|
1
|
Qureshi Z, Altaf F, Jamil A, Siddique R. Unlocking the Mysteries of Breast Cancer: The Role of Epigenetics in Diagnosis, Treatment, and Beyond. Am J Clin Oncol 2025:00000421-990000000-00264. [PMID: 40025834 DOI: 10.1097/coc.0000000000001177] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 03/04/2025]
Abstract
OBJECTIVES Breast cancer is an intricate and varied disease exhibiting a range of molecular subgroups and clinical consequences. Epigenetic alterations have become essential players in the pathophysiology of breast cancer because they control gene expression without changing the DNA sequence. This review provides a comprehensive overview of epigenetics' diagnostic, prognostic, and therapeutic implications in breast cancer. This review aims to present a comprehensive study of the function of epigenetics in breast cancer, emphasizing current developments and potential avenues for future research. METHODS A narrative review methodology involved an extensive literature search and selection to gather relevant studies and trial data. PubMed, Embase, and Web of Science databases were searched using relevant keywords such as "epigenetics," "breast cancer," "DNA methylation," "histone modification," "noncoding RNA," and "linical trials." Relevant studies and clinical trial data were selected and synthesized to summarize the topic comprehensively. RESULTS The review synthesizes critical findings from current research, underscoring the pivotal role of epigenetic mechanisms in breast cancer initiation, progression, and therapeutic response. It highlights the potential of epigenetic biomarkers for diagnosis and prognosis and the promise of epigenetic-targeted therapies in breast cancer management. Furthermore, the review outlines future directions for research, emphasizing the importance of elucidating the dynamic interplay between epigenetic alterations and tumor microenvironments in shaping breast cancer phenotypes. CONCLUSIONS Epigenetic modifications influence breast cancer progression, diagnosis, and therapy. Emerging biomarkers and targeted treatments hold promise, but further research is essential to refine their clinical application and improve personalized cancer management strategies.
Collapse
Affiliation(s)
- Zaheer Qureshi
- The Frank H. Netter M.D. School of Medicine at Quinnipiac University, Bridgeport, CT
| | - Faryal Altaf
- Department of Internal Medicine, Icahn School of Medicine at Mount Sinai/BronxCare Health System, Mount Sinai
| | - Abdur Jamil
- Department of Medicine, Samaritan Medical Centre
| | | |
Collapse
|
|
2
|
Aldakheel FM, Alnajran H, Alduraywish SA, Mateen A, Alqahtani MS, Syed R. Analysing DNA methylation and transcriptomic signatures to predict prostate cancer recurrence risk. Discov Oncol 2025; 16:110. [PMID: 39893332 PMCID: PMC11787142 DOI: 10.1007/s12672-025-01833-8] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 08/10/2024] [Accepted: 01/17/2025] [Indexed: 02/04/2025] Open
Abstract
Prostate cancer (PCa) remains a significant global health challenge, with approximately 1.6 million new cases and 366,000 deaths annually. Despite high survival rates for localized prostate cancer, recurrence poses a substantial risk due to inherent biological factors and residual disease. Early detection and intervention are essential for enhancing patient outcomes and reducing mortality. However, traditional diagnostics such as PSA tests, digital rectal examinations, and biopsies often lack specificity resulting in overdiagnosis. There is a pressing need for novel biomarkers to enhance precision medicine approaches for PCa. This study employs a machine learning approach to identify DNA methylation and RNA expression biomarkers predictive of PCa recurrence using datasets from The Cancer Genome Atlas (TCGA). We analyzed 49,133 genes, identifying 684 differentially methylated genes (DMGs) and 691 differentially expressed genes (DEGs) between recurrence and non-recurrence groups. Ten genes (TNNI2, SPIN2, COL5A3, RNF169, CCND1, FGFR1, SLC17A2, FAMM71F2, RREB1, AOX1) were found to have significant correlations between methylation and expression, forming the basis for our predictive model. A support vector machine (SVM) model was developed using these ten genes, achieving an area under the curve (AUC) of 0.773, demonstrating robust predictive capability. Multivariate regression analysis confirmed the SVM score as an independent predictor of recurrence (HR = 0.45; 95% CI 0.28-0.69, P < 0.001). The analysis of recurrence-free survival suggested that patients with low-risk scores experienced significantly better outcomes compared to those with high-risk scores. Functional enrichment analyses of DMGs revealed significant involvement in biological processes such as transcription regulation, signal transduction, and immune response, highlighting the potential mechanistic pathways of these biomarkers. Validation using real-time PCR confirmed differential expression and methylation patterns of the identified genes in prostate cancer (PC3) and non-cancerous cell lines (PNT2). In conclusion, our study hihglights the DNA methylation biomarkers linked to PCa recurrence and introduces a promising SVM model for early prediction, potentially improving treatment outcomes. Further research is needed to explore the biological roles of these genes in PCa aiming to refine therapeutic approaches.
Collapse
Affiliation(s)
- Fahad M Aldakheel
- Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, King Saud University, P.O. Box 10219, 11433, Riyadh, Saudi Arabia
| | - Hadeel Alnajran
- Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, King Saud University, P.O. Box 10219, 11433, Riyadh, Saudi Arabia
| | - Shatha A Alduraywish
- Department of Family and Community Medicine, College of Medicine, King Saud University, Riyadh, Saudi Arabia
| | - Ayesha Mateen
- Department of Pharmaceutics, College of Pharmacy, King Saud University, PO Box 2457, Riyadh-11451, Saudi Arabia
| | - Mohammed S Alqahtani
- Department of Pharmaceutics, College of Pharmacy, King Saud University, PO Box 2457, Riyadh-11451, Saudi Arabia
| | - Rabbani Syed
- Department of Pharmaceutics, College of Pharmacy, King Saud University, PO Box 2457, Riyadh-11451, Saudi Arabia.
| |
Collapse
|
|
3
|
Walker A, Fang CS, Schroff C, Serrano J, Vasudevaraja V, Yang Y, Belakhoua S, Faustin A, William CM, Zagzag D, Chiang S, Acosta AM, Movahed-Ezazi M, Park K, Moreira AL, Darvishian F, Galbraith K, Snuderl M. Deep learning-based classifier for carcinoma of unknown primary using methylation quantitative trait loci. J Neuropathol Exp Neurol 2025; 84:147-154. [PMID: 39607989 PMCID: PMC11747144 DOI: 10.1093/jnen/nlae123] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/30/2024] Open
Abstract
Cancer of unknown primary (CUP) constitutes between 2% and 5% of human malignancies and is among the most common causes of cancer death in the United States. Brain metastases are often the first clinical presentation of CUP; despite extensive pathological and imaging studies, 20%-45% of CUP are never assigned a primary site. DNA methylation array profiling is a reliable method for tumor classification but tumor-type-specific classifier development requires many reference samples. This is difficult to accomplish for CUP as many cases are never assigned a specific diagnosis. Recent studies identified subsets of methylation quantitative trait loci (mQTLs) unique to specific organs, which could help increase classifier accuracy while requiring fewer samples. We performed a retrospective genome-wide methylation analysis of 759 carcinoma samples from formalin-fixed paraffin-embedded tissue samples using Illumina EPIC array. Utilizing mQTL specific for breast, lung, ovarian/gynecologic, colon, kidney, or testis (BLOCKT) (185k total probes), we developed a deep learning-based methylation classifier that achieved 93.12% average accuracy and 93.04% average F1-score across a 10-fold validation for BLOCKT organs. Our findings indicate that our organ-based DNA methylation classifier can assist pathologists in identifying the site of origin, providing oncologists insight on a diagnosis to administer appropriate therapy, improving patient outcomes.
Collapse
Affiliation(s)
- Adam Walker
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Camila S Fang
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
- Brain and Spine Tumor Center, Laura and Isaac Perlmutter Cancer Center, NYU Langone Health, New York, NY, United States
| | - Chanel Schroff
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Jonathan Serrano
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Varshini Vasudevaraja
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Yiying Yang
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Sarra Belakhoua
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Arline Faustin
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Christopher M William
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - David Zagzag
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Sarah Chiang
- Department of Pathology and Laboratory Medicine, Memorial Sloan Kettering Cancer Center, New York, NY, United States
| | | | - Misha Movahed-Ezazi
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Kyung Park
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Andre L Moreira
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Farbod Darvishian
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Kristyn Galbraith
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
| | - Matija Snuderl
- Department of Pathology, NYU Langone Health and NYU Grossman School of Medicine, New York, NY, United States
- Brain and Spine Tumor Center, Laura and Isaac Perlmutter Cancer Center, NYU Langone Health, New York, NY, United States
| |
Collapse
|
|
4
|
Serpeloni JM, Silva IMD, van Helvoort Lengert A, de Souza MF, Dos Reis MB, Kuasne H, Fuganti PE, Cólus IMDS. Genetic polymorphisms, methylation, and expression levels in the GSTP1 and MGMT genes in urothelial bladder tumors. Gene 2024; 939:149158. [PMID: 39706230 DOI: 10.1016/j.gene.2024.149158] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/12/2024] [Revised: 12/06/2024] [Accepted: 12/09/2024] [Indexed: 12/23/2024]
Abstract
BACKGROUND Alteration in DNA repair and metabolism genes can affect the maintenance of DNA integrity or xenobiotics metabolism, potentially leading to DNA damage accumulation. The present study investigated the association between polymorphisms in Glutathione S-Transferase Pi 1 (GSTP1, rs1695) and O-6-Methylguanine-DNA Methyltransferase (MGMT, rs2308321) genes with urothelial bladder cancer (UBC) susceptibility and prognosis. Furthermore, the methylation patterns of the promoter region of these genes were analyzed in tumor and non-tumor bladder tissues, besides MGMT gene expression in tumor samples. METHODS AND RESULTS Blood samples of 295 patients and 295 healthy controls were genotyped using TaqMan probe assays. The DNA of 39 bladder tumors and 4 adjacent non-tumor samples were used in the Methylation-Sensitive High-Resolution Melting (MS-HRM) assay. Neither polymorphism conferred UBC susceptibility/protection or affected tumor grade, muscle invasion, and recurrence). GSTP1 did not show methylation in the promoter region, while in the MGMT gene, all samples presented heterogeneous methylation with no significant differences between tumor and non-tumor tissues. High MGMT expression was associated with low-grade (p = 0.0153) and trends related to non-invasive tumors (p = 0.070). CONCLUSIONS In our cohort, MGMT expression seems helpful as a biomarker of good prognosis (low-grade and absence of muscle invasion). A heterogeneous methylation pattern in the MGMT gene requires additional investigation to elucidate its potential implications.
Collapse
Affiliation(s)
- Juliana Mara Serpeloni
- State University of Londrina (UEL), Department of General Biology, Center of Biological Sciences, Londrina, PR 86057-970, Brazil.
| | - Isabely Mayara da Silva
- State University of Londrina (UEL), Department of General Biology, Center of Biological Sciences, Londrina, PR 86057-970, Brazil.
| | - André van Helvoort Lengert
- State University of Londrina (UEL), Department of General Biology, Center of Biological Sciences, Londrina, PR 86057-970, Brazil.
| | - Marilesia Ferreira de Souza
- State University of Londrina (UEL), Department of General Biology, Center of Biological Sciences, Londrina, PR 86057-970, Brazil.
| | | | - Hellen Kuasne
- McGill University, Rosalind and Morris Goodman Cancer Institute, Montreal H3A1A3, QC, Canada.
| | | | - Ilce Mara de Syllos Cólus
- State University of Londrina (UEL), Department of General Biology, Center of Biological Sciences, Londrina, PR 86057-970, Brazil.
| |
Collapse
|
|
5
|
Jotanovic J, Boldt HB, Burton M, Andersen MS, Bengtsson D, Bontell TO, Ekman B, Engström BE, Feldt-Rasmussen U, Heck A, Jakovcevic A, Jørgensen JOL, Kraljevic I, Kunicki J, Lindsay JR, Losa M, Loughrey PB, Maiter D, Maksymowicz M, Manojlovic-Gacic E, Pahnke J, Petersenn S, Petersson M, Popovic V, Ragnarsson O, Rasmussen ÅK, Reisz Z, Saeger W, Schalin-Jäntti C, Scheie D, Terreni MR, Tynninen O, Whitelaw B, Burman P, Casar-Borota O. Genome-wide methylation profiling differentiates benign from aggressive and metastatic pituitary neuroendocrine tumors. Acta Neuropathol 2024; 148:68. [PMID: 39580368 PMCID: PMC11585505 DOI: 10.1007/s00401-024-02836-5] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/20/2024] [Revised: 11/01/2024] [Accepted: 11/17/2024] [Indexed: 11/25/2024]
Abstract
Aggressive pituitary neuroendocrine tumors (PitNETs)/adenomas are characterized by progressive growth despite surgery and all standard medical therapies and radiotherapy. A subset will metastasize to the brain and/or distant locations and are termed metastatic PitNETs (pituitary carcinomas). Studies of potential prognostic markers have been limited due to the rarity of these tumors. A few recurrent somatic mutations have been identified, and epigenetic alterations and chromosomal rearrangements have not been explored in larger cohorts of aggressive and metastatic PitNETs. In this study, we performed genome-wide methylation analysis, including copy-number variation (CNV) calculations, on tumor tissue specimens from a large international cohort of 64 patients with aggressive (48) and metastatic (16) pituitary tumors. Twelve patients with non-invasive pituitary tumors (Knosp 0-2) exhibiting an indolent course over a 5 year follow-up served as controls. In an unsupervised hierarchical cluster analysis, aggressive/metastatic PitNETs clustered separately from benign pituitary tumors, and, when only specimens from the first surgery were analyzed, three separate clusters were identified: aggressive, metastatic, and benign PitNETs. Numerous CNV events affecting chromosomal arms and whole chromosomes were frequent in aggressive and metastatic, whereas benign tumors had normal chromosomal copy numbers with only few alterations. Genome-wide methylation analysis revealed different CNV profiles and a clear separation between aggressive/metastatic and benign pituitary tumors, potentially providing biomarkers for identification of these tumors with a worse prognosis at the time of first surgery. The data may refine follow-up routines and contribute to the timely introduction of adjuvant therapy in patients harboring, or at risk of developing, aggressive or metastatic pituitary tumors.
