Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine

Table 1 Primer sequences used for quantitative real-time polymerase chain reaction and northern blot analyses

Name	Sequence
Pdx1	F: ACCAAAGCTCACGCGTGGAAA
	R: TGATGTGTCTCTCGGTCAAGTT
Insulin 1	F: TTGCCCTCTGGGAGCCCAAA
	R: CAGATGCTGGTGCAGCACTG
Insulin 2	F: TCTTCCTCTGGGAGTCCCAC
	R: CAGATGCTGGTGCAGCACTG
Glut2	F: CATTGCTGGAAGAAGCGTATCAG
	R: GAGACCTTCTGCTCAGTCGACG
Amylase	F: TTAACGATAATAAATGTAATGGAGAA
	R: CCCTGCTACTCCAATGTCAA
Trypsin	F: TGAGCAGTTTGTCAATTCTGCC
	R: GCATGATGTCGTTGTTCAGGG
Elastase	F: GTAGTTGCAGCCCAGAGAGG
	R: TCTGCTATGTCACAGGCTGG
Gp2	F: TCCCTGCCAGAATCACACGGT
	R: GGAGGTCCTGCCTACAGACACA
L32	F: GATCTAGCGGCCGCCATCTGTTTACGGCATCATG
	R: TAGATCGCGGCCGCCGCTCCCATAACCGATGTTGG

Forward and reverse primers for quantitative real-time polymerase chain reaction and northern blot probes are listed 5’ to 3’.

Table 2 Genes with the highest levels of differential expression in the Nkcc1-null intestine

Gene symbol	Description	Average intensity	Fold change	P value
Cpa1	Carboxypeptidase A1, pancreatic	1811	15.86	0.00001
Elane	Elastase 2	2118	12.05	0.00001
Glb1l3	Galactosidase, beta 1 like 3	234	10.27	0.0001
Try4	Trypsin 4	2251	9.91	0.00001
Rnase1	Ribonuclease 1, pancreatic RNase A	592	9.28	0.00001
Cpb1	Carboxypeptidase B1	866	9.15	0.00001
Amy2a5	Amylase 2, pancreatic	691	8.75	0.00001
Try10	Trypsin 10	2306	8.33	0.00001
Ctrc	Chymotrypsin C (caldecrin)	397	7.79	0.0003
Ctrb1	Chymotrypsinogen B1	3360	7.66	0.00001
Pnlip	Pancreatic lipase	1938	7.24	0.00001
Prss1	Protease, serine 1 (trypsin 1)	1481	6.93	0.00001
Cel	Bile salt activated lipase, pancreatic	356	6.73	0.00001
Cela3b	Elastase 3B, pancreatic	1576	6.69	0.00001
Prss2	Protease, serine 2 (trypsin II)	716	6.52	0.0001
Pnliprp1	Pancreatic lipase related protein 1	574	5.83	0.0001
Muc6	Mucin 6, gastric	152	5.78	0.0053
Tff2	Trefoil factor 2	1391	5.77	0.0200
Cela1	Elastase 1, pancreatic	549	4.84	0.0002
V1rh10	Vomeronasal 1 receptor, H10	107	4.66	0.0008
Calb3	Calbindin D9K	609	4.64	0.00001
Reg1	Lithostathine 1 (pancreatic stone protein 1)	5648	4.56	0.0008
Pdia2	Protein disulfide isomerase, pancreatic	292	4.47	0.0004
Akp3	Alkaline phosphatase 3, intestine	366	4.02	0.00001
Gp2	Glycoprotein 2 (zymogen granule membrane)	377	3.92	0.0001
Cep350	Centrosomal protein 350	141	3.92	0.0003
Bmper	BMP-binding endothelial regulator	318	3.78	0.0011
Olfr846	Olfactory receptor 846	432	3.66	0.0001
Reg2	Lithostathine 2 (pancreatic stone protein 2)	253	3.58	0.0383
Ctrl	Chymotrypsin like; chymotrypsin A	1431	3.49	0.0030

Differential expression is presented as fold-changes in Nkcc1^-/- intestine relative to wild-type intestine. Average intensity (average of Cy3 and Cy5 fluorescence intensities) is roughly indicative of relative expression levels. P values are less than or equal to the numbers shown.

