Value of dual energy computed tomography with material decomposition algorithm in assessing intestinal creeping fat in Crohn’s disease

Table 1 Primary antibody dilutions used in this study

Antibody	Dilution ratio
TGF-β	1:100
TNF-α	1:100
PPARγ2	1:100
Occludin	1:200

TNF-α: Tumor necrosis factor-α; TGF: Transforming growth factor-β; PPARγ2: Peroxisome proliferator-activated receptor gamma 2.

Table 2 Primers used in this study

Name	Primer	Sequence	Size
β-actin	Forward	GAGACCTTCAACACCCCAGC	103 bp
	Reverse	ATGTCACGCACGATTTCCC
PPARγ2	Forward	CCCTGGCAA AGCATTTGTAT	109 bp
	Reverse	ACTGGCACCCTTGAAAAATG
Occludin	Forward	CCACCCGCGTACAACCTTCTT	174 bp
	Reverse	GAAGCCGGCCTTGCACATGCC

PPARγ2: Peroxisome proliferator-activated receptor gamma 2.

Table 3 Significant positive correlation between Crohn’s disease intestinal creeping fat and various scores, mean ± SD

Group	Intestinal CrF	CDAI score	Colonoscopic score
Normal control (n = 30)	17.24 ± 5.16	10.54 ± 3.81	0.00 ± 0.00
Active phase (n = 30)	104.67 ± 26.51a	417.56 ± 34.38a	4.52 ± 1.04a
Quiescent phase (n = 30)	32.69 ± 11.42a,b	132.42 ± 18.39a,b	1.51 ± 0.33a,b

^aP < 0.05 vs the normal control group.

^bP < 0.05 vs the active Crohn’s disease group.

r = 0.927 for Crohn’s disease activity index score; r = 0.904 for colonoscopic score. CrF: Creeping fat; CD: Crohn’s disease; CDAI: Crohn’s disease activity index.

Table 4 Relationship of Crohn’s disease intestinal creeping fat with intestinal inflammation and intestinal fibrosis, mean ± SD

Group	Intestinal CrF	Intestinal inflammatory score	Intestinal fibrosis
Normal control (n = 30)	17.24 ± 5.16	0.00 ± 0.00	4.5 ± 0.83
Active phase (n = 30)	104.67 ± 26.51a	5.06 ± 1.21a	24.9 ± 2.12a
Quiescent phase (n = 30)	32.69 ± 11.42a,b	1.04 ± 0.45a,b	8.4 ± 1.73a,b

^aP < 0.05 vs the normal control group.

^bP < 0.05 vs the active Crohn’s disease group.

r = 0.917 for intestinal inflammatory score; r = 0.932 for intestinal fibrosis. CrF: Creeping fat; CD: Crohn’s disease.

Table 5 Relationship of Crohn’s disease intestinal creeping fat with intestinal tumor necrosis factor-α and transforming growth factor-β protein expression, mean ± SD

Group	Intestinal CrF	TNF-α (ng/L)	TGF-β
Normal control (n = 30)	17.24 ± 5.16	0.002 ± 0.001	0.003 ± 0.001
Active phase (n = 30)	104.67 ± 26.51a	0.047 ± 0.001a	0.011 ± 0.002a
Quiescent phase (n = 30)	32.69 ± 11.42a,b	0.009 ± 0.002a,b	0.005 ± 0.002a,b

^aP < 0.05 vs the normal control group.

^bP < 0.05 vs the active Crohn’s disease group.

r = 0.936 for intestinal tumor necrosis factor-α expression; r = 0.891 for intestinal transforming growth factor-β protein expression. CrF: Creeping fat; CD: Crohn’s disease; TNF-α: Tumor necrosis factor-α; TGF: Transforming growth factor-β.

Table 6 Significant correlation of intestinal creeping fat with intestinal peroxisome proliferator-activated receptor gamma 2 and occludin protein and gene expression, mean ± SD

Group	Intestinal CrF	PPARγ2		Occludin
		Protein	Gene	Protein	Gene
Normal control (n = 30)	17.24 ± 5.16	0.003 ± 0.001	1.14 ± 0.21	0.015 ± 0.002	1.12 ± 0.33
Active phase (n = 30)	104.67 ± 26.51a	0.025 ± 0.002a	5.83 ± 0.17a	0.002 ± 0.001a	0.41 ± 0.08a
Quiescent phase (n = 30)	32.69 ± 11.42a,b	0.004 ± 0.001a,b	2.06 ± 0.20a,b	0.006 ± 0.002a,b	0.65 ± 0.11a,b

^aP < 0.05 vs the normal control group.

^bP < 0.05 vs the active Crohn’s disease group.

r = 0.917 for intestinal peroxisome proliferator-activated receptor gamma 2 expression; r = -0.926 for intestinal occludin protein expression. CrF: Creeping fat; CD: Crohn’s disease; PPARγ2: Peroxisome proliferator-activated receptor gamma 2.