Collapse
Affiliation(s)
- Jelena Jotanovic
- Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden
- Department of Clinical Pathology, Uppsala University Hospital, Uppsala, Sweden
| | - Henning Bünsow Boldt
- Department of Clinical Research, University of Southern Denmark, Odense, Denmark
- Department of Pathology, Odense University Hospital, Odense, Denmark
| | - Mark Burton
- Department of Clinical Research, Faculty of Health Sciences, University of Southern Denmark, Odense, Denmark
- Department of Clinical Genetics, Odense University Hospital, Odense, Denmark
- Clinical Genome Center, University of Southern Denmark, Odense, Denmark
| | - Marianne Skovsager Andersen
- Department of Clinical Research, University of Southern Denmark, Odense, Denmark
- Department of Endocrinology, Odense University Hospital, Odense, Denmark
| | - Daniel Bengtsson
- Department of Health, Medicine and Caring Sciences, Linköping University, Linköping, Sweden
- Department of Internal Medicine, Kalmar County Hospital, Kalmar, Sweden
| | - Thomas Olsson Bontell
- Department of Physiology, Institute of Neuroscience and Physiology, Sahlgrenska Academy, University of Gothenburg, Gothenburg, Sweden
- Department of Clinical Pathology, Sahlgrenska University Hospital, Gothenburg, Sweden
| | - Bertil Ekman
- Department of Endocrinology in Linköping, Department of Internal Medicine in Norrköping, and Department of Health, Medicine and Caring Sciences, Linköping University, Linköping, Sweden
| | - Britt Edén Engström
- Department of Medical Sciences, Endocrinology and Mineral Metabolism, Uppsala University, Uppsala, Sweden
- Department of Endocrinology and Diabetes, Uppsala University Hospital, Uppsala, Sweden
| | - Ulla Feldt-Rasmussen
- Department of Medical Endocrinology and Metabolism, Rigshospitalet, Copenhagen, Denmark
- Institute of Clinical Medicine, Faculty of Health Research Sciences, Copenhagen University, Copenhagen, Denmark
| | - Ansgar Heck
- Section for Specialized Endocrinology, Oslo University Hospital, Oslo, Norway
| | - Antonia Jakovcevic
- Department of Pathology and Cytology, University Hospital Center Zagreb, Zagreb, Croatia
- School of Medicine, University of Zagreb, Zagreb, Croatia
| | - Jens Otto L Jørgensen
- Department of Endocrinology and Internal Medicine, Aarhus University Hospital, Aarhus, Denmark
| | - Ivana Kraljevic
- School of Medicine, University of Zagreb, Zagreb, Croatia
- Department of Endocrinology, University Hospital Center Zagreb, Zagreb, Croatia
| | - Jacek Kunicki
- Department of Neurosurgery, Maria Sklodowska-Curie National Research Institute of Oncology, Warsaw, Poland
| | - John R Lindsay
- Regional Centre for Endocrinology and Diabetes, Royal Victoria Hospital, Belfast Health and Social Care Trust, Belfast, UK
| | - Marco Losa
- Department of Neurosurgery, IRCCS San Raffaele Scientific Institute, Vita-Salute University, Milan, Italy
| | - Paul Benjamin Loughrey
- Regional Centre for Endocrinology and Diabetes, Royal Victoria Hospital, Belfast Health and Social Care Trust, Belfast, UK
- Patrick G Johnston Centre for Cancer Research, Queen's University Belfast, Belfast, UK
| | - Dominique Maiter
- Department of Endocrinology and Nutrition, UCL, Cliniques Universitaires Saint-Luc, Brussels, Belgium
| | - Maria Maksymowicz
- Department of Cancer Pathomorphology, Maria Sklodowska-Curie National Research Institute of Oncology, Warsaw, Poland
| | | | - Jens Pahnke
- Translational Neurodegeneration Research and Neuropathology Lab, Department of Clinical Medicine, Medical Faculty, University of Oslo, Oslo, Norway
- Section of Neuropathology Research, Department of Pathology, Clinics for Laboratory Medicine, Oslo University Hospital, Oslo, Norway
| | - Stephan Petersenn
- ENDOC Center for Endocrine Tumors, Hamburg, Germany
- University of Duisburg-Essen, Essen, Germany
| | - Maria Petersson
- Department of Endocrinology, Karolinska University Hospital, Stockholm, Sweden
- Department of Molecular Medicine and Surgery, Karolinska Institutet, Stockholm, Sweden
| | - Vera Popovic
- Medical Faculty, University of Belgrade, Belgrade, Serbia
| | - Oskar Ragnarsson
- Department of Endocrinology, Sahlgrenska University Hospital, Gothenburg, Sweden
- Department of Internal Medicine and Clinical Nutrition, Institute of Medicine, Sahlgrenska Academy, University of Gothenburg, Gothenburg, Sweden
- Wallenberg Centre for Molecular and Translational Medicine, Institute of Medicine, University of Gothenburg, Gothenburg, Sweden
| | - Åse Krogh Rasmussen
- Department of Nephrology and Endocrinology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark
| | - Zita Reisz
- Department of Clinical Neuropathology, King's College Hospital, NHS Foundation Trust, London, UK
| | - Wolfgang Saeger
- Institute of Neuropathology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany
- Institute of Pathology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany
| | - Camilla Schalin-Jäntti
- Endocrinology, Abdominal Center, Helsinki University Hospital, Helsinki, Finland
- University of Helsinki, ENDO-ERN (European Reference Network On Rare Endocrine Conditions), Helsinki, Finland
| | - David Scheie
- Department of Pathology, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark
- Department of Clinical Medicine, University of Copenhagen, Copenhagen, Denmark
| | - Maria Rosa Terreni
- Department of Pathology, IRCCS San Raffaele Scientific Institute, Vita-Salute University, Milan, Italy
| | - Olli Tynninen
- University of Helsinki, ENDO-ERN (European Reference Network On Rare Endocrine Conditions), Helsinki, Finland
- Department of Pathology, Helsinki University Hospital, University of Helsinki, Helsinki, Finland
| | - Ben Whitelaw
- Department of Endocrinology, King's College Hospital, NHS Foundation Trust, London, UK
| | - Pia Burman
- Department of Endocrinology, Skåne University Hospital, Lund University, Malmö, Sweden
| | - Olivera Casar-Borota
- Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden.
- Department of Clinical Pathology, Uppsala University Hospital, Uppsala, Sweden.
| |
Collapse
|
|
6
|
Li H, Luo F, Sun X, Liao C, Wang G, Han Y, Li L, Xu C, Wang W, Cai S, Li G, Wu D. A differentially-methylated-region signature predicts the recurrence risk for patients with early stage lung adenocarcinoma. Aging (Albany NY) 2024; 16:13323-13339. [PMID: 39560475 PMCID: PMC11719112 DOI: 10.18632/aging.206139] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/10/2023] [Accepted: 09/02/2024] [Indexed: 11/20/2024]
Abstract
Predicting prognosis in lung cancer patients is important in establishing future treatment and monitoring plans. Lung adenocarcinoma (LUAD) is the most common and aggressive type of lung cancer with dismal prognosis and prognostic stratification would help to guide treatment. Aberrant DNA methylation in tumors occurs earlier than clinical variations, and keeps accumulating as cancer progresses. Preliminary studies have given us some clues that DNA methylation might serve as a promising biomarker for prognosis prediction. Herein, we aimed to study the potential utility of DNA methylation pattern in predicting the recurrence risk of early stage resectable LUAD and to develop a risk-modeling signature based on differentially methylated regions (DMRs). This study consisted of three cohorts of 244 patients with stage I-IIIA LUAD, including marker discovery cohort (n = 39), prognostic model training cohort (n = 117) and validation cohort (n = 80). 468 DMRs between LUAD tumor and adjacent tissues were screened out in the marker discovery cohort (adjusted P < 0.05), and a prognostic signature was developed based on 15 DMRs significantly related to disease-free survival in early stage LUAD patients. The DMR signature showed commendable performance in predicting the recurrence risk of LUAD patients both in model training cohort (P < 0.001; HR = 4.32, 95% CI = 2.39-7.80) and model validation cohort (P = 0.009; HR = 9.08, 95% CI = 1.20-68.80), which might be of great utility both for understanding the molecular basis of LUAD relapse, providing risk stratification of patients, and establishing future monitoring plans.
Collapse
Affiliation(s)
- Heng Li
- Yunnan Cancer Hospital and The Third Affiliated Hospital of Kunming Medical University and Yunnan Cancer Center, Kunming, P.R. China
| | - Fuchao Luo
- Chongqing University Fuling Hospital, Chongqing, P.R. China
| | | | | | | | | | - Leo Li
- Burning Rock Biotech, Guangzhou, P.R. China
| | - Chunwei Xu
- Institute of Basic Medicine and Cancer, Chinese Academy of Sciences, Hangzhou, P.R. China
| | - Wenxian Wang
- The Cancer Hospital of the University of Chinese Academy of Sciences, Hangzhou, P.R. China
| | | | - Gao Li
- Hainan General Hospital, Hainan Affiliated Hospital of Hainan Medical University, Haikou, P.R. China
| | - Di Wu
- The First Affiliated Hospital of Southern University of Science and Technology (Shenzhen People’s Hospital), Shenzhen, P.R. China
| |
Collapse
|
|
7
|
Kim C, Oh S, Im H, Gim J. Unveiling Bladder Cancer Prognostic Insights by Integrating Patient-Matched Sample and CpG Methylation Analysis. MEDICINA (KAUNAS, LITHUANIA) 2024; 60:1175. [PMID: 39064604 PMCID: PMC11279046 DOI: 10.3390/medicina60071175] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Subscribe] [Scholar Register] [Received: 04/30/2024] [Revised: 07/07/2024] [Accepted: 07/17/2024] [Indexed: 07/28/2024]
Abstract
Bladder cancer prognosis remains a pressing clinical challenge, necessitating the identification of novel biomarkers for precise survival prediction and improved quality of life outcomes. This study proposes a comprehensive strategy to uncover key prognostic biomarkers in bladder cancer using DNA methylation analysis and extreme survival pattern observations in matched pairs of cancer and adjacent normal cells. Unlike traditional approaches that overlook cancer heterogeneity by analyzing entire samples, our methodology leverages patient-matched samples to account for this variability. Specifically, DNA methylation profiles from adjacent normal bladder tissue and bladder cancer tissue collected from the same individuals were analyzed to pinpoint critical methylation changes specific to cancer cells while mitigating confounding effects from individual genetic differences. Utilizing differential threshold settings for methylation levels within cancer-associated pathways enabled the identification of biomarkers that significantly impact patient survival. Our analysis identified distinct survival patterns associated with specific CpG sites, underscoring these sites' pivotal roles in bladder cancer outcomes. By hypothesizing and testing the influence of methylation levels on survival, we pinpointed CpG biomarkers that profoundly affect the prognosis. Notably, CpG markers, such as cg16269144 (PRKCZ), cg16624272 (PTK2), cg11304234, and cg26534425 (IL18), exhibited critical methylation thresholds that correlate with patient mortality. This study emphasizes the importance of tailored approaches to enhancing prognostic accuracy and refining therapeutic strategies for bladder cancer patients. The identified biomarkers pave the way for personalized prognostication and targeted interventions, promising advancements in bladder cancer management and patient care.
Collapse
Affiliation(s)
- Chanbyeol Kim
- Department of Biomedical Science, Chosun University, Gwangju 61452, Republic of Korea; (C.K.); (S.O.); (H.I.)
- AI Convergence College, Chosun University, Gwangju 61452, Republic of Korea
| | - Sangwon Oh
- Department of Biomedical Science, Chosun University, Gwangju 61452, Republic of Korea; (C.K.); (S.O.); (H.I.)
- AI Convergence College, Chosun University, Gwangju 61452, Republic of Korea
| | - Hamin Im
- Department of Biomedical Science, Chosun University, Gwangju 61452, Republic of Korea; (C.K.); (S.O.); (H.I.)
- AI Convergence College, Chosun University, Gwangju 61452, Republic of Korea
| | - Jungsoo Gim
- Department of Biomedical Science, Chosun University, Gwangju 61452, Republic of Korea; (C.K.); (S.O.); (H.I.)
- AI Convergence College, Chosun University, Gwangju 61452, Republic of Korea
- BK FOUR Department of Integrative Biological Science, Chosun University, Gwangju 61452, Republic of Korea
- Well-Ageing Medicare Institute, Chosun University, Gwangju 61452, Republic of Korea
- Asian Dementia Research Initiative, Chosun University, Gwangju 61452, Republic of Korea
| |
Collapse
|
|
8
|
Fialková V, Ďúranová H, Borotová P, Klongová L, Grabacka M, Speváková I. Natural Stilbenes: Their Role in Colorectal Cancer Prevention, DNA Methylation, and Therapy. Nutr Cancer 2024; 76:760-788. [PMID: 38950568 DOI: 10.1080/01635581.2024.2364391] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/05/2024] [Revised: 05/29/2024] [Accepted: 05/31/2024] [Indexed: 07/03/2024]
Abstract
The resistance of colorectal cancer (CRC) to conventional therapeutic modalities, such as radiation therapy and chemotherapy, along with the associated side effects, significantly limits effective anticancer strategies. Numerous epigenetic investigations have unveiled that naturally occurring stilbenes can modify or reverse abnormal epigenetic alterations, particularly aberrant DNA methylation status, offering potential avenues for preventing or treating CRC. By modulating the activity of the DNA methylation machinery components, phytochemicals may influence the various stages of CRC carcinogenesis through multiple molecular mechanisms. Several epigenetic studies, especially preclinical research, have highlighted the effective DNA methylation modulatory effects of stilbenes with minimal adverse effects on organisms, particularly in combination therapies for CRC. However, the available preclinical and clinical data regarding the effects of commonly encountered stilbenes against CRC are currently limited. Therefore, additional epigenetic research is warranted to explore the preventive potential of these phytochemicals in CRC development and to validate their therapeutic application in the prevention and treatment of CRC. This review aims to provide an overview of selected bioactive stilbenes as potential chemopreventive agents for CRC with a focus on their modulatory mechanisms of action, especially in targeting alterations in DNA methylation machinery in CRC.
Collapse
Affiliation(s)
- Veronika Fialková
- AgroBioTech Research Centre, Slovak University of Agriculture, Nitra, Slovakia
| | - Hana Ďúranová
- AgroBioTech Research Centre, Slovak University of Agriculture, Nitra, Slovakia
| | - Petra Borotová
- AgroBioTech Research Centre, Slovak University of Agriculture, Nitra, Slovakia
| | - Lucia Klongová
- AgroBioTech Research Centre, Slovak University of Agriculture, Nitra, Slovakia
| | - Maja Grabacka
- Department of Biotechnology and General Technology of Foods, Faculty of Food Technology, University of Agriculture, Cracow, Poland
| | - Ivana Speváková
- AgroBioTech Research Centre, Slovak University of Agriculture, Nitra, Slovakia
| |
Collapse
|
|
9
|
Ruskin P, Pandi C, Kannan B, Pandi A, A S SG, Jayaseelan VP, Arumugam P. Triggering Receptor Expression on Myeloid Cells-1 (TREM1) Promoter Hypomethylation and Its Overexpression Associated With Poor Survival of Cancer Patients: A Pan-Cancer Analysis. Cureus 2024; 16:e64640. [PMID: 39149674 PMCID: PMC11326766 DOI: 10.7759/cureus.64640] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/15/2024] [Accepted: 07/13/2024] [Indexed: 08/17/2024] Open
Abstract
Background Triggering receptor expression on myeloid cells-1 (TREM1) belongs to the immunoglobulin superfamily and is implicated in various conditions, including infectious and non-infectious diseases, autoimmune disorders, and cancer. Notably, TREM1 is significantly dysregulated in numerous cancer types. However, the underlying mechanism driving TREM1 mRNA expression in cancers remains unclear. Objective This study aims to analyze the promoter methylation level of TREM1 and its overexpression with cancer. Methods This study utilized The Cancer Genome Atlas (TCGA) cohort to analyze the methylation and expression levels of TREM1 in cancers. The University of ALabama at Birmingham CANcer (UALCAN) database facilitated data analysis from the TCGA dataset. Additionally, survival analysis was conducted using the TCGA dataset via Kaplan-Meier (KM) plots to identify significant associations with prognosis. Results Promoter methylation analysis revealed that TREM1 is hypomethylated in cancers, resulting in significantly overexpressed mRNA across various cancer types. This methylation and expression showed a negative correlation. Furthermore, high TREM1 mRNA expression was linked to poor prognosis in several cancers. Conclusion TREM1 gene expression negatively correlates with promotor DNA methylation and is associated with poor survival. It may serve as a prognostic marker and biomarker for various cancers. Future research should focus on further validation and antitumor immunity to elucidate its oncogenic role in cancers.
Collapse
Affiliation(s)
- Pinky Ruskin
- Microbiology, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai, IND
| | - Chandra Pandi
- Molecular Biology Lab, Centre for Cellular and Molecular Research, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai, IND
| | - Balachander Kannan
- Molecular Biology Lab, Centre for Cellular and Molecular Research, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai, IND
| | - Anitha Pandi
- Clinical Genetics Lab, Centre for Cellular and Molecular Research, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai, IND
| | - Smiline Girija A S
- Microbiology, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai, IND
| | - Vijayashree Priyadharsini Jayaseelan
- Clinical Genetics Lab, Centre for Cellular and Molecular Research, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai, IND
| | - Paramasivam Arumugam
- Molecular Biology Lab, Centre for Cellular and Molecular Research, Saveetha Dental College and Hospitals, Saveetha Institute of Medical and Technical Sciences, Saveetha University, Chennai, IND
| |
Collapse
|
|
10
|
Buckley DN, Tew BY, Gooden C, Salhia B. A comprehensive analysis of minimally differentially methylated regions common to pediatric and adult solid tumors. NPJ Precis Oncol 2024; 8:125. [PMID: 38824198 PMCID: PMC11144230 DOI: 10.1038/s41698-024-00590-1] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/07/2023] [Accepted: 04/14/2024] [Indexed: 06/03/2024] Open
Abstract
Cancer is the second most common cause of death in children aged 1-14 years in the United States, with 11,000 new cases and 1200 deaths annually. Pediatric cancers typically have lower mutational burden compared to adult-onset cancers, however, the epigenomes in pediatric cancer are highly altered, with widespread DNA methylation changes. The rarity of pediatric cancers poses a significant challenge to developing cancer-type specific biomarkers for diagnosis, prognosis, or treatment monitoring. In the current study, we explored the potential of a DNA methylation profile common across various pediatric cancers. To do this, we conducted whole genome bisulfite sequencing (WGBS) on 31 recurrent pediatric tumor tissues, 13 normal tissues, and 20 plasma cell-free (cf)DNA samples, representing 11 different pediatric cancer types. We defined minimal focal regions that were differentially methylated across samples in the multiple cancer types which we termed minimally differentially methylated regions (mDMRs). These methylation changes were also observed in 506 pediatric and 5691 adult cancer samples accessed from publicly available databases, and in 44 pediatric cancer samples we analyzed using a targeted hybridization probe capture assay. Finally, we found that these methylation changes were detectable in cfDNA and could serve as potential cfDNA methylation biomarkers for early detection or minimal residual disease.