Table 3 Significantly enriched Gene Ontology categories

GO category	P-value	Enrichment	(N, B, n, b)
Single ranked list
GO:0008236 Serine-type peptidase activity	3.38E-14	35.6	(13551, 135, 31, 11)
GO:0008233 Peptidase activity	7.66E-11	12.6	(13551, 451, 31, 13)
GO:0007586 Digestion	1.82E-10	209.8	(13551, 19, 17, 5)
GO:0007600 Sensory perception	3.45E-8	1.67	(13551, 817, 1270, 128)
GO:0006508 Proteolysis	4.01E-8	7.65	(13551, 743, 31, 13)
GO:0004984 Olfactory receptor activity	7.11E-8	1.82	(13551, 552, 1270, 94)
GO:0004806 Triglyceride lipase activity	7.01E-7	271.0	(13551, 10, 15, 3)
GO:0004930 GPCR activity	3.86E-5	2.41	(13551, 512, 352, 32)
Two unranked lists (target and background)
GO:0008236 Serine-type peptidase activity	6.03E-8	4.63	(13551, 135, 390, 18)
GO:0007586 Digestion	5.79E-7	12.8	(13551, 19, 390, 7)
GO:0004930 GPCR activity	1.30E-5	2.24	(13551, 512, 390, 33)
GO:0004984 Olfactory receptor activity	5.86E-5	2.08	(13551, 552, 390,3 3)
GO:0004806 Triglyceride lipase activity	1.24E-4	13.9	(13551, 10, 390, 4)
GO:0008233 Peptidase activity	2.71E-4	2.08	(13551, 451, 390, 27)

GO categories were identified using both the Single rank and Two unranked list options of the GOrilla Gene Ontology program[9]. N is the total number of genes, B is the total number of genes associated with a specific GO term, n is the number of genes in the target set, b is the number of genes in the intersection. Enrichment = (b/n)/(B/N). GPCR: G-protein coupled receptor; GO: Gene Ontology.

Table 4 Digestive enzymes and peptidases altered in small intestine of Nkcc1^-/- mice

Gene symbol	Description	Average intensity	Fold change	P-value
Cpa1	Carboxypeptidase A1, pancreatic	1811	15.86	0.00001
Elane	Elastase 2	2118	12.05	0.00001
Try4	Trypsin 4	2251	9.91	0.00001
Cpb1	Carboxypeptidase B1 (tissue)	866	9.15	0.00001
Try10	Trypsin 10	2306	8.33	0.00001
Ctrc	Chymotrypsin C (caldecrin)	397	7.79	0.0003
Ctrb1	Chymotrypsinogen B	3360	7.66	0.00001
Pnlip	Pancreatic lipase	1938	7.24	0.00001
Prss1	Protease, serine 1 (trypsin 1)	1481	6.93	0.00001
Cel	Carboxyester lipase, pancreatic	356	6.73	0.00001
Cela3b	Elastase 3B, pancreatic	1576	6.69	0.00001
Prss2	Trypsin II, anionic	716	6.52	0.0001
Pnliprp1	Pancreatic lipase related protein 1	574	5.83	0.0001
Cela1	Elastase 1, pancreatic	549	4.84	0.0002
2210010C04Rik	RIKEN cDNA 2210010C04 gene	125	3.89	0.0005
Ctrl	Chymotrypsin like; chymotrypsin A	1431	3.49	0.0030
Klk1	Kallikrein 1	278	1.82	0.0180
Klk1b26	Kallikrein 1-related petidase b26	988	1.80	0.0030
Pnliprp2	Pancreatic lipase related protein 2	833	1.74	0.0181
Klk1b21	Kallikrein 21	386	1.66	0.0036
Cyp7b1	Cytochrome P450 7B1	100	1.53	0.0229
Prcp	Prolyl carboxypeptidase (angiotensinase C)	566	1.51	0.0047
Amz1	Archaelysin family metallopeptidase 1	887	1.35	0.0121
Otud4	OTU domain containing 4	524	-1.34	0.0221
Pga5	Pepsinogen 5, group I	168	-1.42	0.0198
Dpep3	Dipeptidase 3	301	-1.48	0.0197
Hpn	Serine protease hepsin	206	-1.99	0.0211

Differential expression is presented as fold-changes in Nkcc1^-/- intestine relative to wild-type intestine. Average intensity (average of Cy3 and Cy5 fluorescence intensities) is roughly indicative of relative expression levels. P values are less than or equal to the numbers shown.

