©The Author(s) 2019.
World J Diabetes. Jul 15, 2019; 10(7): 396-402
Published online Jul 15, 2019. doi: 10.4239/wjd.v10.i7.396
Published online Jul 15, 2019. doi: 10.4239/wjd.v10.i7.396
Table 1 Polymerase chain reaction primers details
| Gene | Primers | Base pairs | PCR cycle | Amplicon size |
| Epidermal growth factor receptor (EGFR) rs17337023 | Forward outer: ATTAACCACCAATCCAACATCCAGAC | 26 | 67 °C; 30 s; 30 cycles | T allele 180; C allele 271; Control 406 |
| Reverse outer: CTTTCCCTCCACTGAGGACAAAGTT | 25 | |||
| Forward inner (A allele): TCTCTTTCACTTCCTACAGATGCTCA | 26 | |||
| Reverse inner (T allele): AGCCTTCAAGACCTGGCGCA | 20 |
Table 2 Descriptive statistics and genotype frequency of study subjects
| Hypertensive pregnant case (n = 122) | Normotensive pregnant control (n = 80) | P-value | |
| Age (Yr) | 30.55 ± 8.05 | 29.13 ± 10.19 | 0.054 |
| Weight (kg) | 77.56 ± 16.88 | 69.24 ± 11.07 | 0.025 |
| Body Fat % | 35.138 ± 4.29 | 25.01 ± 8.28 | 0.000 |
| Waist circumference (cm) | 104.50 ± 12.09 | 86.92 ± 12.03 | 0.000 |
| Systolic blood pressure (mmHg) | 131.76 ± 13.04 | 122.02 ± 8.27 | 0.000 |
| Diastolic blood pressure (mmHg) | 85.88 ± 8.45 | 73.31 ± 11.27 | 0.000 |
| Walk | |||
| None | 90.1% | 17.7% | 0.000 |
| 30 min/3 days week | 7.9% | 74.2% | |
| 30 min/5 days week | 2.0% | 8.1% | |
| Genotype frequency | |||
| EGFR rs17337023 polymorphism | |||
| AA | 30 | 19 | 0.079 |
| AT | 56 | 48 | |
| TT | 36 | 13 | |
| Allele Odds Ratio | |||
| Allele A | 1.282 [0.860-1.912] | 0.219 | |
| Allele T | 0.780 [0.523-1.163] | 0.221 | |
- Citation: Martins RS, Ahmed T, Farhat S, Shahid S, Fatima SS. Epidermal growth factor receptor rs17337023 polymorphism in hypertensive gestational diabetic women: A pilot study. World J Diabetes 2019; 10(7): 396-402
- URL: https://www.wjgnet.com/1948-9358/full/v10/i7/396.htm
- DOI: https://dx.doi.org/10.4239/wjd.v10.i7.396