Collapse
Affiliation(s)
- David N Buckley
- Department of Translational Genomics, Keck School of Medicine, University of Southern California, Los Angeles, CA, USA
| | - Ben Yi Tew
- Department of Translational Genomics, Keck School of Medicine, University of Southern California, Los Angeles, CA, USA
| | - Chris Gooden
- Department of Translational Genomics, Keck School of Medicine, University of Southern California, Los Angeles, CA, USA
| | - Bodour Salhia
- Department of Translational Genomics, Keck School of Medicine, University of Southern California, Los Angeles, CA, USA.
- Norris Comprehensive Cancer Center, University of Southern California, Los Angeles, CA, USA.
| |
Collapse
|
|
11
|
Dong J, Zhao X, Song X, Wang S, Zhao X, Liang B, Long Y, Xing Z. Identification of Eleutherococcus senticosus NAC transcription factors and their mechanisms in mediating DNA methylation of EsFPS, EsSS, and EsSE promoters to regulate saponin synthesis. BMC Genomics 2024; 25:536. [PMID: 38816704 PMCID: PMC11140872 DOI: 10.1186/s12864-024-10442-8] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/08/2024] [Accepted: 05/22/2024] [Indexed: 06/01/2024] Open
Abstract
BACKGROUND The formation of pharmacologically active components in medicinal plants is significantly impacted by DNA methylation. However, the exact mechanisms through which DNA methylation regulates secondary metabolism remain incompletely understood. Research in model species has demonstrated that DNA methylation at the transcription factor binding site within functional gene promoters can impact the binding of transcription factors to target DNA, subsequently influencing gene expression. These findings suggest that the interaction between transcription factors and target DNA could be a significant mechanism through which DNA methylation regulates secondary metabolism in medicinal plants. RESULTS This research conducted a comprehensive analysis of the NAC family in E. senticosus, encompassing genome-wide characterization and functional analysis. A total of 117 EsNAC genes were identified and phylogenetically divided into 15 subfamilies. Tandem duplications and chromosome segment duplications were found to be the primary replication modes of these genes. Motif 2 was identified as the core conserved motif of the genes, and the cis-acting elements, gene structures, and expression patterns of each EsNAC gene were different. EsJUB1, EsNAC047, EsNAC098, and EsNAC005 were significantly associated with the DNA methylation ratio in E. senticosus. These four genes were located in the nucleus or cytoplasm and exhibited transcriptional self-activation activity. DNA methylation in EsFPS, EsSS, and EsSE promoters significantly reduced their activity. The methyl groups added to cytosine directly hindered the binding of the promoters to EsJUB1, EsNAC047, EsNAC098, and EsNAC005 and altered the expression of EsFPS, EsSS, and EsSE genes, eventually leading to changes in saponin synthesis in E. senticosus. CONCLUSIONS NAC transcription factors that are hindered from binding by methylated DNA are found in E. senticosus. The incapacity of these NACs to bind to the promoter of the methylated saponin synthase gene leads to subsequent alterations in gene expression and saponin synthesis. This research is the initial evidence showcasing the involvement of EsNAC in governing the impact of DNA methylation on saponin production in E. senticosus.
Collapse
Affiliation(s)
- Jing Dong
- College of Life Sciences, North China University of Science and Technology, Tangshan, 063210, Hebei, China
| | - Xuelei Zhao
- College of Life Sciences, North China University of Science and Technology, Tangshan, 063210, Hebei, China
| | - Xin Song
- College of Life Sciences, North China University of Science and Technology, Tangshan, 063210, Hebei, China
| | - Shuo Wang
- College of Life Sciences, North China University of Science and Technology, Tangshan, 063210, Hebei, China
| | - Xueying Zhao
- College of Life Sciences, North China University of Science and Technology, Tangshan, 063210, Hebei, China
| | - Baoxiang Liang
- College of Life Sciences, North China University of Science and Technology, Tangshan, 063210, Hebei, China
| | - Yuehong Long
- College of Life Sciences, North China University of Science and Technology, Tangshan, 063210, Hebei, China.
| | - Zhaobin Xing
- College of Life Sciences, North China University of Science and Technology, Tangshan, 063210, Hebei, China.
| |
Collapse
|
|
12
|
Takane K, Cai T, Noguchi R, Gohda Y, Ikenoue T, Yamaguchi K, Ota Y, Kiyomatsu T, Yano H, Fukuyo M, Seki M, Bahityar R, Kaneda A, Furukawa Y. Genome-Wide Analysis of DNA Methylation in Pseudomyxoma Peritonei Originated from Appendiceal Neoplasms. Oncology 2024; 102:720-731. [PMID: 38262376 DOI: 10.1159/000536219] [Citation(s) in RCA: 1] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/07/2023] [Accepted: 01/09/2024] [Indexed: 01/25/2024]
Abstract
INTRODUCTION Pseudomyxoma peritonei (PMP) is a disease characterized by progressive accumulation of intraperitoneal mucinous ascites produced by neoplasms in the abdominal cavity. Since the prognosis of patients with PMP remains unsatisfactory, the development of effective therapeutic drug(s) is a matter of pressing concern. Genetic analyses of PMP have clarified the frequent activation of GNAS and/or KRAS. However, the involvement of global epigenetic alterations in PMPs has not been reported. METHODS To clarify the genetic background of the 15 PMP tumors, we performed genetic analysis using AmpliSeq Cancer HotSpot Panel v2. We further investigated global DNA methylation in the 15 tumors and eight noncancerous colonic epithelial tissues using MethylationEPIC array BeadChip (Infinium 850k) containing a total of 865,918 probes. RESULTS This is the first report of comprehensive DNA methylation profiles of PMPs in the world. We clarified that the 15 PMPs could be classified into at least two epigenotypes, unique methylation epigenotype (UME) and normal-like methylation epigenotype (NLME), and that genes associated with neuronal development and synaptic signaling may be involved in the development of PMPs. In addition, we identified a set of hypermethylation marker genes such as HOXD1 and TSPYL5 in the 15 PMPs. CONCLUSIONS These findings may help the understanding of the molecular mechanism(s) of PMP and contribute to the development of therapeutic strategies for this life-threatening disease.
Collapse
Affiliation(s)
- Kiyoko Takane
- Clinical Genome Research, The Institute of Medical Science, The University of Tokyo, Tokyo, Japan,
| | - Tingwei Cai
- Clinical Genome Research, The Institute of Medical Science, The University of Tokyo, Tokyo, Japan
| | - Rei Noguchi
- Division of Rare Cancer Research, National Cancer Center Research Institute, Tokyo, Japan
| | - Yoshimasa Gohda
- Department of Surgery, National Center for Global Health and Medicine, Tokyo, Japan
| | - Tsuneo Ikenoue
- Clinical Genome Research, The Institute of Medical Science, The University of Tokyo, Tokyo, Japan
| | - Kiyoshi Yamaguchi
- Clinical Genome Research, The Institute of Medical Science, The University of Tokyo, Tokyo, Japan
| | - Yasunori Ota
- Department of Pathology, Research Hospital, The Institute of Medical Science, The University of Tokyo, Tokyo, Japan
| | - Tomomichi Kiyomatsu
- Department of Surgery, National Center for Global Health and Medicine, Tokyo, Japan
| | - Hideaki Yano
- Department of Surgery, National Center for Global Health and Medicine, Tokyo, Japan
| | - Masaki Fukuyo
- Department of Molecular Oncology, Graduate School of Medicine, Chiba University, Chiba, Japan
| | - Motoaki Seki
- Department of Molecular Oncology, Graduate School of Medicine, Chiba University, Chiba, Japan
| | - Rahmutulla Bahityar
- Department of Molecular Oncology, Graduate School of Medicine, Chiba University, Chiba, Japan
| | - Atsushi Kaneda
- Department of Molecular Oncology, Graduate School of Medicine, Chiba University, Chiba, Japan
| | - Yoichi Furukawa
- Clinical Genome Research, The Institute of Medical Science, The University of Tokyo, Tokyo, Japan
| |
Collapse
|
|
13
|
Ding HY, Lei W, Xiao SJ, Deng H, Yuan LK, Xu L, Zhou JL, Huang R, Fang YL, Wang QY, Zhang Y, Zhang L, Zhu XC. High incidence of EDNRB gene mutation in seven southern Chinese familial cases with Hirschsprung's disease. Pediatr Surg Int 2024; 40:38. [PMID: 38253735 DOI: 10.1007/s00383-023-05620-w] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Accepted: 12/15/2023] [Indexed: 01/24/2024]
Abstract
PURPOSE Hirschsprung's disease (HSCR) is the leading cause of neonatal functional intestinal obstruction, which has been identified in many familial cases. HSCR, a multifactorial disorder of enteric nervous system (ENS) development, is associated with at least 24 genes and seven chromosomal loci, with RET and EDNRB as its major genes. We present a genetic investigation of familial HSCR to clarify the genotype-phenotype relationship. METHODS We performed whole exome sequencing (WES) on Illumina HiSeq X Ten platform to investigate genetic backgrounds of core family members, and identified the possibly harmful mutation genes. Mutation carriers and pedigree relatives were validated by Sanger sequencing for evaluating the gene penetrance. RESULTS Four familial cases showed potential disease-relative variants in EDNRB and RET gene, accounting for all detection rate of 57.1%. Three familial cases exhibited strong pathogenic variants as frameshift or missense mutations in EDNRB gene. A novel c.367delinsTT mutation of EDNRB was identified in one family member. The other two EDNRB mutations, c.553G>A in family 2 and c.877delinsTT in family 5, have been reported in previous literatures. The penetrance of EDNRB variants was 33-50% according mutation carries. In family 6, the RET c.1858T>C (C620R) point mutation has previously been reported to cause HSCR, with 28.5% penetrance. CONCLUSION We identified a novel EDNRB (deleted C and inserted TT) mutation in this study using WES. Heterozygote variations in EDNRB gene were significantly enriched in three families and RET mutations were identified in one family. EDNRB variants showed an overall higher incidence and penetrance than RET in southern Chinese families cases.
Collapse
Affiliation(s)
- Hui-Yang Ding
- Department of Neonatal Surgery, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Wen Lei
- Maternal and Child Health Research Institute, Translational Medicine Center, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Shang-Jie Xiao
- Department of Neonatal Surgery, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Hua Deng
- Maternal and Child Health Research Institute, Translational Medicine Center, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Li-Ke Yuan
- Department of Neonatal Surgery, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Lu Xu
- Department of Neonatal Surgery, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Jia-Liang Zhou
- Department of Neonatal Surgery, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Rong Huang
- Department of Neonatal Surgery, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Yuan-Long Fang
- Department of Neonatal Surgery, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Qing-Yuan Wang
- Department of Neonatal Surgery, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Ying Zhang
- Department of Neonatal Surgery, Guangdong Women and Children Hospital, Guangzhou, 511400, China
| | - Liang Zhang
- Maternal and Child Health Research Institute, Translational Medicine Center, Guangdong Women and Children Hospital, Guangzhou, 511400, China.
| | - Xiao-Chun Zhu
- Department of Neonatal Surgery, Guangdong Women and Children Hospital, Guangzhou, 511400, China.
| |
Collapse
|
|
14
|
Bibikova M, Fan J. Liquid biopsy for early detection of lung cancer. CHINESE MEDICAL JOURNAL PULMONARY AND CRITICAL CARE MEDICINE 2023; 1:200-206. [PMID: 39171286 PMCID: PMC11332910 DOI: 10.1016/j.pccm.2023.08.005] [Citation(s) in RCA: 2] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Subscribe] [Scholar Register] [Received: 02/16/2023] [Indexed: 08/23/2024]
Abstract
Lung cancer is the leading cause of cancer-related mortality worldwide. Early cancer detection plays an important role in improving treatment success and patient prognosis. In the past decade, liquid biopsy became an important tool for cancer diagnosis, as well as for treatment selection and response monitoring. Liquid biopsy is a broad term that defines a non-invasive test done on a sample of blood or other body fluid to look for cancer cells or other analytes that can include DNA, RNA, or other molecules released by tumor cells. Liquid biopsies mainly include circulating tumor DNA, circulating RNA, microRNA, proteins, circulating tumor cells, exosomes, and tumor-educated platelets. This review summarizes the progress and clinical application potential of liquid biopsy for early detection of lung cancer.
Collapse
Affiliation(s)
- Marina Bibikova
- AnchorDx, Inc., 46305 Landing Parkway, Fremont, CA 94538, USA
| | - Jianbing Fan
- Department of Pathology, School of Basic Medical Science, Southern Medical University, Guangzhou, Guangdong 510515, China
| |
Collapse
|
|
15
|
Li Y, Li B, Jiang R, Liao L, Zheng C, Yuan J, Zeng L, Hu K, Zhang Y, Mei W, Hong Z, Xiao B, Kong L, Han K, Tang J, Jiang W, Pan Z, Zhang S, Ding P. A novel screening method of DNA methylation biomarkers helps to improve the detection of colorectal cancer and precancerous lesions. Cancer Med 2023; 12:20626-20638. [PMID: 37881109 PMCID: PMC10660402 DOI: 10.1002/cam4.6511] [Citation(s) in RCA: 7] [Impact Index Per Article: 3.5] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/28/2023] [Revised: 07/22/2023] [Accepted: 08/30/2023] [Indexed: 10/27/2023] Open
Abstract
BACKGROUND Colorectal cancer (CRC) is one of the most common malignancies, and early detection plays a crucial role in enhancing curative outcomes. While colonoscopy is considered the gold standard for CRC diagnosis, noninvasive screening methods of DNA methylation biomarkers can improve the early detection of CRC and precancerous lesions. METHODS Bioinformatics and machine learning methods were used to evaluate CRC-related genes within the TCGA database. By identifying the overlapped genes, potential biomarkers were selected for further validation. Methylation-specific PCR (MSP) was utilized to identify the associated genes as biomarkers. Subsequently, a real-time PCR assay for detecting the presence of neoplasia or cancer of the colon or rectum was established. This screening approach involved the recruitment of 978 participants from five cohorts. RESULTS The genes with the highest specificity and sensitivity were Septin9, AXL4, and SDC2. A total of 940 participants were involved in the establishment of the final PCR system and the subsequent performance evaluation test. A multiplex TaqMan real-time PCR system has been illustrated to greatly enhance the ability to detect precancerous lesions and achieved an accuracy of 87.8% (95% CI 82.9-91.5), a sensitivity of 82.7% (95% CI 71.8-90.1), and a specificity of 90.1% (95% CI 84.3-93.9). Moreover, the detection rate of precancerous lesions of this assay reached 55.0% (95% CI 38.7-70.4). CONCLUSION The combined detection of the methylation status of SEPT9, SDC2, and ALX4 in plasma holds the potential to further enhance the sensitivity of CRC detection.
Collapse
Affiliation(s)
- Yuan Li
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| | - Bin Li
- Beijing BGI‐GBI Biotech Co., LtdBeijingChina
| | - Rou Jiang
- Department of Cancer Prevention CenterSun Yat‐sen University Cancer CenterGuangzhouChina
| | - Leen Liao
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| | | | - Jie Yuan
- Department of General SurgeryThe Fifth Affiliated Hospital of Southern Medical UniversityGuangzhouChina
| | | | - Kunling Hu
- Beijing BGI‐GBI Biotech Co., LtdBeijingChina
| | | | - Weijian Mei
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| | - Zhigang Hong
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| | - Binyi Xiao
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| | - Lingheng Kong
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| | - Kai Han
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| | - Jinghua Tang
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| | - Wu Jiang
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| | - Zhizhong Pan
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| | | | - Peirong Ding
- Department of Colorectal SurgerySun Yat‐sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center of Cancer MedicineGuangzhouChina
| |
Collapse
|
|
16
|
Dieu Vuong L, Ngoc Nguyen Q. ABERRANT METHYLATION OF CANCER-RELATED GENES IN VIETNAMESE BREAST CANCER PATIENTS: ASSOCIATIONS WITH CLINICOPATHOLOGICAL FEATURES. Exp Oncol 2023; 45:195-202. [PMID: 37824772 DOI: 10.15407/exp-oncology.2023.02.195] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/10/2023] [Indexed: 10/14/2023]
Abstract
BACKGROUND Epigenetic alteration is one of the most common molecular changes identified in the progression of breast cancer (BC). AIM To study the frequency and relation between methylation of BRCA1, MLH1, MGMT, GSTP1, APC, RASSF1A, p16, WIF, and EGFR and the clinicopathological features in Vietnamese BC patients. MATERIALS AND METHODS Methylation-specific polymerase chain reaction (MS-PCR) and SPSS 20.0 software were utilized in order to identify methylated frequency as well as evaluate its relationship with the patient's clinical features. RESULTS In 162 BC cases, the methylation rates of the selected genes were 53.7%, 22.8%, 38.9%, 34.6%, 29.0%, 46.3%, 20.4%, 18.5%, and 28.4% respectively. In 32 cases of benign breast diseases (BBD) - 12.5%, 15.6%, 6.3%, 3.1%, 12.5%, 21.9%, 3.1%, 15.6% and 3.1%. BC samples displayed higher BRCA1, MGMT, GSTP1, APC, RASSF1A, WIF1, and p16 methylation levels than BBD samples (p < 0.001). Hypermethylation of BRCA1, GSTP1, and RASSF1A was predominant in the invasive ductal carcinoma, while hypermethylation of BRCA1, GSTP1, RASSF1A, WIF-1, and p16 was found to significantly correlate with lymph node metastasis (p < 0.05). Hypermethylation of BRCA1, MGMT, and GSTP1 was more common in stage III (p < 0.05) than in stages I/II, whereas MLH1 methylation was predominant in stage I and APC methylation was less common in stage III (p = 0.03). In addition, methylation of RASSF1A and EGFR was more frequent in younger patients (p < 0.01) than in elder patients. CONCLUSION These data suggest that a gene panel (BRCA1/MGMT/GSTP1) can be used to support the diagnosis and screening of Vietnamese patients' BC with a sensitivity of 70%, and a specificity of 85%.
