BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Diabetes. May 15, 2025; 16(5): 102994
Published online May 15, 2025. doi: 10.4239/wjd.v16.i5.102994
TERT/FOXO1 signaling promotes islet β-cell dysfunction in type 2 diabetes mellitus by regulating ATG9A-mediated autophagy
Xiao-Tian Lei, Sheng Qiu, Gang-Yi Yang, Department of Endocrinology, The Second Affiliated Hospital of Chongqing Medical University, Chongqing 402360, China
Xiang-Fen Chen, Jia-Ying Tang, Shan Geng, Qi-Nan Wu, Department of Endocrinology, The Affiliated Dazu’s Hospital of Chongqing Medical University, The People's Hospital of Dazu, Chongqing 402360, China
ORCID number: Qi-Nan Wu (0009-0000-7001-4836).
Co-first authors: Xiao-Tian Lei and Xiang-Fen Chen.
Co-corresponding authors: Gang-Yi Yang and Qi-Nan Wu.
Author contributions: Lei XT conducted the animal experiments; Chen XF and Wu QN performed mechanistic studies; Yang GY and Wu QN analyzed data; Tang JY, Qiu S and Geng S contributed to technical assistance and discussion; Geng S provided research material and technical assistance; Lei XT, Chen XF and Qiu S wrote, reviewed, and edited the manuscript; Wu QN, Yang GY, Chen XF designed directed the project, and contributed to the discussion; Yang GY, Wu QN are the guarantors of this work and, as such, had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Lei XT and Chen XF contributed equally to this work as co-first authors. In our study, the two corresponding authors have made equal contributions at critical stages. Professor Wu played a significant role in the writing and revision of the manuscript, ensuring the clarity of the research findings and the logical rigor, thereby enhancing the overall academic quality of the article. Professor Yang provided crucial guidance in experimental design, data collection, and quality control, ensuring the reliability and scientific validity of the experimental data. The expertise and contributions of the two corresponding authors complemented each other, and their work guaranteed the successful publication of the article. Therefore, it is both reasonable and necessary to list both as corresponding authors, which also serves as an acknowledgment of their respective contributions and aligns with the conventions of academic publishing.
Supported by National Natural Science Foundation of China, No. 82000792; General Project of Chongqing Natural Science Foundation, No. CSTB2023NSCQ-MSX0246 and No. CSTB2022NSCQ-MSX1271; Research Project of the State Administration of Traditional Chinese Medicine on Collaborative Chronic Disease Management of Traditional Chinese Medicine and Western Medicine, No. CXZH2024087; and Science and Health Joint Project of Dazu District Science and Technology Bureau, No. DZKJ2024JSYJ-KWXM1002.
Institutional review board statement: This study and experimental procedures were approved by the Medical Ethics Committee of the Affiliated Dazu’s Hospital of Chongqing Medical University (approval no .2024LLSC126).
Institutional animal care and use committee statement: The research proposal and materials comply with the principles of medical ethics and the requirements of the Helsinki Declaration. The research design has scientific basis, and the selected animal species, grades, quantities, and specifications are appropriate. During the experiment, animals were treated with kindness, anesthesia and analgesia were administered, euthanasia was performed after the experiment, and the animals were treated harmlessly after death without causing any harm to the environment. The experiment complied with ethical standards for animal experimentation.
Conflict-of-interest statement: The authors have no conflicts of interest.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: All the data and materials that are required to reproduce these findings can be shared by contacting the corresponding author, the email: 152299@hospital.cqmu.edu.cn.
Corresponding author: Qi-Nan Wu, MD, PhD, Professor, Chief Physician, Department of Endocrinology, The Affiliated Dazu’s Hospital of Chongqing Medical University, The People's Hospital of Dazu, No. 1073 Second Ring Road, Dazu District, Chongqing 402360, China. 152299@hospital.cqmu.edu.cn
Received: November 5, 2024
Revised: February 9, 2025
Accepted: March 19, 2025
Published online: May 15, 2025
Processing time: 172 Days and 4.6 Hours

Abstract
BACKGROUND

Type 2 diabetes mellitus (T2DM) is a severe global health problem that causes prolonged disease exposure and an elevated risk for chronic complications, posing a substantial health burden. Although therapies, such as GLP-1 receptor agonists and SGLT2 inhibitors, have been successfully developed, new therapeutic options are still expected to offer better blood glucose control and decrease complications.

AIM

To elucidate the mechanism by which TERT/FOXO1 affects high glucose (HG)-induced dysfunction in islet β-cells via the regulation of ATG9A-mediated autophagy.

METHODS

High-fat diet (HFD)-fed/streptozotocin (STZ)-treated mice or HG-treated MIN6 cells were used to establish T2DM models. Fasting blood glucose (FBG) and insulin levels in mice, as well as morphological changes in islet tissues, were assessed. Cell proliferation and the apoptosis rate were measured via EdU assays and flow cytometry, respectively. The expression levels of TERT, FOXO1, ATG9A and autophagy-related proteins (LC3B, p62) were analyzed via western blotting. The relationship between FOXO1 and ATG9A was assessed using dual-luciferase reporter gene assays and ChIP assays.

