Copyright: ©Author(s) 2026.
World J Diabetes. Jul 15, 2026; 17(7): 121202
Published online Jul 15, 2026. doi: 10.4239/wjd.121202
Published online Jul 15, 2026. doi: 10.4239/wjd.121202
Table 1 Composition of Dangua Fang
| Chinese name | Scientific name | Used parts | Per 100 g (g) |
| Danshen | Salvia miltiorrhiza Bunge | Root | 18.75 |
| Gualou | Trichosanthes kirilowii Maxim | Fruit and seeds | 18.75 |
| Chuanxiong | Conioselinum anthriscoides “Chuanxiong” | Rhizome | 12.5 |
| Yujin | Curcuma longa L | Root | 12.5 |
| Xiebai | Allium macrostemon Bunge | Bulb | 12.5 |
| Chishao | Paeonia lactiflora Pall | Root | 12.5 |
| Banxia | Pinellia ternata (Thunb) Makino | Rhizome | 6.25 |
| Jiangcan | Bombyx batryticatus | Whole insect | 6.25 |
Table 2 Primer sequences for quantitative reverse-transcription polymerase chain reaction
| Name | Sequences (5’-3’) | Length (bp) |
| NAMPT | F: GTTGCTGCCACCTTACCTTAG | 126 |
| R: CCACCAGAACCAAAGGAGAC | ||
| SIRT1 | F: GACGCCTTATCCTCTAGTTCCT | 130 |
| R: CAGCATCATCTTCCAAGCCATT | ||
| β-actin | F: CGCGAGTACAACCTTCTTGC | 211 |
| R: CCTTCTGACCCATACCCACC |
Table 3 Comparison of blood glucose levels, mean ± SD
| Group | FBG (mmol/L) | PBG (mmol/L) | ||||
| Week 1 | Week 7 | Week 15 | Week 1 | Week 7 | Week 15 | |
| CON | 6.41 ± 0.83 | 5.30 ± 0.90 | 6.66 ± 0.82 | 7.14 ± 0.72 | 6.06 ± 0.74 | 6.16 ± 0.68 |
| MOD | 16.53 ± 1.72a | 18.17 ± 2.38a | 19.77 ± 1.45a | 20.20 ± 2.52a | 22.23 ± 3.28a | 25.25 ± 2.95a |
| DFG | 15.98 ± 2.17 | 12.18 ± 1.61c | 14.37 ± 1.89c | 20.18 ± 2.33 | 12.76 ± 2.71c | 22.06 ± 3.31b |
| MET | 15.94 ± 1.94 | 9.71 ± 1.95c | 13.41 ± 1.77c | 19.89 ± 2.34 | 13.07 ± 3.16c | 15.79 ± 3.28c |
Table 4 Comparison of glucolipid metabolism-related indicators, mean ± SD
| Group | Liver weight (g) | Liver index (%) | HbA1c (mg/L) | TC (mmol/L) | TG (mmol/L) | HDL-C (mmol/L) | LDL-C (mmol/L) | FFA (mmol/L) |
| CON | 12.32 ± 2.75 | 3.28 ± 1.22 | 0.52 ± 0.08 | 2.27 ± 1.34 | 4.09 ± 1.38 | 1.60 ± 0.28 | 0.15 ± 0.08 | 0.80 ± 0.24 |
| MOD | 24.79 ± 2.75a | 8.39 ± 2.39a | 1.82 ± 0.25a | 22.12 ± 2.45a | 11.08 ± 2.62a | 0.85 ± 0.25a | 1.40 ± 0.18a | 1.55 ± 0.33a |
| DFG | 21.53 ± 2.78b | 6.15 ± 1.66b | 1.23 ± 0.21c | 11.16 ± 1.66c | 9.09 ± 2.08 | 1.01 ± 0.23 | 0.87 ± 0.15c | 0.73 ± 0.26c |
| MET | 21.02 ± 2.55b | 5.86 ± 1.57b | 0.98 ± 0.16c | 10.88 ± 2.42c | 8.77 ± 2.17b | 1.05 ± 0.22 | 0.80 ± 0.14c | 0.65 ± 0.24c |
Table 5 Comparison of nicotinamide phosphoribosyltransferase/nicotinamide adenine dinucleotide/sirtuin 1 axis expression, mean ± SD
| Group | NAD+ | NAMPT | SIRT1 | ||||
| mRNA | Protein | Positive area (%) | mRNA | Protein | Positive area (%) | ||
| CON | 77.12 ± 13.19 | 1.28 ± 0.21 | 1.69 ± 0.21 | 58.75 ± 7.55 | 1.18 ± 0.19 | 1.37 ± 0.21 | 61.14 ± 6.09 |
| MOD | 9.62 ± 3.22a | 0.73 ± 0.22a | 0.82 ± 0.22a | 19.77 ± 3.92a | 0.56 ± 0.23a | 0.81 ± 0.19a | 23.67 ± 3.98a |
| DFG | 26.34 ± 7.73c | 1.08 ± 0.23c | 1.54 ± 0.23c | 43.83 ± 5.31c | 0.99 ± 0.20c | 1.24 ± 0.24c | 47.77 ± 5.03c |
| MET | 29.63 ± 10.68c | 1.01 ± 0.22b | 1.49 ± 0.19c | 50.22 ± 5.34c | 1.04 ± 0.18c | 1.29 ± 0.23c | 36.21 ± 5.08c |
- Citation: Han Z, Wang ZT, Yang LQ, Heng XP. Regulatory effects of Dangua Fang on the NAMPT/NAD+/SIRT1 axis and amino acid metabolism in type 2 diabetic rats. World J Diabetes 2026; 17(7): 121202
- URL: https://www.wjgnet.com/1948-9358/full/v17/i7/121202.htm
- DOI: https://dx.doi.org/10.4239/wjd.121202