Collapse
Affiliation(s)
- Linh Dieu Vuong
- Pathology and Molecular Biology Centre, National Cancer Hospital K, 30 Cau Buou Street, Thanh Tri, Hanoi, Vietnam
| | - Quang Ngoc Nguyen
- Pathology and Molecular Biology Centre, National Cancer Hospital K, 30 Cau Buou Street, Thanh Tri, Hanoi, Vietnam.
| |
Collapse
|
|
17
|
Beaudry A, Jacques-Ricard S, Darracq A, Sgarioto N, Garcia A, García TR, Lemieux W, Béland K, Haddad E, Cordeiro P, Duval M, McGraw S, Richer C, Caron M, Marois F, St-Onge P, Sinnett D, Banquy X, Raynal NJM. Repurposing disulfiram, an alcohol-abuse drug, in neuroblastoma causes KAT2A downregulation and in vivo activity with a water/oil emulsion. Sci Rep 2023; 13:16443. [PMID: 37777587 PMCID: PMC10543387 DOI: 10.1038/s41598-023-43219-2] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/09/2023] [Accepted: 09/21/2023] [Indexed: 10/02/2023] Open
Abstract
Neuroblastoma, the most common type of pediatric extracranial solid tumor, causes 10% of childhood cancer deaths. Despite intensive multimodal treatment, the outcomes of high-risk neuroblastoma remain poor. We urgently need to develop new therapies with safe long-term toxicity profiles for rapid testing in clinical trials. Drug repurposing is a promising approach to meet these needs. Here, we investigated disulfiram, a safe and successful chronic alcoholism treatment with known anticancer and epigenetic effects. Disulfiram efficiently induced cell cycle arrest and decreased the viability of six human neuroblastoma cell lines at half-maximal inhibitory concentrations up to 20 times lower than its peak clinical plasma level in patients treated for chronic alcoholism. Disulfiram shifted neuroblastoma transcriptome, decreasing MYCN levels and activating neuronal differentiation. Consistently, disulfiram significantly reduced the protein level of lysine acetyltransferase 2A (KAT2A), drastically reducing acetylation of its target residues on histone H3. To investigate disulfiram's anticancer effects in an in vivo model of high-risk neuroblastoma, we developed a disulfiram-loaded emulsion to deliver the highly liposoluble drug. Treatment with the emulsion significantly delayed neuroblastoma progression in mice. These results identify KAT2A as a novel target of disulfiram, which directly impacts neuroblastoma epigenetics and is a promising candidate for repurposing to treat pediatric neuroblastoma.
Collapse
Affiliation(s)
- Annie Beaudry
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Simon Jacques-Ricard
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
- Département de Pharmacologie et de Physiologie, Faculté de Médecine, Université de Montréal, Montreal, QC, Canada
| | - Anaïs Darracq
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
- Département de Pharmacologie et de Physiologie, Faculté de Médecine, Université de Montréal, Montreal, QC, Canada
| | - Nicolas Sgarioto
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Araceli Garcia
- Faculté de Pharmacie, Université de Montréal, Montreal, QC, Canada
| | | | - William Lemieux
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Kathie Béland
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Elie Haddad
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Paulo Cordeiro
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Michel Duval
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Serge McGraw
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Chantal Richer
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Maxime Caron
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - François Marois
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Pascal St-Onge
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
| | - Daniel Sinnett
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada
- Département de Pédiatrie, Université de Montréal, Montreal, QC, Canada
| | - Xavier Banquy
- Faculté de Pharmacie, Université de Montréal, Montreal, QC, Canada
| | - Noël J-M Raynal
- Sainte-Justine University Hospital Research Center, 3175, Chemin de la Côte-Sainte-Catherine, Montreal, QC, H3T 1C5, Canada.
- Département de Pharmacologie et de Physiologie, Faculté de Médecine, Université de Montréal, Montreal, QC, Canada.
| |
Collapse
|
|
18
|
Aghamaliyev U, Su K, Weniger M, Koch D, D'Haese JG, Werner J, Bazhin AV. SPOCK2 gene expression is downregulated in pancreatic ductal adenocarcinoma cells and correlates with prognosis of patients with pancreatic cancer. J Cancer Res Clin Oncol 2023; 149:9191-9200. [PMID: 37188984 PMCID: PMC10374688 DOI: 10.1007/s00432-023-04845-5] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/22/2023] [Accepted: 05/07/2023] [Indexed: 05/17/2023]
Abstract
OBJECTIVES Pancreatic ductal adenocarcinoma (PDAC) represents a widespread form of malignant pancreatic neoplasms and a leading oncologic cause of death in Europe and the USA. Despite advances in understanding its molecular biology, the 5-year survival rate remains low at 10%. The extracellular matrix in PDAC contains proteins, including SPOCK2, which are essential for tumorigenicity and drug resistance. The present study aims to explore the possible role of SPOCK2 in the pathogenesis of PDAC. MATERIALS AND METHODS Expression of SPOCK2 was evaluated in 7 PDAC cell lines and 1 normal pancreatic cell line using quantitative RT-PCR. Demethylation of the gene was carried out using 5-aza-2'-deoxycytidine (5-aza-dC) treatment with subsequent validation Western Blot analysis. In vitro downregulation of SPOCK2 gene was performed using siRNA transfection. MTT and transwell assays were employed to evaluate the impact of the SPOK2 demethylation on the proliferation and migration of PDAC cells. KM Plotter was applied to analyze a correlation between SPOCK2 mRNA expression and the survival of PDAC patients. RESULTS In contrast to the normal pancreatic cell line, SPOCK2 expression was significantly downregulated in PDAC cell lines. Treatment with 5-aza-dC, led to increase in SPOCK2 expression in the cell lines tested. Importantly, compared with control cells, transfected with SPOCK2 siRNA cells exhibited increased growth rates and more migration ability. Finally, we demonstrated that a high SPOCK2 expression level correlated with longer overall survival of patients with PDAC. CONCLUSION The expression of SPOCK2 is downregulated in PDAC as a result of hypermethylation of its corresponding gene. SPOCK2 expression as well as the demethylation of its gene could be a potential marker for PDAC.
Collapse
Affiliation(s)
- Ughur Aghamaliyev
- Department of General, Visceral, and Transplant Surgery, Hospital of the University of Munich, Ludwig-Maximilians-University Munich, Marchioninistr. 15, 81377, Munich, Germany
| | - Kaifeng Su
- Department of General, Visceral, and Transplant Surgery, Hospital of the University of Munich, Ludwig-Maximilians-University Munich, Marchioninistr. 15, 81377, Munich, Germany
| | - Maximilian Weniger
- Department of General, Visceral, and Transplant Surgery, Hospital of the University of Munich, Ludwig-Maximilians-University Munich, Marchioninistr. 15, 81377, Munich, Germany
| | - Dominik Koch
- Department of General, Visceral, and Transplant Surgery, Hospital of the University of Munich, Ludwig-Maximilians-University Munich, Marchioninistr. 15, 81377, Munich, Germany
| | - Jan G D'Haese
- Department of General, Visceral, and Transplant Surgery, Hospital of the University of Munich, Ludwig-Maximilians-University Munich, Marchioninistr. 15, 81377, Munich, Germany
| | - Jens Werner
- Department of General, Visceral, and Transplant Surgery, Hospital of the University of Munich, Ludwig-Maximilians-University Munich, Marchioninistr. 15, 81377, Munich, Germany
- German Cancer Consortium (DKTK), Partner Site Munich and German Cancer Research Center (DKFZ), Heidelberg, Germany
- Bavarian Cancer Research Center (BZKF), Erlangen, Germany
| | - Alexandr V Bazhin
- Department of General, Visceral, and Transplant Surgery, Hospital of the University of Munich, Ludwig-Maximilians-University Munich, Marchioninistr. 15, 81377, Munich, Germany.
- German Cancer Consortium (DKTK), Partner Site Munich and German Cancer Research Center (DKFZ), Heidelberg, Germany.
- Bavarian Cancer Research Center (BZKF), Erlangen, Germany.
| |
Collapse
|
|
19
|
Konda P, Garinet S, Van Allen EM, Viswanathan SR. Genome-guided discovery of cancer therapeutic targets. Cell Rep 2023; 42:112978. [PMID: 37572322 DOI: 10.1016/j.celrep.2023.112978] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/12/2023] [Revised: 07/22/2023] [Accepted: 07/28/2023] [Indexed: 08/14/2023] Open
Abstract
The success of precision oncology-which aims to match the right therapies to the right patients based on molecular status-is predicated on a robust pipeline of molecular targets against which therapies can be developed. Recent advances in genomics and functional genetics have enabled the unbiased discovery of novel molecular targets at scale. We summarize the promise and challenges in integrating genomic and functional genetic landscapes of cancer to establish the next generation of cancer targets.
Collapse
Affiliation(s)
- Prathyusha Konda
- Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA
| | - Simon Garinet
- Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA
| | - Eliezer M Van Allen
- Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA; Cancer Program, Broad Institute of MIT and Harvard, Cambridge, MA, USA; Department of Medicine, Harvard Medical School, Boston, MA, USA
| | - Srinivas R Viswanathan
- Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA; Cancer Program, Broad Institute of MIT and Harvard, Cambridge, MA, USA; Department of Medicine, Harvard Medical School, Boston, MA, USA.
| |
Collapse
|
|
20
|
Meng Y, Huang K, Shi M, Huo Y, Han L, Liu B, Li Y. Research Advances in the Role of the Tropomyosin Family in Cancer. Int J Mol Sci 2023; 24:13295. [PMID: 37686101 PMCID: PMC10488083 DOI: 10.3390/ijms241713295] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/30/2023] [Revised: 08/22/2023] [Accepted: 08/24/2023] [Indexed: 09/10/2023] Open
Abstract
Cancer is one of the most difficult diseases for human beings to overcome. Its development is closely related to a variety of factors, and its specific mechanisms have been a hot research topic in the field of scientific research. The tropomyosin family (Tpm) is a group of proteins closely related to the cytoskeleton and actin, and recent studies have shown that they play an important role in various cancers, participating in a variety of biological activities, including cell proliferation, invasion, and migration, and have been used as biomarkers for various cancers. The purpose of this review is to explore the research progress of the Tpm family in tumorigenesis development, focusing on the molecular pathways associated with them and their relevant activities involved in tumors. PubMed and Web of Science databases were searched for relevant studies on the role of Tpms in tumorigenesis and development and the activities of Tpms involved in tumors. Data from the literature suggest that the Tpm family is involved in tumor cell proliferation and growth, tumor cell invasion and migration, tumor angiogenesis, tumor cell apoptosis, and immune infiltration of the tumor microenvironment, among other correlations. It can be used as a potential biomarker for early diagnosis, follow-up, and therapeutic response of some tumors. The Tpm family is involved in cancer in a close relationship with miRNAs and LncRNAs. Tpms are involved in tumor tissue invasion and migration as a key link. On this basis, TPM is frequently used as a biomarker for various cancers. However, the specific molecular mechanism of its involvement in cancer progression has not been explained clearly, which remains an important direction for future research.
Collapse
Affiliation(s)
- Yucheng Meng
- Key Laboratory of Dental Maxillofacial Reconstruction and Biological Intelligence Manufacturing, School of Stomatology, Lanzhou University, Lanzhou 730030, China; (Y.M.); (K.H.); (M.S.); (Y.H.); (L.H.)
| | - Ke Huang
- Key Laboratory of Dental Maxillofacial Reconstruction and Biological Intelligence Manufacturing, School of Stomatology, Lanzhou University, Lanzhou 730030, China; (Y.M.); (K.H.); (M.S.); (Y.H.); (L.H.)
- Key Laboratory of Preclinical Study for New Drugs of Gansu Province, School of Basic Medical Sciences, Lanzhou University, Lanzhou 730030, China
| | - Mingxuan Shi
- Key Laboratory of Dental Maxillofacial Reconstruction and Biological Intelligence Manufacturing, School of Stomatology, Lanzhou University, Lanzhou 730030, China; (Y.M.); (K.H.); (M.S.); (Y.H.); (L.H.)
| | - Yifei Huo
- Key Laboratory of Dental Maxillofacial Reconstruction and Biological Intelligence Manufacturing, School of Stomatology, Lanzhou University, Lanzhou 730030, China; (Y.M.); (K.H.); (M.S.); (Y.H.); (L.H.)
| | - Liang Han
- Key Laboratory of Dental Maxillofacial Reconstruction and Biological Intelligence Manufacturing, School of Stomatology, Lanzhou University, Lanzhou 730030, China; (Y.M.); (K.H.); (M.S.); (Y.H.); (L.H.)
| | - Bin Liu
- Key Laboratory of Dental Maxillofacial Reconstruction and Biological Intelligence Manufacturing, School of Stomatology, Lanzhou University, Lanzhou 730030, China; (Y.M.); (K.H.); (M.S.); (Y.H.); (L.H.)
| | - Yi Li
- Key Laboratory of Dental Maxillofacial Reconstruction and Biological Intelligence Manufacturing, School of Stomatology, Lanzhou University, Lanzhou 730030, China; (Y.M.); (K.H.); (M.S.); (Y.H.); (L.H.)
| |
Collapse
|
|
21
|
Tabassum G, Singh P, Gurung R, Hakami MA, Alkhorayef N, Alsaiari AA, Alqahtani LS, Hasan MR, Rashid S, Kumar A, Dev K, Dohare R. Investigating the role of Kinesin family in lung adenocarcinoma via integrated bioinformatics approach. Sci Rep 2023; 13:9859. [PMID: 37330525 PMCID: PMC10276827 DOI: 10.1038/s41598-023-36842-6] [Citation(s) in RCA: 2] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/11/2023] [Accepted: 06/11/2023] [Indexed: 06/19/2023] Open
Abstract
Lung cancer is the leading cause of mortality from cancer worldwide. Lung adenocarcinoma (LUAD) is a type of non-small cell lung cancer (NSCLC) with highest prevalence. Kinesins a class of motor proteins are shown to be involved in carcinogenesis. We conducted expression, stage plot and survival analyses on kinesin superfamily (KIF) and scrutinized the key prognostic kinesins. Genomic alterations of these kinesins were studied thereafter via cBioPortal. A protein-protein interaction network (PPIN) of selected kinesins and 50 closest altering genes was constructed followed by gene ontology (GO) term and pathway enrichment analyses. Multivariate survival analysis based on CpG methylation of selected kinesins was performed. Lastly, we conducted tumor immune infiltration analysis. Our results found KIF11/15/18B/20A/2C/4A/C1 to be significantly upregulated and correlated with poor survival in LUAD patients. These genes also showed to be highly associated with cell cycle. Out of our seven selected kinesins, KIFC1 showed the highest genomic alteration with highest number of CpG methylation. Also, CpG island (CGI) cg24827036 was discovered to be linked to LUAD prognosis. Therefore, we deduced that reducing the expression of KIFC1 could be a feasible treatment strategy and that it can be a wonderful individual prognostic biomarker. CGI cg24827036 can also be used as a therapy site in addition to being a great prognostic biomarker.
