olfactory receptor 1366 | 89 | 1.50 | 0.0207 |
| Olfr804 | Olfactory receptor 804 | 404 | 1.48 | 0.0175 |
| Gpbar1 | G protein-coupled bile acid receptor 1 | 129 | 1.47 | 0.0216 |
| Gprc5a | G protein-coupled receptor, C5A | 936 | 1.46 | 0.0142 |
| Olfr740 | Olfactory receptor 739 | 172 | 1.43 | 0.0164 |
| Olfr1156 | Olfactory receptor 152 | 156 | 1.43 | 0.0211 |
| Rxfp4 | Relaxin family peptide receptor 4 | 397 | 1.37 | 0.0132 |
| Igf2r | Insulin-like growth factor 2 receptor | 1089 | -1.39 | 0.0158 |
| Olfr641 | Olfactory receptor 641 | 652 | -1.39 | 0.0211 |
| Olfr48 | Olfactory receptor 140 | 99 | -1.48 | 0.0143 |
| Vmn1r210 | Vomeronasal 1 receptor 210 | 192 | -1.54 | 0.0127 |
| Grm2 | Glutamate receptor, metabotropic 2 | 179 | -1.63 | 0.0028 |
| Vmn1r5 | Vomeronasal 1 receptor 5 | 124 | -1.64 | 0.0071 |
| Ffar2 | Free fatty acid receptor 2 | 203 | -1.85 | 0.0092 |
- Citation: Bradford EM, Vairamani K, Shull GE. Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine. World J Gastrointest Pathophysiol 2016; 7(1): 138-149
- URL: https://www.wjgnet.com/2150-5330/full/v7/i1/138.htm
- DOI: https://dx.doi.org/10.4291/wjgp.v7.i1.138