RESULTS

T2DM modeling in HFD-fed/STZ-treated mice and HG-treated MIN6 cells led to elevated TERT and FOXO1 expression and reduced ATG9A expression. Mice with T2DM were found to have decreased body weight, worsened morphology, elevated FBG and suppressed insulin levels. HG-treated MIN6 cells presented decreased viability and LC3B expression, in addition to increased p62 expression and apoptosis rates. FOXO1 knockdown both in vitro and in vivo protected mice and cells against islet β-cell dysfunction via the activation of autophagy. The molecular mechanism involved the suppression of ATG9A expression by TERT through FOXO1 transcription activation.

CONCLUSION

Our results suggested that TERT/FOXO1 inhibits ATG9A expression to decrease islet β-cell function in T2DM.

Key Words: TERT; ATG9A; Autophagy; Islet β-cells; Type 2 diabetes mellitus

Core Tip: Our research elucidated the mechanism by which TERT/FOXO1 affects high glucose-induced dysfunction in islet β-cells via the regulation of ATG9A-mediated autophagy. It revealed the mechanism by which TERT/FOXO1 mediates ATG9A to inhibit autophagy in mouse’s β cells. These findings indicated that FOXO1 is a potential target for the treatment of type 2 diabetes mellitus (T2DM) by acting as an autophagy regulator, deepening the understanding of the autophagy mechanisms involved in the regulation of β-cell function in the context of T2DM.



INTRODUCTION

The release of insulin by islet β-cells and glucagon by α-cells, which are critical for blood glucose regulation, can be controlled through metabolic, endocrine, and paracrine regulation; however, deregulation causes a series of pathologies, most notably type 2 diabetes mellitus (T2DM)[1]. T2DM is a severe global health issue that manifests as β-cell failure with reduced insulin production and peripheral insulin resistance[2,3] and is often associated with microvascular complications (such as retinopathy) and macrovascular complications (such as cardiovascular disorders)[4]. Young-onset T2DM is a substantially increasing issue that affects more individuals of working age and causes prolonged disease exposure and elevated risk for chronic complications, posing a substantial health burden[5]. Although therapies, such as GLP-1 receptor agonists and SGLT2 inhibitors, have been successfully developed, new therapeutic options are still expected to offer better blood glucose control and decrease complications[6]. Additionally, increasing the availability and improving the accuracy and utility of genomic and clinical biomarkers will contribute to the development of precision medicine[7].

The length of telomeres, an indicator of DNA damage, is related to cardiovascular disorders, diabetes, and tumors[8]. Additionally, the deregulation of the telomere–telomerase system is implicated in both diabetes and associated vascular complications[9]. In the event of oxidative stress, TERT, a telomerase catalytic subunit, attenuates reactive oxygen species generation and improves telomere function, exerting antioxidative effects; however, telomere attrition together with mitochondrial impairment eventually initiates age-associated diseases, including T2DM[10]. Single nucleotide polymorphisms in genes such as TERT and TRF2 are highly linked to telomere attrition in T2DM[11]. FOXO1 plays an important role in β-cell replication and neogenesis as well as a protective function against oxidative stress in β-cells[12]. FOXO1 participates in the regulation of hepatic glucose generation, and FOXO1 inhibition and FGF21 synergistically normalize glucose control in mice with diabetes[13]. A recent study demonstrated the regulation of FOXO1 transcription by TERT in cancer[14]. Thus, TERT may regulate FOXO1 transcription to affect β-cell function.

Autophagy plays an important role in cellular metabolism. The impairment of autophagy leads to the loss and apoptosis of β-cells, eventually stimulating the onset and progression of diabetes[15], and modulating islet β-cell autophagy holds promise in the treatment of diabetes[16]. ATG9A is known as a core autophagy protein that contributes to the growth of autophagosomes[17,18]. On the basis of the above information, we speculate that ATG9A-mediated autophagy is involved in the regulatory roles of TERT/FOXO1 in β-cell function. In this study, we revealed the mechanism by which TERT/FOXO1 inhibits ATG9A expression to impair islet β-cell function in T2DM, providing a new theoretical basis for the treatment of T2DM.

MATERIALS AND METHODS
Ethics approval

The experimental design for C57BL/6 mice (8 weeks, male) was approved by the ethics committee of The Affiliated Dazu Hospital of Chongqing Medical University (Number: 2024 LLSC126), and all in vivo experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health. Mice were purchased from Hunan SJA Laboratory Animal Co., Ltd. (Changsha, China) and housed in SPF cages. The temperature of the cages was controlled at 21-25 °C, and the mice were housed under SPF conditions and a 12 hours/12 hours light/dark environment. All the mice had free access to water and food.