Collapse
Affiliation(s)
- Gulnaz Tabassum
- Department of Biotechnology, Faculty of Natural Sciences, Jamia Millia Islamia, New Delhi, 110025, India
| | - Prithvi Singh
- Centre for Interdisciplinary Research in Basic Sciences, Jamia Millia Islamia, New Delhi, 110025, India
| | - Rishabh Gurung
- Centre for Interdisciplinary Research in Basic Sciences, Jamia Millia Islamia, New Delhi, 110025, India
| | - Mohammed Ageeli Hakami
- Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Al- Quwayiyah, Shaqra University, Riyadh, 13343, Saudi Arabia
| | - Nada Alkhorayef
- Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Al- Quwayiyah, Shaqra University, Riyadh, 13343, Saudi Arabia
| | - Ahad Amer Alsaiari
- Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Taif University, Taif, 21944, Saudi Arabia
| | - Leena S Alqahtani
- Department of Biochemistry, College of Science, University of Jeddah, Jeddah, 23445, Saudi Arabia
| | - Mohammad Raghibul Hasan
- Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Al- Quwayiyah, Shaqra University, Riyadh, 13343, Saudi Arabia
| | - Summya Rashid
- Department of Pharmacology and Toxicology, College of Pharmacy, Prince Sattam Bin Abdulaziz University, Alkharj, 16278, Saudi Arabia
| | - Atul Kumar
- Department of Biotechnology, Faculty of Natural Sciences, Jamia Millia Islamia, New Delhi, 110025, India
| | - Kapil Dev
- Department of Biotechnology, Faculty of Natural Sciences, Jamia Millia Islamia, New Delhi, 110025, India.
| | - Ravins Dohare
- Centre for Interdisciplinary Research in Basic Sciences, Jamia Millia Islamia, New Delhi, 110025, India.
| |
Collapse
|
|
22
|
Otsuka S, Qin XY, Wang W, Ito T, Nansai H, Abe K, Fujibuchi W, Nakao Y, Sone H. iGEM as a human iPS cell-based global epigenetic modulation detection assay provides throughput characterization of chemicals affecting DNA methylation. Sci Rep 2023; 13:6663. [PMID: 37095195 PMCID: PMC10125974 DOI: 10.1038/s41598-023-33729-4] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/28/2022] [Accepted: 04/18/2023] [Indexed: 04/26/2023] Open
Abstract
Chemical-induced dysregulation of DNA methylation during the fetal period is known to contribute to developmental disorders or increase the risk of certain diseases later in life. In this study, we developed an iGEM (iPS cell-based global epigenetic modulation) detection assay using human induced pluripotent stem (hiPS) cells that express a fluorescently labeled methyl-CpG-binding domain (MBD), which enables a high-throughput screening of epigenetic teratogens/mutagens. 135 chemicals with known cardiotoxicity and carcinogenicity were categorized according to the MBD signal intensity, which reflects the degree of nuclear spatial distribution/concentration of DNA methylation. Further biological characterization through machine-learning analysis that integrated genome-wide DNA methylation, gene expression profiling, and knowledge-based pathway analysis revealed that chemicals with hyperactive MBD signals strongly associated their effects on DNA methylation and expression of genes involved in cell cycle and development. These results demonstrated that our MBD-based integrated analytical system is a powerful framework for detecting epigenetic compounds and providing mechanism insights of pharmaceutical development for sustainable human health.
Collapse
Affiliation(s)
- Satoshi Otsuka
- Center for Health and Environmental Risk Research, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki, 305-8506, Japan
- Graduate School of Advanced Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-Ku, Tokyo, 169-8555, Japan
- Department of Cellular and Tissue Communication, Graduate School of Medicine and Faculty of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyo-Ku, Tokyo, 113-8555, Japan
| | - Xian-Yang Qin
- Laboratory for Cellular Function Conversion Technology, RIKEN Center for Integrative Medical Sciences, 1-7-22 Suehiro, Tsurumi, Yokohama, Kanagawa, 230-0045, Japan
| | - Wenlong Wang
- Center for Health and Environmental Risk Research, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki, 305-8506, Japan
- Department of Environmental Engineering, Graduate School of Engineering, Kyoto University, Kyoto University Katsura, Nishikyo-Ku, Kyoto, 615-8540, Japan
| | - Tomohiro Ito
- Center for Health and Environmental Risk Research, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki, 305-8506, Japan
| | - Hiroko Nansai
- Center for Health and Environmental Risk Research, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki, 305-8506, Japan
| | - Kuniya Abe
- Technology and Development Team for Mammalian Cellular Dynamics, BioResource Center, RIKEN Tsukuba Institute, 3-1-1 Koyadai, Tsukuba, Ibaraki, 305-0074, Japan
| | - Wataru Fujibuchi
- Center for iPS Cell Research and Application (CiRA), Kyoto University, 53 Kawahara-Cho, Sho-Goin, Sakyo-Ku, Kyoto, 606-8507, Japan
- Department of Cellular and Tissue Communication, Graduate School of Medicine and Faculty of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyo-Ku, Tokyo, 113-8555, Japan
| | - Yoichi Nakao
- Graduate School of Advanced Science and Engineering, Waseda University, 3-4-1 Okubo, Shinjuku-Ku, Tokyo, 169-8555, Japan
| | - Hideko Sone
- Center for Health and Environmental Risk Research, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki, 305-8506, Japan.
- Environmental Health and Prevention Research Unit, Department of Environmental Health and Preventive Medicine, Yokohama University of Pharmacy, 601 Matano, Totsuka, Yokohama, 245-0066, Japan.
| |
Collapse
|
|
23
|
Chu DT, Ngo AD, Wu CC. Epigenetics in cancer development, diagnosis and therapy. PROGRESS IN MOLECULAR BIOLOGY AND TRANSLATIONAL SCIENCE 2023; 198:73-92. [PMID: 37225325 DOI: 10.1016/bs.pmbts.2023.01.009] [Citation(s) in RCA: 3] [Impact Index Per Article: 1.5] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 03/08/2023]
Abstract
Cancer is a dangerous disease and one of the leading causes of death in the world. In 2020, there were nearly 10 million cancer deaths and approximately 20 million new cases. New cases and deaths from cancer are expected to increase further in the coming years. To have a deeper insight into the mechanism of carcinogenesis, epigenetics studies have been published and received much attention from scientists, doctors, and patients. Among alterations in epigenetics, DNA methylation and histone modification are studied by many scientists. They have been reported to be a major contributor in tumor formation and are involved in metastasis. From the understanding of DNA methylation and histone modification, effective, accurate and cost-effective methods for diagnosis and screening of cancer patients have been introduced. Furthermore, therapeutic approaches and drugs targeting altered epigenetics have also been clinically studied and have shown positive results in combating tumor progression. Several cancer drugs that rely on DNA methylation inactivation or histone modification have been approved by the FDA for the treatment of cancer patients. In summary, epigenetics changes such as DNA methylation or histone modification are take part in tumor growth, and they also have great prospect to study diagnostic and therapeutic methods of this dangerous disease.
Collapse
Affiliation(s)
- Dinh-Toi Chu
- Center for Biomedicine and Community Health, International School, Vietnam National University, Hanoi, Vietnam; Faculty of Applied Sciences, International School, Vietnam National University, Hanoi, Vietnam.
| | - Anh-Dao Ngo
- Center for Biomedicine and Community Health, International School, Vietnam National University, Hanoi, Vietnam
| | - Chia-Ching Wu
- Department of Cell Biology and Anatomy, College of Medicine, National Cheng Kung University, Tainan, Taiwan; International Center for Wound Repair and Regeneration, National Cheng Kung University, Tainan, Taiwan; Department of Biomedical Engineering, National Cheng Kung University, Tainan, Taiwan
| |
Collapse
|
|
24
|
Targeting of the Interleukin-13 Receptor (IL-13R)α2 Expressing Prostate Cancer by a Novel Hybrid Lytic Peptide. Biomolecules 2023; 13:biom13020356. [PMID: 36830725 PMCID: PMC9953383 DOI: 10.3390/biom13020356] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/20/2022] [Revised: 01/31/2023] [Accepted: 02/09/2023] [Indexed: 02/15/2023] Open
Abstract
The IL-13Rα2 cell surface receptor is highly expressed in tumours such as prostate cancer. In this report, we evaluated the hypothesis that prostate cancer cells with enhanced IL-13Rα2 expression are a suitable target for the hybrid lytic peptide (Pep-1-Phor21) peptide, which is generated by fusing the IL-13Rα2 specific ligand (Pep-1) and a cell membrane disrupting lytic peptide (Phor21). The expression of IL-13Rα2 mRNA and protein in prostate cancer tissues and cell lines was assessed via real-time PCR (RT-PCR) and immunoblotting. The effect of Pep-1-Phor21 on the viability of prostate cancer cells grown in monolayers (2D) and microtissue spheroids (3D) was assessed via CellTox green cytotoxic assay. IL-13Rα2 expression and Pep-1-Phor21-mediated killing were also determined in the cells treated with epigenetic regulators (Trichostatin A (TSA) and 5-aza-2 deoxycytidine (5-Aza-dC)). The hybrid lytic peptide cytotoxic activity correlated with the expression of IL-13Rα2 in prostate cancer cell lines cultured as monolayers (2D) or 3D spheroids. In addition, TSA or 5-Aza-dC treatment of prostate cancer cells, particularly those with low expression of IL-13Rα2, enhanced the cells' sensitivity to the lytic peptide by increasing IL-13Rα2 expression. These results demonstrate that the Pep-1-Phor21 hybrid lytic peptide has potent and selective anticancer properties against IL-13Rα2-expressing prostate cancer cells.
Collapse
|
|
25
|
Kärcher J, Schulze B, Dörr A, Tierling S, Walter J. Transfer of blocker-based qPCR reactions for DNA methylation analysis into a microfluidic LoC system using thermal modeling. BIOMICROFLUIDICS 2022; 16:064102. [PMID: 36506005 PMCID: PMC9729016 DOI: 10.1063/5.0108374] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Subscribe] [Scholar Register] [Received: 07/08/2022] [Accepted: 11/11/2022] [Indexed: 06/17/2023]
Abstract
Changes in the DNA methylation landscape are associated with many diseases like cancer. Therefore, DNA methylation analysis is of great interest for molecular diagnostics and can be applied, e.g., for minimally invasive diagnostics in liquid biopsy samples like blood plasma. Sensitive detection of local de novo methylation, which occurs in various cancer types, can be achieved with quantitative HeavyMethyl-PCR using oligonucleotides that block the amplification of unmethylated DNA. A transfer of these quantitative PCRs (qPCRs) into point-of-care (PoC) devices like microfluidic Lab-on-Chip (LoC) cartridges can be challenging as LoC systems show significantly different thermal properties than qPCR cyclers. We demonstrate how an adequate thermal model of the specific LoC system can help us to identify a suitable thermal profile, even for complex HeavyMethyl qPCRs, with reduced experimental effort. Using a simulation-based approach, we demonstrate a proof-of-principle for the successful LoC transfer of colorectal SEPT9/ACTB-qPCR from Epi Procolon® colorectal carcinoma test, by avoidance of oligonucleotide interactions.
Collapse
Affiliation(s)
- Janik Kärcher
- Robert Bosch GmbH, Corporate Research, Robert Bosch Campus 1, 71272 Renninge, Germany
| | - Britta Schulze
- Robert Bosch GmbH, Corporate Research, Robert Bosch Campus 1, 71272 Renninge, Germany
| | - Aaron Dörr
- Robert Bosch GmbH, Corporate Research, Robert Bosch Campus 1, 71272 Renninge, Germany
| | - Sascha Tierling
- University of Saarland, Institute for Genetics and Epigenetics, Campus Saarbrücken, 66123 Saarbrücken, Germany
| | - Jörn Walter
- University of Saarland, Institute for Genetics and Epigenetics, Campus Saarbrücken, 66123 Saarbrücken, Germany
| |
Collapse
|
|
26
|
Perera BPU, Morgan RK, Polemi KM, Sala-Hamrick KE, Svoboda LK, Dolinoy DC. PIWI-Interacting RNA (piRNA) and Epigenetic Editing in Environmental Health Sciences. Curr Environ Health Rep 2022; 9:650-660. [PMID: 35917009 DOI: 10.1007/s40572-022-00372-6] [Citation(s) in RCA: 6] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Accepted: 06/28/2022] [Indexed: 01/31/2023]
Abstract
PURPOSE OF REVIEW: The epigenome modulates gene expression in response to environmental stimuli. Modifications to the epigenome are potentially reversible, making them a promising therapeutic approach to mitigate environmental exposure effects on human health. This review details currently available genome and epigenome editing technologies and highlights ncRNA, including piRNA, as potential tools for targeted epigenome editing. RECENT FINDINGS: Zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and clustered regularly interspaced short palindromic repeats (CRISPR) associated nuclease (CRISPR/Cas) research has significantly advanced genome editing technology, with broad promise in genetic research and targeted therapies. Initial epigenome-directed therapies relied on global modification and suffered from limited specificity. Adapted from current genome editing tools, zinc finger protein (ZFP), TALE, and CRISPR/nuclease-deactivated Cas (dCas) systems now confer locus-specific epigenome editing, with promising applicability in the field of environmental health sciences. However, high incidence of off-target effects and time taken for screening limit their use. FUTURE DEVELOPMENT: ncRNA serve as a versatile biomarker with well-characterized regulatory mechanisms that can easily be adapted to edit the epigenome. For instance, the transposon silencing mechanism of germline PIWI-interacting RNAs (piRNA) could be engineered to specifically methylate a given gene, overcoming pitfalls of current global modifiers. Future developments in epigenome editing technologies will inform risk assessment through mechanistic investigation and serve as potential modes of intervention to mitigate environmentally induced adverse health outcomes later in life.
Collapse
Affiliation(s)
- Bambarendage P U Perera
- School of Public Health, Department of Environmental Health Sciences, University of Michigan, Ann Arbor, MI, USA.
| | - Rachel K Morgan
- School of Public Health, Department of Environmental Health Sciences, University of Michigan, Ann Arbor, MI, USA
| | - Katelyn M Polemi
- School of Public Health, Department of Environmental Health Sciences, University of Michigan, Ann Arbor, MI, USA
| | - Kimmie E Sala-Hamrick
- School of Public Health, Department of Environmental Health Sciences, University of Michigan, Ann Arbor, MI, USA
| | - Laurie K Svoboda
- School of Public Health, Department of Environmental Health Sciences, University of Michigan, Ann Arbor, MI, USA
| | - Dana C Dolinoy
- School of Public Health, Department of Environmental Health Sciences, University of Michigan, Ann Arbor, MI, USA
- School of Public Health, Department of Nutritional Sciences, University of Michigan, Ann Arbor, MI, USA
| |
Collapse
|
|
27
|
Attanzio A, Restivo I, Tutone M, Tesoriere L, Allegra M, Livrea MA. Redox Properties, Bioactivity and Health Effects of Indicaxanthin, a Bioavailable Phytochemical from Opuntia ficus indica, L.: A Critical Review of Accumulated Evidence and Perspectives. Antioxidants (Basel) 2022; 11:antiox11122364. [PMID: 36552572 PMCID: PMC9774763 DOI: 10.3390/antiox11122364] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/25/2022] [Revised: 11/16/2022] [Accepted: 11/23/2022] [Indexed: 12/05/2022] Open
Abstract
Phytochemicals from plant foods are considered essential to human health. Known for their role in the adaptation of plants to their environment, these compounds can induce adaptive responses in cells, many of which are directed at maintaining the redox tone. Indicaxanthin is a long-known betalain pigment found in the genus Opuntia of cactus pear and highly concentrated in the edible fruits of O. ficus indica, L. whose bioactivity has been overlooked until recently. This review summarizes studies conducted so far in vitro and in vivo, most of which have been performed in our laboratory. The chemical and physicochemical characteristics of Indicaxanthin are reflected in the molecule's reducing properties and antioxidant effects and help explain its ability to interact with membranes, modulate redox-regulated cellular pathways, and possibly bind to protein molecules. Measurement of bioavailability in volunteers has been key to exploring its bioactivity; amounts consistent with dietary intake, or plasma concentration after dietary consumption of cactus pear fruit, have been used in experimental setups mimicking physiological or pathophysiological conditions, in cells and in animals, finally suggesting pharmacological potential and relevance of Indicaxanthin as a nutraceutical. In reporting experimental results, this review also aimed to raise questions and seek insights for further basic research and health promotion applications.
Collapse
|
|
28
|
de Almeida BC, dos Anjos LG, Dobroff AS, Baracat EC, Yang Q, Al-Hendy A, Carvalho KC. Epigenetic Features in Uterine Leiomyosarcoma and Endometrial Stromal Sarcomas: An Overview of the Literature. Biomedicines 2022; 10:2567. [PMID: 36289829 PMCID: PMC9599831 DOI: 10.3390/biomedicines10102567] [Citation(s) in RCA: 8] [Impact Index Per Article: 2.7] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/10/2022] [Revised: 10/04/2022] [Accepted: 10/06/2022] [Indexed: 11/16/2022] Open
Abstract
There is a consensus that epigenetic alterations play a key role in cancer initiation and its biology. Studies evaluating the modification in the DNA methylation and chromatin remodeling patterns, as well as gene regulation profile by non-coding RNAs (ncRNAs) have led to the development of novel therapeutic approaches to treat several tumor types. Indeed, despite clinical and translational challenges, combinatorial therapies employing agents targeting epigenetic modifications with conventional approaches have shown encouraging results. However, for rare neoplasia such as uterine leiomyosarcomas (LMS) and endometrial stromal sarcomas (ESS), treatment options are still limited. LMS has high chromosomal instability and molecular derangements, while ESS can present a specific gene fusion signature. Although they are the most frequent types of "pure" uterine sarcomas, these tumors are difficult to diagnose, have high rates of recurrence, and frequently develop resistance to current treatment options. The challenges involving the management of these tumors arise from the fact that the molecular mechanisms governing their progression have not been entirely elucidated. Hence, to fill this gap and highlight the importance of ongoing and future studies, we have cross-referenced the literature on uterine LMS and ESS and compiled the most relevant epigenetic studies, published between 2009 and 2022.
