Epidermal growth factor receptor rs17337023 polymorphism in hypertensive gestational diabetic women: A pilot study

Table 1 Polymerase chain reaction primers details

Gene	Primers	Base pairs	PCR cycle	Amplicon size
Epidermal growth factor receptor (EGFR) rs17337023	Forward outer: ATTAACCACCAATCCAACATCCAGAC	26	67 °C; 30 s; 30 cycles	T allele 180; C allele 271; Control 406
	Reverse outer: CTTTCCCTCCACTGAGGACAAAGTT	25
	Forward inner (A allele): TCTCTTTCACTTCCTACAGATGCTCA	26
	Reverse inner (T allele): AGCCTTCAAGACCTGGCGCA	20

PCR: Polymerase chain reaction.

Table 2 Descriptive statistics and genotype frequency of study subjects

	Hypertensive pregnant case (n = 122)	Normotensive pregnant control (n = 80)	P-value
Age (Yr)	30.55 ± 8.05	29.13 ± 10.19	0.054
Weight (kg)	77.56 ± 16.88	69.24 ± 11.07	0.025
Body Fat %	35.138 ± 4.29	25.01 ± 8.28	0.000
Waist circumference (cm)	104.50 ± 12.09	86.92 ± 12.03	0.000
Systolic blood pressure (mmHg)	131.76 ± 13.04	122.02 ± 8.27	0.000
Diastolic blood pressure (mmHg)	85.88 ± 8.45	73.31 ± 11.27	0.000
Walk
None	90.1%	17.7%	0.000
30 min/3 days week	7.9%	74.2%
30 min/5 days week	2.0%	8.1%
Genotype frequency
EGFR rs17337023 polymorphism
AA	30	19	0.079
AT	56	48
TT	36	13
Allele Odds Ratio
Allele A	1.282 [0.860-1.912]		0.219
Allele T	0.780 [0.523-1.163]		0.221

Data presented as Mean ± SD and percentages. In all cases a P value of < 0.05 was considered significant. Hardy-Weinberg Equilibrium (HWE) for case P = 0.378 and control P = 0.064, Where EGFR is epidermal growth factor receptor.