Table 5 G-protein coupled, olfactory, and vomeronasal receptors

Gene symbol	Description	Average intensity	Fold change	P-value
V1rh10	Vomeronasal 1 receptor, H10	107	4.66	0.0008
Olfr846	Olfactory receptor 846	432	3.66	0.0001
Olfr491	Olfactory receptor 491	79	3.18	0.0051
Olfr419	Olfactory receptor 419	477	3.12	0.0004
Olfr827	Olfactory receptor 827	122	2.65	0.0001
Olfr992	Olfactory receptor 992	300	2.53	0.0005
Olfr506	Olfactory receptor 506	143	2.48	0.0049
Olfr812	Olfactory receptor 812	53	2.37	0.0048
Gpr63	G protein-coupled receptor 63	42	2.08	0.0023
Olfr1080	Olfactory receptor 1080	66	1.90	0.0107
V1rh1	Vomeronasal 1 receptor, H2	60	1.88	0.0071
Olfr344	Olfactory receptor 344	50	1.87	0.0057
Olfr1340	Olfactory receptor 1340	79	1.83	0.0123
Olfr378	Olfactory receptor 378	67	1.81	0.0072
Olfr643	Olfactory receptor 643	77	1.72	0.0080
Olfr1000	Olfactory receptor 996	475	1.72	0.0127
Olfr1134	Olfactory receptor 1134	139	1.71	0.0101
Olfr906	Olfactory receptor 906	134	1.68	0.0038
Olfr736	Olfactory receptor 736	92	1.67	0.0166
Olfr433	Olfactory receptor 433	189	1.65	0.0039
Olfr78	Olfactory receptor 78	125	1.62	0.0087
Olfr90	Olfactory receptor 90	106	1.56	0.0235
Prokr1	Prokineticin receptor 1	196	1.56	0.0096
Olfr1494	Olfactory receptor 1494	457	1.54	0.0180
Olfr1462	Olfactory receptor 1462	260	1.52	0.0183
Olfr444	Olfactory receptor 444	252	1.52	0.0154
Nmur1	Neuromedin U receptor 1	196	1.51	0.0177
Olfr1366	Olfactory receptor 1366	89	1.50	0.0207
Olfr804	Olfactory receptor 804	404	1.48	0.0175
Gpbar1	G protein-coupled bile acid receptor 1	129	1.47	0.0216
Gprc5a	G protein-coupled receptor, C5A	936	1.46	0.0142
Olfr740	Olfactory receptor 739	172	1.43	0.0164
Olfr1156	Olfactory receptor 152	156	1.43	0.0211
Rxfp4	Relaxin family peptide receptor 4	397	1.37	0.0132
Igf2r	Insulin-like growth factor 2 receptor	1089	-1.39	0.0158
Olfr641	Olfactory receptor 641	652	-1.39	0.0211
Olfr48	Olfactory receptor 140	99	-1.48	0.0143
Vmn1r210	Vomeronasal 1 receptor 210	192	-1.54	0.0127
Grm2	Glutamate receptor, metabotropic 2	179	-1.63	0.0028
Vmn1r5	Vomeronasal 1 receptor 5	124	-1.64	0.0071
Ffar2	Free fatty acid receptor 2	203	-1.85	0.0092

Differential expression is presented as fold-changes in Nkcc1^-/- intestine relative to wild-type intestine. Average intensity (average of Cy3 and Cy5 fluorescence intensities) is roughly indicative of relative expression levels. P values are less than or equal to the numbers shown.