Collapse
Affiliation(s)
- Bruna Cristine de Almeida
- Laboratório de Ginecologia Estrutural e Molecular (LIM 58), Disciplina de Ginecologia, Departamento de Obstetricia e Ginecologia, Hospital das Clínicas da Faculdade de Medicina da Universidade de Sao Paulo (HCFMUSP), São Paulo 05403-010, Brazil
| | - Laura Gonzalez dos Anjos
- Laboratório de Ginecologia Estrutural e Molecular (LIM 58), Disciplina de Ginecologia, Departamento de Obstetricia e Ginecologia, Hospital das Clínicas da Faculdade de Medicina da Universidade de Sao Paulo (HCFMUSP), São Paulo 05403-010, Brazil
| | - Andrey Senos Dobroff
- UNM Comprehensive Cancer Center (UNMCCC), University of New Mexico, Albuquerque, NM 87131, USA
- Division of Molecular Medicine, Department of Internal Medicine, (UNM) School of Medicine, UNM Health Sciences Center, 1 University of New Mexico, Albuquerque, NM 87131, USA
| | - Edmund Chada Baracat
- Laboratório de Ginecologia Estrutural e Molecular (LIM 58), Disciplina de Ginecologia, Departamento de Obstetricia e Ginecologia, Hospital das Clínicas da Faculdade de Medicina da Universidade de Sao Paulo (HCFMUSP), São Paulo 05403-010, Brazil
| | - Qiwei Yang
- Department of Obstetrics and Gynecology, University of Chicago, Chicago, IL 60637, USA
| | - Ayman Al-Hendy
- Department of Obstetrics and Gynecology, University of Chicago, Chicago, IL 60637, USA
| | - Katia Candido Carvalho
- Laboratório de Ginecologia Estrutural e Molecular (LIM 58), Disciplina de Ginecologia, Departamento de Obstetricia e Ginecologia, Hospital das Clínicas da Faculdade de Medicina da Universidade de Sao Paulo (HCFMUSP), São Paulo 05403-010, Brazil
| |
Collapse
|
|
29
|
Yang G, Lu T, Weisenberger DJ, Liang G. The Multi-Omic Landscape of Primary Breast Tumors and Their Metastases: Expanding the Efficacy of Actionable Therapeutic Targets. Genes (Basel) 2022; 13:1555. [PMID: 36140723 PMCID: PMC9498783 DOI: 10.3390/genes13091555] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/29/2022] [Revised: 08/08/2022] [Accepted: 08/23/2022] [Indexed: 12/02/2022] Open
Abstract
Breast cancer (BC) mortality is almost exclusively due to metastasis, which is the least understood aspect of cancer biology and represents a significant clinical challenge. Although we have witnessed tremendous advancements in the treatment for metastatic breast cancer (mBC), treatment resistance inevitably occurs in most patients. Recently, efforts in characterizing mBC revealed distinctive genomic, epigenomic and transcriptomic (multi-omic) landscapes to that of the primary tumor. Understanding of the molecular underpinnings of mBC is key to understanding resistance to therapy and the development of novel treatment options. This review summarizes the differential molecular landscapes of BC and mBC, provides insights into the genomic heterogeneity of mBC and highlights the therapeutically relevant, multi-omic features that may serve as novel therapeutic targets for mBC patients.
Collapse
Affiliation(s)
- Guang Yang
- School of Sciences, China Pharmaceutical University, Nanjing 211121, China
- China Grand Enterprises, Beijing 100101, China
| | - Tao Lu
- School of Sciences, China Pharmaceutical University, Nanjing 211121, China
- State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 211121, China
| | - Daniel J. Weisenberger
- Department of Biochemistry and Molecular Medicine, University of Southern California, Norris Comprehensive Cancer Center, Los Angeles, CA 90033, USA
| | - Gangning Liang
- Department of Urology, University of Southern California, Norris Comprehensive Cancer Center, Los Angeles, CA 90033, USA
| |
Collapse
|
|
30
|
Muylaert C, Van Hemelrijck LA, Maes A, De Veirman K, Menu E, Vanderkerken K, De Bruyne E. Aberrant DNA methylation in multiple myeloma: A major obstacle or an opportunity? Front Oncol 2022; 12:979569. [PMID: 36059621 PMCID: PMC9434119 DOI: 10.3389/fonc.2022.979569] [Citation(s) in RCA: 9] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/27/2022] [Accepted: 07/22/2022] [Indexed: 11/30/2022] Open
Abstract
Drug resistance (DR) of cancer cells leading to relapse is a huge problem nowadays to achieve long-lasting cures for cancer patients. This also holds true for the incurable hematological malignancy multiple myeloma (MM), which is characterized by the accumulation of malignant plasma cells in the bone marrow (BM). Although new treatment approaches combining immunomodulatory drugs, corticosteroids, proteasome inhibitors, alkylating agents, and monoclonal antibodies have significantly improved median life expectancy, MM remains incurable due to the development of DR, with the underlying mechanisms remaining largely ill-defined. It is well-known that MM is a heterogeneous disease, encompassing both genetic and epigenetic aberrations. In normal circumstances, epigenetic modifications, including DNA methylation and posttranslational histone modifications, play an important role in proper chromatin structure and transcriptional regulation. However, in MM, numerous epigenetic defects or so-called ‘epimutations’ have been observed and this especially at the level of DNA methylation. These include genome-wide DNA hypomethylation, locus specific hypermethylation and somatic mutations, copy number variations and/or deregulated expression patterns in DNA methylation modifiers and regulators. The aberrant DNA methylation patterns lead to reduced gene expression of tumor suppressor genes, genomic instability, DR, disease progression, and high-risk disease. In addition, the frequency of somatic mutations in the DNA methylation modifiers seems increased in relapsed patients, again suggesting a role in DR and relapse. In this review, we discuss the recent advances in understanding the involvement of aberrant DNA methylation patterns and/or DNA methylation modifiers in MM development, progression, and relapse. In addition, we discuss their involvement in MM cell plasticity, driving myeloma cells to a cancer stem cell state characterized by a more immature and drug-resistant phenotype. Finally, we briefly touch upon the potential of DNA methyltransferase inhibitors to prevent relapse after treatment with the current standard of care agents and/or new, promising (immuno) therapies.
Collapse
|
|
31
|
Madrid E, Gonzalez-Miranda I, Muñoz S, Rejas C, Cardemil F, Martinez F, Cortes JP, Berasaluce M, Párraga M. Arsenic concentration in topsoil of central Chile is associated with aberrant methylation of P53 gene in human blood cells: a cross-sectional study. ENVIRONMENTAL SCIENCE AND POLLUTION RESEARCH INTERNATIONAL 2022; 29:48250-48259. [PMID: 35188613 DOI: 10.1007/s11356-022-19085-2] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.7] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Subscribe] [Scholar Register] [Received: 09/06/2021] [Accepted: 02/02/2022] [Indexed: 06/14/2023]
Abstract
Gene expression can be modified in people who are chronically exposed to high concentrations of heavy metals. The soil surrounding the Ventanas Industrial Complex, located on the coastal zone of Puchuncaví and Quintero townships (Chile), contain heavy metal concentrations (As, Cu, Pb, Zn, among others) that far exceed international standards. The aim of this study was to determine the potential association of the heavy metals in soils, especially arsenic, with the status of methylation of four tumor suppressor genes in permanent residents in those townships. To study the methylation status in genes p53, p16, APC, and RASSF1A, we took blood samples from adults living in areas near the industrial complex for at least 5 years and compared it to blood samples from adults living in areas with normal heavy metal concentrations of soils. Results indicated that inhabitants of an area with high levels of heavy metals in soil have a significantly higher proportion of methylation in the promoter region of the p53 tumor suppressor gene compared with control areas (p-value: 0.0035). This is the first study to consider associations between heavy metal exposure in humans and aberrant DNA methylation in Chile. Our results suggest more research to support consistent decision-making on processes of environmental remediation or prevention of exposure.
Collapse
Affiliation(s)
- Eva Madrid
- Interdisciplinary Centre for Health Studies (CIESAL) - Escuela de Medicina, Universidad de Valparaíso, Viña del Mar, Valparaíso, Chile.
| | - Isabel Gonzalez-Miranda
- Centro Regional de Investigación e Innovación para la Sostenibilidad de la Agricultura y los Territorios Rurales (Ceres), Quillota, Valparaíso, Chile
- Pontificia Universidad Católica de Valparaíso, Vicerrectoría de Investigación y Estudios Avanzados, Valparaíso, Chile
| | - Sergio Muñoz
- Department of Public Health-CIGES, Universidad de La Frontera, Temuco, Chile
| | - Carolina Rejas
- Department of Surgery, University Hospital Regensburg, Regensburg, Germany
| | - Felipe Cardemil
- Department of Basic and Clinical Oncology, School of Medicine, Universidad de Chile, Santiago, Chile
| | - Felipe Martinez
- Facultad de Medicina, Escuela de Medicina, Universidad Andrés Bello, Viña del Mar, Chile
| | | | - Maite Berasaluce
- Interdisciplinary Centre for Health Studies (CIESAL) - Escuela de Medicina, Universidad de Valparaíso, Viña del Mar, Valparaíso, Chile
| | - Mario Párraga
- Laboratorio de Biología Molecular, Centro de Investigaciones Biomédicas, Universidad de Valparaíso, Valparaíso, Chile
| |
Collapse
|
|
32
|
Zhao H, Yu J, Weng G, Yu J, Wang E, Gao J, Liu H, Hou T, Wang Z, Kang Y. Structural view on the role of the TRD loop in regulating DNMT3A activity: a molecular dynamics study. Phys Chem Chem Phys 2022; 24:15791-15801. [PMID: 35758413 DOI: 10.1039/d2cp02031a] [Citation(s) in RCA: 5] [Impact Index Per Article: 1.7] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/21/2022]
Abstract
DNA methyltransferase 3A (DNMT3A) has been regarded as a potential epigenetic target for the development of cancer therapeutics. A number of DNMT3A inhibitors have been reported, but most of them do not have good potency, high selectivity and/or low cytotoxicity. It has been suggested that a non-conserved region around the target recognition domain (TRD) loop is implicated in the DNMT3A activity under the allosteric regulation of the ATRX-DNMT3-DNMT3L (ADD) domain, but the molecular mechanism of the regulation of the TRD loop on the DNMT3A activity needs to be elucidated. In this study, based on the reported crystal structures, the dynamics of the TRD loop in different multimerization with/without the bound guest molecule, namely the ADD domain or the DNA molecule, was investigated using conventional molecular dynamics (MD) and umbrella sampling simulations. The simulation results illustrate that the TRD loop exhibits relatively higher flexibility than the other components in the whole catalytic domain (CD), which could be well stabilized into different local minima through the binding with either the ADD domain or the DNA molecule by forming tight hydrogen-bond and salt-bridge networks involving distinct residues. Moreover, the movement of the TRD loop away from the catalytic loop upon activation could be triggered simply by the detachment of the ADD domain, but not necessarily induced by the ADD domain relocation on the CD. All these dynamic structural details could be a supplement to the previously reported crystal structure, which underlines the importance of the structural flexibility for the critical residues in the TRD loop, arousing more interest in the rational design of novel DNMT3A inhibitors targeting this region.
Collapse
Affiliation(s)
- Hong Zhao
- College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310058, Zhejiang, China. .,Alibaba-Zhejiang University Joint Research Center of Future Digital Healthcare, China
| | - Jie Yu
- College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310058, Zhejiang, China.
| | - Gaoqi Weng
- College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310058, Zhejiang, China.
| | - Jiahui Yu
- College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310058, Zhejiang, China.
| | - Ercheng Wang
- College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310058, Zhejiang, China.
| | - Junbo Gao
- College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310058, Zhejiang, China.
| | - Huanxiang Liu
- Faculty of Applied Science, Macao Polytechnic University, Macao, SAR, China
| | - Tingjun Hou
- College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310058, Zhejiang, China.
| | - Zhe Wang
- College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310058, Zhejiang, China.
| | - Yu Kang
- College of Pharmaceutical Sciences, Zhejiang University, Hangzhou 310058, Zhejiang, China.
| |
Collapse
|
|
33
|
The Breast Cancer Protooncogenes HER2, BRCA1 and BRCA2 and Their Regulation by the iNOS/NOS2 Axis. Antioxidants (Basel) 2022; 11:antiox11061195. [PMID: 35740092 PMCID: PMC9227079 DOI: 10.3390/antiox11061195] [Citation(s) in RCA: 13] [Impact Index Per Article: 4.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/08/2022] [Revised: 06/01/2022] [Accepted: 06/06/2022] [Indexed: 02/04/2023] Open
Abstract
The expression of inducible nitric oxide synthase (iNOS; NOS2) and derived NO in various cancers was reported to exert pro- and anti-tumorigenic effects depending on the levels of expression and the tumor types. In humans, the breast cancer level of iNOS was reported to be overexpressed, to exhibit pro-tumorigenic activities, and to be of prognostic significance. Likewise, the expression of the oncogenes HER2, BRCA1, and BRCA2 has been associated with malignancy. The interrelationship between the expression of these protooncogenes and oncogenes and the expression of iNOS is not clear. We have hypothesized that there exist cross-talk signaling pathways between the breast cancer protooncogenes, the iNOS axis, and iNOS-mediated NO mutations of these protooncogenes into oncogenes. We review the molecular regulation of the expression of the protooncogenes in breast cancer and their interrelationships with iNOS expression and activities. In addition, we discuss the roles of iNOS, HER2, BRCA1/2, and NO metabolism in the pathophysiology of cancer stem cells. Bioinformatic analyses have been performed and have found suggested molecular alterations responsible for breast cancer aggressiveness. These include the association of BRCA1/2 mutations and HER2 amplifications with the dysregulation of the NOS pathway. We propose that future studies should be undertaken to investigate the regulatory mechanisms underlying the expression of iNOS and various breast cancer oncogenes, with the aim of identifying new therapeutic targets for the treatment of breast cancers that are refractory to current treatments.
Collapse
|
|
34
|
Chromosome-specific retention of cancer-associated DNA hypermethylation following pharmacological inhibition of DNMT1. Commun Biol 2022; 5:528. [PMID: 35654826 PMCID: PMC9163065 DOI: 10.1038/s42003-022-03509-3] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/29/2021] [Accepted: 05/20/2022] [Indexed: 11/08/2022] Open
Abstract
AbstractThe DNA methylation status of the X-chromosome in cancer cells is often overlooked because of computational difficulties. Most of the CpG islands on the X-chromosome are mono-allelically methylated in normal female cells and only present as a single copy in male cells. We treated two colorectal cancer cell lines from a male (HCT116) and a female (RKO) with increasing doses of a DNA methyltransferase 1 (DNMT1)-specific inhibitor (GSK3685032/GSK5032) over several months to remove as much non-essential CpG methylation as possible. Profiling of the remaining DNA methylome revealed an unexpected, enriched retention of DNA methylation on the X-chromosome. Strikingly, the identified retained X-chromosome DNA methylation patterns accurately predicted de novo DNA hypermethylation in colon cancer patient methylomes in the TCGA COAD/READ cohort. These results suggest that a re-examination of tumors for X-linked DNA methylation changes may enable greater understanding of the importance of epigenetic silencing of cancer related genes.
Collapse
|
|
35
|
Chen L, Ganz PA, Sehl ME. DNA Methylation, Aging, and Cancer Risk: A Mini-Review. FRONTIERS IN BIOINFORMATICS 2022; 2:847629. [PMID: 36304336 PMCID: PMC9580889 DOI: 10.3389/fbinf.2022.847629] [Citation(s) in RCA: 10] [Impact Index Per Article: 3.3] [Reference Citation Analysis] [Abstract] [Grants] [Track Full Text] [Download PDF] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/03/2022] [Accepted: 03/21/2022] [Indexed: 11/13/2022] Open
Abstract
Accumulation of somatic mutations and genomic instability are hallmarks of both aging and cancer. Epigenetic alterations occur across cell types and tissues with advancing age. DNA methylation-based estimates of biologic age can predict important age-related outcomes, including risk of frailty and mortality, and most recently have been shown to be associated with risk of developing cancer. In this mini-review, we examine pathways known to exhibit altered methylation in aging tissues, pre-malignant lesions, and tumors and review methodologies of epigenetic clocks that reliably predict cancer risk, including those derived from methylation studies of peripheral blood, as well as those methylation levels from within the tissues at high risk of cancer.
Collapse
Affiliation(s)
- Larry Chen
- Computational and Systems Biology Program, University of California, Los Angeles, Los Angeles, CA, United States
| | - Patricia A. Ganz
- Division of Hematology-Oncology, Department of Medicine, UCLA David Geffen School of Medicine, Los Angeles, CA, United States
- Department of Health Policy and Management, Fielding School of Public Health, University of California, Los Angeles, Los Angeles, CA, United States
| | - Mary E. Sehl
- Division of Hematology-Oncology, Department of Medicine, UCLA David Geffen School of Medicine, Los Angeles, CA, United States
- Department of Computational Medicine, UCLA David Geffen School of Medicine, Los Angeles, CA, United States
- *Correspondence: Mary E. Sehl,
| |
Collapse
|
|
36
|
Expression of proliferation-related genes in BM-MSC-treated ALL cells in hypoxia condition is regulated under the influence of epigenetic factors in-vitro. Med Oncol 2022; 39:88. [PMID: 35581482 DOI: 10.1007/s12032-022-01671-6] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/27/2021] [Accepted: 01/12/2022] [Indexed: 10/18/2022]
Abstract
Mesenchymal stem cells affect ALL cell biology under hypoxic conditions. We studied survival, proliferation, expression, and promoter methylation levels of essential genes involved in expanding MOLT-4 cells co-cultured with BM-MSC under the hypoxic condition. Here, MOLT-4 cells were co-cultured with BMMSCs under hypoxic conditions. First, the apoptosis rate was evaluated by Flow cytometry. Then, MOLT-4 cells' proliferation rate was assessed using MTT assay, and the expressions and methylation rates of genes were determined by qRT-PCR and MS-qPCR, respectively. The results showed that although MOLT-4 cells proliferation and survival rates were reduced under hypoxic conditions, this reduction was not statistically significant. Also, we showed that hypoxic conditions caused upregulation of candidate genes and affected their methylation status. Besides, it was revealed that Pontin was downregulated, while KDM3A, SKP2, and AURKA had an upward trend in the presence of MOLT-4 cells plus BM-MSC. The co-culture of leukemia cells with BMMSCs under hypoxic conditions may be a potential therapeutic approach for ALL.
Collapse
|
|
37
|
Barbé L, Finkbeiner S. Genetic and Epigenetic Interplay Define Disease Onset and Severity in Repeat Diseases. Front Aging Neurosci 2022; 14:750629. [PMID: 35592702 PMCID: PMC9110800 DOI: 10.3389/fnagi.2022.750629] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.7] [Reference Citation Analysis] [Abstract] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/30/2021] [Accepted: 03/01/2022] [Indexed: 11/13/2022] Open
Abstract
Repeat diseases, such as fragile X syndrome, myotonic dystrophy, Friedreich ataxia, Huntington disease, spinocerebellar ataxias, and some forms of amyotrophic lateral sclerosis, are caused by repetitive DNA sequences that are expanded in affected individuals. The age at which an individual begins to experience symptoms, and the severity of disease, are partially determined by the size of the repeat. However, the epigenetic state of the area in and around the repeat also plays an important role in determining the age of disease onset and the rate of disease progression. Many repeat diseases share a common epigenetic pattern of increased methylation at CpG islands near the repeat region. CpG islands are CG-rich sequences that are tightly regulated by methylation and are often found at gene enhancer or insulator elements in the genome. Methylation of CpG islands can inhibit binding of the transcriptional regulator CTCF, resulting in a closed chromatin state and gene down regulation. The downregulation of these genes leads to some disease-specific symptoms. Additionally, a genetic and epigenetic interplay is suggested by an effect of methylation on repeat instability, a hallmark of large repeat expansions that leads to increasing disease severity in successive generations. In this review, we will discuss the common epigenetic patterns shared across repeat diseases, how the genetics and epigenetics interact, and how this could be involved in disease manifestation. We also discuss the currently available stem cell and mouse models, which frequently do not recapitulate epigenetic patterns observed in human disease, and propose alternative strategies to study the role of epigenetics in repeat diseases.
Collapse
Affiliation(s)
- Lise Barbé
- Center for Systems and Therapeutics, Gladstone Institutes, San Francisco, CA, United States
- Department of Neurology, University of California, San Francisco, San Francisco, CA, United States
- Department of Physiology, University of California, San Francisco, San Francisco, CA, United States
| | - Steve Finkbeiner
- Center for Systems and Therapeutics, Gladstone Institutes, San Francisco, CA, United States
- Department of Neurology, University of California, San Francisco, San Francisco, CA, United States
- Department of Physiology, University of California, San Francisco, San Francisco, CA, United States
- *Correspondence: Steve Finkbeiner,
| |
Collapse
|
|
38
|
Hayashi T, Eto K, Kadoya Y. Downregulation of ten-eleven translocation-2 triggers epithelial differentiation during organogenesis. Differentiation 2022; 125:45-53. [DOI: 10.1016/j.diff.2022.05.001] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/06/2022] [Revised: 03/25/2022] [Accepted: 05/02/2022] [Indexed: 11/26/2022]
|
|
39
|
Ravi S, Alencar AM, Arakelyan J, Xu W, Stauber R, Wang CCI, Papyan R, Ghazaryan N, Pereira RM. An Update to Hallmarks of Cancer. Cureus 2022; 14:e24803. [PMID: 35686268 PMCID: PMC9169686 DOI: 10.7759/cureus.24803] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Accepted: 05/06/2022] [Indexed: 12/03/2022] Open
Abstract
In the last decade, there has been remarkable progress in research toward understanding and refining the hallmarks of cancer. In this review, we propose a new hallmark - "pro-survival autophagy." The importance of pro-survival autophagy is well established in tumorigenesis, as it is related to multiple steps in cancer progression and vital for some cancers. Autophagy is a potential anti-cancer therapeutic target. For this reason, autophagy is a good candidate as a new hallmark of cancer. We describe two enabling characteristics that play a major role in enabling cells to acquire the hallmarks of cancer - "tumor-promoting microenvironment and macroenvironment" and "cancer epigenetics, genome instability and mutation." We also discuss the recent updates, therapeutic and prognostic implications of the eight hallmarks of cancer described by Hanahan et al. in 2011. Understanding these hallmarks and enabling characteristics is key not only to developing new ways to treat cancer efficiently but also to exploring options to overcome cancer resistance to treatment.
Collapse
Affiliation(s)
- Swapna Ravi
- Department of Medicine, St. Luke's Hospital, Duluth, USA
| | - Antonio M Alencar
- Department of Medical Oncology, Hospital Universitário da Universidade Federal do Maranhão, Hospital São Domingos, São Luís, BRA
| | - Jemma Arakelyan
- Department of Oncology/Solid Tumors, Yerevan State Medical University, Hematology Center After Prof. R. Yeolyan, Yerevan, ARM
| | - Weihao Xu
- Department of Business Development, Harbour BioMed, Boston, USA
| | - Roberta Stauber
- Department of Oncology, Universidade do Estado do Rio de Janeiro, Rio de Janeiro, BRA
| | - Cheng-Chi I Wang
- Department of Research and Development, Beltie Bio, Inc, San Diego, USA
| | - Ruzanna Papyan
- Department of Pediatric Oncology and Hematology, Yerevan State Medical University, Pediatric Center and Blood Disorders Center of Armenia, Yerevan, ARM
| | - Narine Ghazaryan
- Department of Molecular Biology, L.A. Orbeli Institute of Physiology National Academy of Sciences, Republic of Armenia (NAS RA) Hematology Center After Prof. R. Yeolyan, Yerevan, ARM
| | - Rosalina M Pereira
- Department of Neurology, University of Texas Southwestern Medical Center, Dallas, USA
| |
Collapse
|
|
40
|
Mattei AL, Bailly N, Meissner A. DNA methylation: a historical perspective. Trends Genet 2022; 38:676-707. [DOI: 10.1016/j.tig.2022.03.010] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/19/2022] [Revised: 03/14/2022] [Accepted: 03/15/2022] [Indexed: 10/18/2022]
|
|
41
|
Fan J, Bellon M, Ju M, Zhao L, Wei M, Fu L, Nicot C. Clinical significance of FBXW7 loss of function in human cancers. Mol Cancer 2022; 21:87. [PMID: 35346215 PMCID: PMC8962602 DOI: 10.1186/s12943-022-01548-2] [Citation(s) in RCA: 62] [Impact Index Per Article: 20.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/22/2021] [Accepted: 02/22/2022] [Indexed: 12/13/2022] Open
Abstract
FBXW7 (F-Box and WD Repeat Domain Containing 7) (also referred to as FBW7 or hCDC4) is a component of the Skp1-Cdc53 / Cullin-F-box-protein complex (SCF/β-TrCP). As a member of the F-box protein family, FBXW7 serves a role in phosphorylation-dependent ubiquitination and proteasome degradation of oncoproteins that play critical role(s) in oncogenesis. FBXW7 affects many regulatory functions involved in cell survival, cell proliferation, tumor invasion, DNA damage repair, genomic instability and telomere biology. This thorough review of current literature details how FBXW7 expression and functions are regulated through multiple mechanisms and how that ultimately drives tumorigenesis in a wide array of cell types. The clinical significance of FBXW7 is highlighted by the fact that FBXW7 is frequently inactivated in human lung, colon, and hematopoietic cancers. The loss of FBXW7 can serve as an independent prognostic marker and is significantly correlated with the resistance of tumor cells to chemotherapeutic agents and poorer disease outcomes. Recent evidence shows that genetic mutation of FBXW7 differentially affects the degradation of specific cellular targets resulting in a distinct and specific pattern of activation/inactivation of cell signaling pathways. The clinical significance of FBXW7 mutations in the context of tumor development, progression, and resistance to therapies as well as opportunities for targeted therapies is discussed.
Collapse
Affiliation(s)
- Jingyi Fan
- State Key Laboratory of Oncology in South China; Collaborative Innovation Center for Cancer Medicine, Guangdong Esophageal Cancer Institute; Sun Yat-sen University Cancer Center, Guangzhou, 510060, Guangdong Province, China.,Department of Pharmacology, School of Pharmacy, China Medical University, Shenyang, 110122, China.,Liaoning Province, China Liaoning Key Laboratory of Molecular Targeted Anti-Tumor Drug Development and Evaluation, Liaoning Cancer Immune Peptide Drug Engineering Technology Research Center, Key Laboratory of Precision Diagnosis and Treatment of Gastrointestinal Tumors, Ministry of Education, China Medical University, Shenyang, 110122, Liaoning Province, China
| | - Marcia Bellon
- Department of Pathology and Laboratory Medicine, Center for Viral Pathogenesis, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS, 66160, USA
| | - Mingyi Ju
- Department of Pharmacology, School of Pharmacy, China Medical University, Shenyang, 110122, China.,Liaoning Province, China Liaoning Key Laboratory of Molecular Targeted Anti-Tumor Drug Development and Evaluation, Liaoning Cancer Immune Peptide Drug Engineering Technology Research Center, Key Laboratory of Precision Diagnosis and Treatment of Gastrointestinal Tumors, Ministry of Education, China Medical University, Shenyang, 110122, Liaoning Province, China
| | - Lin Zhao
- Department of Pharmacology, School of Pharmacy, China Medical University, Shenyang, 110122, China.,Liaoning Province, China Liaoning Key Laboratory of Molecular Targeted Anti-Tumor Drug Development and Evaluation, Liaoning Cancer Immune Peptide Drug Engineering Technology Research Center, Key Laboratory of Precision Diagnosis and Treatment of Gastrointestinal Tumors, Ministry of Education, China Medical University, Shenyang, 110122, Liaoning Province, China
| | - Minjie Wei
- Department of Pharmacology, School of Pharmacy, China Medical University, Shenyang, 110122, China.,Liaoning Province, China Liaoning Key Laboratory of Molecular Targeted Anti-Tumor Drug Development and Evaluation, Liaoning Cancer Immune Peptide Drug Engineering Technology Research Center, Key Laboratory of Precision Diagnosis and Treatment of Gastrointestinal Tumors, Ministry of Education, China Medical University, Shenyang, 110122, Liaoning Province, China
| | - Liwu Fu
- State Key Laboratory of Oncology in South China; Collaborative Innovation Center for Cancer Medicine, Guangdong Esophageal Cancer Institute; Sun Yat-sen University Cancer Center, Guangzhou, 510060, Guangdong Province, China.
| | - Christophe Nicot
- Department of Pathology and Laboratory Medicine, Center for Viral Pathogenesis, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS, 66160, USA.
| |
Collapse
|
|
42
|
Abstract
In this interview, Professor Peter W Laird speaks with Storm Johnson, Commissioning Editor for Epigenomics, on his work to date in the field of cancer epigenetics. Dr Peter W Laird is a Professor at Van Andel Institute (VAI) in Grand Rapids, Michigan. He earned his B.S. and M.S., Cum Laude, from the University of Leiden, The Netherlands. He trained for his PhD with Dr Piet Borst, The Netherlands Cancer Institute, and as a postdoc with Dr Anton Berns, The Netherlands Cancer Institute, and with Dr Rudolf Jaenisch, at the Whitehead Institute for Biomedical Research in Cambridge, MA, USA. He joined the faculty at the University of Southern California in 1996, where he served as the Founding Director of the USC Epigenome Center and also as the Leader of the Epigenetics and Regulation Program of the Norris Comprehensive Cancer Center. In 2014, he relocated to VAI to join Dr Peter Jones in building an internationally acclaimed research center focused on Epigenetics. Dr Laird published the first demonstration of the causal role for DNA methylation in oncogenesis (Cell, 1995) [1]. He served as the Principal Investigator for all DNA methylation data production for the Cancer Genome Atlas (TCGA) and led many TCGA analysis efforts. He has been awarded 10 patents related to DNA methylation technology by the United States Patent and Trademark Office, one of which is the basis for the first US FDA-approved blood-based DNA methylation assay for cancer (Epi proColon). His research findings include the report of a close link between DNA methylation and BRAF mutation in colorectal cancer (Nature Genetics, 2006) [2], the discovery that embryonic stem cell polycomb repressor targets are predisposed to abnormal DNA methylation in cancer (Nature Genetics, 2007) [3], the identification of a novel epigenetic subtype of glioma (G-CIMP), tightly associated with IDH1 mutation (Cancer Cell, 2010) [4], and the connection between nuclear architecture, late replication, and domains of epigenetic instability (Nature Genetics, 2011) [5], later showing a link with mitotic cell division, thus providing a mechanistic explanation for the loss of DNA methylation in aging and cancer first described four decades ago (Nature Genetics, 2018) [6].
Collapse
|
|
43
|
Ferraguti G, Terracina S, Petrella C, Greco A, Minni A, Lucarelli M, Agostinelli E, Ralli M, de Vincentiis M, Raponi G, Polimeni A, Ceccanti M, Caronti B, Di Certo MG, Barbato C, Mattia A, Tarani L, Fiore M. Alcohol and Head and Neck Cancer: Updates on the Role of Oxidative Stress, Genetic, Epigenetics, Oral Microbiota, Antioxidants, and Alkylating Agents. Antioxidants (Basel) 2022; 11:145. [PMID: 35052649 PMCID: PMC8773066 DOI: 10.3390/antiox11010145] [Citation(s) in RCA: 25] [Impact Index Per Article: 8.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/27/2021] [Revised: 12/27/2021] [Accepted: 01/04/2022] [Indexed: 02/06/2023] Open
Abstract
Head and neck cancer (HNC) concerns more than 890,000 patients worldwide annually and is associated with the advanced stage at presentation and heavy outcomes. Alcohol drinking, together with tobacco smoking, and human papillomavirus infection are the main recognized risk factors. The tumorigenesis of HNC represents an intricate sequential process that implicates a gradual acquisition of genetic and epigenetics alterations targeting crucial pathways regulating cell growth, motility, and stromal interactions. Tumor microenvironment and growth factors also play a major role in HNC. Alcohol toxicity is caused both directly by ethanol and indirectly by its metabolic products, with the involvement of the oral microbiota and oxidative stress; alcohol might enhance the exposure of epithelial cells to carcinogens, causing epigenetic modifications, DNA damage, and inaccurate DNA repair with the formation of DNA adducts. Long-term markers of alcohol consumption, especially those detected in the hair, may provide crucial information on the real alcohol drinking of HNC patients. Strategies for prevention could include food supplements as polyphenols, and alkylating drugs as therapy that play a key role in HNC management. Indeed, polyphenols throughout their antioxidant and anti-inflammatory actions may counteract or limit the toxic effect of alcohol whereas alkylating agents inhibiting cancer cells' growth could reduce the carcinogenic damage induced by alcohol. Despite the established association between alcohol and HNC, a concerning pattern of alcohol consumption in survivors of HNC has been shown. It is of primary importance to increase the awareness of cancer risks associated with alcohol consumption, both in oncologic patients and the general population, to provide advice for reducing HNC prevalence and complications.
Collapse
Affiliation(s)
- Giampiero Ferraguti
- Department of Experimental Medicine, Sapienza University of Rome, 00185 Rome, Italy; (G.F.); (S.T.); (M.L.)
| | - Sergio Terracina
- Department of Experimental Medicine, Sapienza University of Rome, 00185 Rome, Italy; (G.F.); (S.T.); (M.L.)
| | - Carla Petrella
- Institute of Biochemistry and Cell Biology, IBBC—CNR, 000185 Rome, Italy; (C.P.); (M.G.D.C.); (C.B.)
| | - Antonio Greco
- Department of Sense Organs, Sapienza University of Rome, 00185 Rome, Italy; (A.G.); (A.M.); (E.A.); (M.R.); (M.d.V.)
| | - Antonio Minni
- Department of Sense Organs, Sapienza University of Rome, 00185 Rome, Italy; (A.G.); (A.M.); (E.A.); (M.R.); (M.d.V.)
| | - Marco Lucarelli
- Department of Experimental Medicine, Sapienza University of Rome, 00185 Rome, Italy; (G.F.); (S.T.); (M.L.)
| | - Enzo Agostinelli
- Department of Sense Organs, Sapienza University of Rome, 00185 Rome, Italy; (A.G.); (A.M.); (E.A.); (M.R.); (M.d.V.)
| | - Massimo Ralli
- Department of Sense Organs, Sapienza University of Rome, 00185 Rome, Italy; (A.G.); (A.M.); (E.A.); (M.R.); (M.d.V.)
| | - Marco de Vincentiis
- Department of Sense Organs, Sapienza University of Rome, 00185 Rome, Italy; (A.G.); (A.M.); (E.A.); (M.R.); (M.d.V.)
| | - Giammarco Raponi
- Department of Public Health and Infectious Diseases, Sapienza University of Rome, 00185 Rome, Italy;
| | - Antonella Polimeni
- Department of Odontostomatological and Maxillofacial Sciences, Sapienza University of Rome, 00185 Rome, Italy;
| | - Mauro Ceccanti
- SITAC, Società Italiana per il Trattamento dell’Alcolismo, 00184 Rome, Italy;
- SIFASD, Società Italiana Sindrome Feto-Alcolica, 00184 Rome, Italy
| | - Brunella Caronti
- Department of Human Neurosciences, Sapienza University of Rome, 00185 Rome, Italy;
| | - Maria Grazia Di Certo
- Institute of Biochemistry and Cell Biology, IBBC—CNR, 000185 Rome, Italy; (C.P.); (M.G.D.C.); (C.B.)
| | - Christian Barbato
- Institute of Biochemistry and Cell Biology, IBBC—CNR, 000185 Rome, Italy; (C.P.); (M.G.D.C.); (C.B.)
| | - Alessandro Mattia
- Ministero dell’Interno, Dipartimento della Pubblica Sicurezza, Direzione Centrale di Sanità, Centro di Ricerche e Laboratorio di Tossicologia Forense, 00185 Rome, Italy;
| | - Luigi Tarani
- Department of Pediatrics, Sapienza University Hospital of Rome, 00185 Rome, Italy;
| | - Marco Fiore
- Institute of Biochemistry and Cell Biology, IBBC—CNR, 000185 Rome, Italy; (C.P.); (M.G.D.C.); (C.B.)
| |
Collapse
|
|
44
|
The role of microRNAs in COVID-19 with a focus on miR-200c. J Circ Biomark 2022; 11:14-23. [PMID: 35356072 PMCID: PMC8939267 DOI: 10.33393/jcb.2022.2356] [Citation(s) in RCA: 10] [Impact Index Per Article: 3.3] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/05/2021] [Accepted: 02/22/2022] [Indexed: 12/11/2022] Open
Abstract
Objective: Epigenetics is a quickly spreading scientific field, and the study of epigenetic regulation in various diseases such as infectious diseases is emerging. The microribonucleic acids (miRNAs) as one of the types of epigenetic processes bind to their target messenger RNAs (mRNAs) and regulate their stability and/or translation. This study aims to evaluate non-coding RNAs (ncRNAs) with a focus on miR-200c in COVID-19. In this review, we first define the epigenetics and miRNAs, and then the role of miRNAs in diseases focusing on lung diseases is explained. Finally, in this study, we will investigate the role and position of miRNAs with a focus on miR-200c in viral and severe acute respiratory syndrome–related coronavirus (SARS-CoV2) infections. Methods: Systematic search of MEDLINE, PubMed, Web of Science, Embase, and Cochrane Library was conducted for all relative papers from 2000 to 2021 with the limitations of the English language. Finally, we selected 128 articles which fit the best to our objective of study, among which 5 articles focused on the impact of miR-200c. Results: Due to the therapeutic results of various drugs in different races and populations, epigenetic processes, especially miRNAs, are important. The overall results showed that different types of miRNAs can be effective on the process of various lung diseases through different target pathways and genes. It is likely that amplified levels of miR-200c may lead to decreased angiotensin-converting enzyme-2 (ACE2) expression, which in turn may increase the potential of infection, inflammation, and the complications of coronavirus disease. Conclusion: miR-200c and its correlation with ACE2 can be used as early prognostic and diagnostic markers.
Collapse
|
|
45
|
Svoboda LK, Ishikawa T, Dolinoy DC. Developmental toxicant exposures and sex-specific effects on epigenetic programming and cardiovascular health across generations. ENVIRONMENTAL EPIGENETICS 2022; 8:dvac017. [PMID: 36325489 PMCID: PMC9600458 DOI: 10.1093/eep/dvac017] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Subscribe] [Scholar Register] [Received: 05/27/2022] [Revised: 09/12/2022] [Accepted: 10/01/2022] [Indexed: 05/15/2023]
Abstract
Despite substantial strides in diagnosis and treatment, cardiovascular diseases (CVDs) continue to represent the leading cause of death in the USA and around the world, resulting in significant morbidity and loss of productive years of life. It is increasingly evident that environmental exposures during early development can influence CVD risk across the life course. CVDs exhibit marked sexual dimorphism, but how sex interacts with environmental exposures to affect cardiovascular health is a critical and understudied area of environmental health. Emerging evidence suggests that developmental exposures may have multi- and transgenerational effects on cardiovascular health, with potential sex differences; however, further research in this important area is urgently needed. Lead (Pb), phthalate plasticizers, and perfluoroalkyl substances (PFAS) are ubiquitous environmental contaminants with numerous adverse human health effects. Notably, recent evidence suggests that developmental exposure to each of these toxicants has sex-specific effects on cardiovascular outcomes, but the underlying mechanisms, and their effects on future generations, require further investigation. This review article will highlight the role for the developmental environment in influencing cardiovascular health across generations, with a particular emphasis on sex differences and epigenetic mechanisms. In particular, we will focus on the current evidence for adverse multi and transgenerational effects of developmental exposures to Pb, phthalates, and PFAS and highlight areas where further research is needed.
Collapse
Affiliation(s)
- Laurie K Svoboda
- *Correspondence address. Environmental Health Sciences, University of Michigan, School of Public Health, 1415 Washington Heights, Ann Arbor, MI 48109, USA. Tel: +734-764-2032; E-mail:
| | - Tomoko Ishikawa
- Environmental Health Sciences, University of Michigan, School of Public Health, 1415 Washington Heights, Ann Arbor, MI 48109, USA
| | - Dana C Dolinoy
- Environmental Health Sciences, University of Michigan, School of Public Health, 1415 Washington Heights, Ann Arbor, MI 48109, USA
- Nutritional Sciences, University of Michigan, School of Public Health, 1415 Washington Heights, Ann Arbor, MI 48109, USA
| |
Collapse
|
|
46
|
Bildik G, Liang X, Sutton MN, Bast RC, Lu Z. DIRAS3: An Imprinted Tumor Suppressor Gene that Regulates RAS and PI3K-driven Cancer Growth, Motility, Autophagy, and Tumor Dormancy. Mol Cancer Ther 2022; 21:25-37. [PMID: 34667114 DOI: 10.1158/1535-7163.mct-21-0331] [Citation(s) in RCA: 21] [Impact Index Per Article: 7.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/22/2021] [Revised: 07/20/2021] [Accepted: 10/11/2021] [Indexed: 01/14/2023]
Abstract
DIRAS3 is an imprinted tumor suppressor gene that encodes a 26 kDa GTPase with 60% amino acid homology to RAS, but with a distinctive 34 amino acid N-terminal extension required to block RAS function. DIRAS3 is maternally imprinted and expressed only from the paternal allele in normal cells. Loss of expression can occur in a single "hit" through multiple mechanisms. Downregulation of DIRAS3 occurs in cancers of the ovary, breast, lung, prostate, colon, brain, and thyroid. Reexpression of DIRAS3 inhibits signaling through PI3 kinase/AKT, JAK/STAT, and RAS/MAPK, blocking malignant transformation, inhibiting cancer cell growth and motility, and preventing angiogenesis. DIRAS3 is a unique endogenous RAS inhibitor that binds directly to RAS, disrupting RAS dimers and clusters, and preventing RAS-induced transformation. DIRAS3 is essential for autophagy and triggers this process through multiple mechanisms. Reexpression of DIRAS3 induces dormancy in a nu/nu mouse xenograft model of ovarian cancer, inhibiting cancer cell growth and angiogenesis. DIRAS3-mediated induction of autophagy facilitates the survival of dormant cancer cells in a nutrient-poor environment. DIRAS3 expression in dormant, drug-resistant autophagic cancer cells can serve as a biomarker and as a target for novel therapy to eliminate the residual disease that remains after conventional therapy.
Collapse
Affiliation(s)
- Gamze Bildik
- Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, Texas
| | - Xiaowen Liang
- Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, Texas
| | - Margie N Sutton
- Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, Texas
| | - Robert C Bast
- Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, Texas
| | - Zhen Lu
- Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, Texas.
| |
Collapse
|
|
47
|
The Role of DNA Methylation and DNA Methyltransferases in Cancer. ADVANCES IN EXPERIMENTAL MEDICINE AND BIOLOGY 2022; 1389:317-348. [DOI: 10.1007/978-3-031-11454-0_13] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 11/11/2022]
|
|
48
|
Gao X, Chen Q, Yao H, Tan J, Liu Z, Zhou Y, Zou Z. Epigenetics in Alzheimer's Disease. Front Aging Neurosci 2022; 14:911635. [PMID: 35813941 PMCID: PMC9260511 DOI: 10.3389/fnagi.2022.911635] [Citation(s) in RCA: 39] [Impact Index Per Article: 13.0] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/02/2022] [Accepted: 05/24/2022] [Indexed: 12/19/2022] Open
Abstract
Alzheimer's disease (AD) is a neurodegenerative disease with unknown pathogenesis and complex pathological manifestations. At present, a large number of studies on targeted drugs for the typical pathological phenomenon of AD (Aβ) have ended in failure. Although there are some drugs on the market that indirectly act on AD, their efficacy is very low and the side effects are substantial, so there is an urgent need to develop a new strategy for the treatment of AD. An increasing number of studies have confirmed epigenetic changes in AD. Although it is not clear whether these epigenetic changes are the cause or result of AD, they provide a new avenue of treatment for medical researchers worldwide. This article summarizes various epigenetic changes in AD, including DNA methylation, histone modification and miRNA, and concludes that epigenetics has great potential as a new target for the treatment of AD.
Collapse
Affiliation(s)
- Xiaodie Gao
- Guangxi Key Lab of Brain and Cognitive Neuroscience, Guilin Medical University, Guilin, China
- Department of Scientific Research, Brain Hospital of Guangxi Zhuang Autonomous Region, Liuzhou, China
| | - Qiang Chen
- Department of Scientific Research, Brain Hospital of Guangxi Zhuang Autonomous Region, Liuzhou, China
| | - Hua Yao
- Guangxi Key Lab of Brain and Cognitive Neuroscience, Guilin Medical University, Guilin, China
| | - Jie Tan
- Guangxi Key Lab of Brain and Cognitive Neuroscience, Guilin Medical University, Guilin, China
| | - Zheng Liu
- Guangxi Key Lab of Brain and Cognitive Neuroscience, Guilin Medical University, Guilin, China
- *Correspondence: Zheng Liu,
| | - Yan Zhou
- Guangxi Key Lab of Brain and Cognitive Neuroscience, Guilin Medical University, Guilin, China
- Yan Zhou,
| | - Zhenyou Zou
- Guangxi Key Lab of Brain and Cognitive Neuroscience, Guilin Medical University, Guilin, China
- Department of Scientific Research, Brain Hospital of Guangxi Zhuang Autonomous Region, Liuzhou, China
- Zhenyou Zou,
| |
Collapse
|
|
49
|
Liu H, Xie HQ, Zhao Y, Zhang W, Zhang Y. DNA methylation-mediated down-regulation of TMEM130 promotes cell migration in breast cancer. Acta Histochem 2021; 123:151814. [PMID: 34763116 DOI: 10.1016/j.acthis.2021.151814] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/23/2021] [Revised: 10/15/2021] [Accepted: 10/29/2021] [Indexed: 12/09/2022]
Abstract
BACKGROUND Breast cancer is the most common female cancer worldwide. DNA methylation is a common modification in epigenetics and affects the prognosis of breast cancer by changing gene expression. In the present study, we aim to investigate the role of DNA methylation in TMEM130 gene expression, and the function of TMEM130 in breast cancer cell migration. METHODS The transcriptional expression of TMEM130 was detected by qRT-PCR in breast cancer cell lines and tissues. Bisulfite sequencing PCR (BSP) was used to confirm the methylation status of TMEM130 promoter. Then, TMEM130 was transfected in breast cancer cell lines and to explore its role in cell migration by Transwell and western blot. RESULTS TMEM130 mRNA expression was decreased in breast cancer cell lines and tissues, and consistent with the data in The Cancer Genome Atlas (TCGA). The promoter of TMEM130 was hypermethylated in breast cancer and the expression of TMEM130 could be restored by the methyltransferase inhibitor. Overexpression of TMEM130 could inhibit cell migration ability in breast cancer cell lines. CONCLUSION Taken together, these results indicate TMEM130 downregulation and hypermethylation might contribute to breast cancer migration and TMEM130 might be a promising biomarker for breast cancer.
Collapse
Affiliation(s)
- Hong Liu
- Department of Clinical Laboratory, Zibo Central Hospital, Zibo 255036, China
| | - Hong-Qiang Xie
- Department of Intensive Care Unit，Zibo Central Hospital, Zibo 255036, China
| | - Yan Zhao
- Department of Clinical Laboratory, Zibo Central Hospital, Zibo 255036, China
| | - Wen Zhang
- Department of Clinical Laboratory, Zibo Central Hospital, Zibo 255036, China
| | - Yan Zhang
- Department of Clinical Laboratory, Zibo Central Hospital, Zibo 255036, China.
| |
Collapse
|
|
50
|
Qazi S, Raza K. In silico approach to understand epigenetics of POTEE in ovarian cancer. J Integr Bioinform 2021; 18:jib-2021-0028. [PMID: 34788504 PMCID: PMC8709732 DOI: 10.1515/jib-2021-0028] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/30/2021] [Accepted: 11/04/2021] [Indexed: 12/20/2022] Open
Abstract
Ovarian cancer is the third leading cause of cancer-related deaths in India. Epigenetics mechanisms seemingly plays an important role in ovarian cancer. This paper highlights the crucial epigenetic changes that occur in POTEE that get hypomethylated in ovarian cancer. We utilized the POTEE paralog mRNA sequence to identify major motifs and also performed its enrichment analysis. We identified 6 motifs of varying lengths, out of which only three motifs, including CTTCCAGCAGATGTGGATCA, GGAACTGCC, and CGCCACATGCAGGC were most likely to be present in the nucleotide sequence of POTEE. By enrichment and occurrences identification analyses, we rectified the best match motif as CTTCCAGCAGATGT. Since there is no experimentally verified structure of POTEE paralog, thus, we predicted the POTEE structure using an automated workflow for template-based modeling using the power of a deep neural network. Additionally, to validate our predicted model we used AlphaFold predicted POTEE structure and observed that the residual stretch starting from 237-958 had a very high confidence per residue. Furthermore, POTEE predicted model stability was evaluated using replica exchange molecular dynamic simulation for 50 ns. Our network-based epigenetic analysis discerns only 10 highly significant, direct, and physical associators of POTEE. Our finding aims to provide new insights about the POTEE paralog.
Collapse
Affiliation(s)
- Sahar Qazi
- Department of Computer Science, Jamia Millia Islamia, New Delhi 110025, India
| | - Khalid Raza
- Department of Computer Science, Jamia Millia Islamia, New Delhi 110025, India
| |
Collapse
|