T2DM modeling

Before the T2DM model[19] was established, the mice were adaptively fed for one week. The mice in the model groups were further divided into an sh-FOXO1 group and an sh-NC group; 10 μL of sh-FOXO1 or sh-NC lentiviral vectors was injected into the tail vein of the mice 20 days before euthanasia. Twenty mice were fed a high-fat diet (HFD) for 4 weeks, followed by 5 days of intraperitoneal injection of streptozotocin (STZ, 0.1 mol/L citric acid solution and 0.1 mol/L sodium citrate solution at a ratio of 1.32: 1, pH 4.0-4.5, 40 mg/kg). The glucose level of each mouse on the third day after STZ injection was randomly measured using a BIONIME GM300 glucose meter (100145, Beijing, China). A mouse with a glucose level above 16.7 mmol/L was considered to have T2DM. The weight of the mice was also measured, and the insulin level was measured using a mouse insulin ELISA kit (JL11459, J&L Biological, Shanghai, China). The mice in the control group were fed standard chow and intraperitoneally injected with citrate-phosphate buffer.

H&E staining

Pancreas tissues were fixed for 48 hours in 4% polyformaldehyde, dehydrated, embedded and cut into 5 μm thick sections. Then, the sections were routinely hydrated using gradient ethanol, cleared, washed with deionized water and stained with hematoxylin for 3-5 minutes. Then, the sections were differentiated with 1% hydrochloric acid alcohol for 20 seconds and 1% ammonia for 30 seconds, washed, stained with l% eosin solution for 5 minutes, and washed. The sections were hydrated, cleared, dried and sealed before being observed and photographed under a microscope (Olympus, IX50, Tokyo, Japan).

Immunohistochemistry

Sections were dewaxed and hydrated before antigen repair and blocked in goat serum for 30 minutes. The sections were incubated with an anti-insulin antibody (ab181547, Abcam, 1:200) diluted in phosphate-buffered saline (PBS) overnight at 4 °C. After being washed with PBS 3 times, the sections were incubated with a secondary antibody at 37 °C for 30 minutes, after which the sections were incubated with DAB solution, stained with hematoxylin, hydrated, cleared and sealed. Images were captured under a microscope (Olympus, IX50, Tokyo, Japan).

Cell culture

MIN6 cells from the Cell Bank of the Chinese Academy of Science (Shanghai, China) were cultured in RPMI 1640 culture medium (Gibco, Grand Island, NY, United States) supplemented with 10% FBS, 10 mmol/L HEPES, 5.5 mmol/L glucose, 50 mmol/L b-mercaptoethanol, 100 mg/mL streptomycin and 100 U/mL penicillin in an incubator with 5% CO2 and 95% saturated humidity at 37 °C.

Reverse transcription quantitative polymerase chain reaction

Cells or tissues were collected for RNA extraction using an RNeasy Mini Kit (Qiagen, Valencia, CA, United States). A reverse transcription kit (Promega, Madison, WI) was used to obtain cDNA, and a SYBR® Premix Ex TaqTM II (Perfect Real Time) kit (DRR081, Takara, Tokyo, Japan) and a polymerase chain reaction (PCR) instrument (ABI 7500, ABI, Foster City, CA, United States) were used for reverse transcription quantitative PCR (RT-qPCR). Each reaction was performed in triplicate. Expression data were analyzed using the 2-ΔΔCt method, with GAPDH used as an internal control. The primer sequences are listed in Table 1.

Table 1 Primer sequences.
Genes
F (5'-3')
R (5'-3')
TERTCTGTGCCTACCAGGGGAGATGGCCTTGAGCCCAGAAAGAT
FOXO1CGGAAAATCACCCCGGAGAAGAGCTGGTTCGAGGACGAAA
ATG9ACTACCACGCATACTCACGCAGACATGTGACCCAGTCGGTT
GAPDHAGCCCAAGATGCCCTTCAGTCCGTGTTCCTACCCCCAATG
Western blot

Tissues or cells were lysed in RIPA buffer, and the protein concentration was measured using a BCA kit (Boster, Wuhan, China). The proteins were subsequently electrophoresed via 15% SDS-PAGE and transferred to PVDF membranes. The membranes were blocked with 5% powdered skim milk for 2 hours, and then, the membranes were incubated with primary antibodies against TERT, FOXO1, ATG9A, p62, LC3A/B and GAPDH (Supplementary Table 1) overnight at 4 °C. After being washed with TBST 5 times, the membranes were incubated with secondary antibody for 2 hours, followed by 3 washes (10 minutes each) with TBST and then incubation with ECL luminescent color developing fluid (P0018FS, Beyotime). The protein bands were observed, photographed and analyzed using ImageJ software, with GAPDH used as an internal control.

High glucose treatment of cells

MIN6 cells were seeded into a 60 mm culture dish at a density of 1 × 106 cells/mL and cultured at 37 °C with 5% CO2. Once the cells reached 90% confluence, the cells in the high glucose (HG) group were treated with 40 mmol/L glucose for 48 hours, and the cells in the control group were treated with 5.5 mmol/L glucose for 48 hours[20].

Cell transfection

A TERT overexpression vector (oe-TERT), ATG9A overexpression vector (oe-ATG9A), FOXO1 overexpression vector (oe-FOXO1) and their negative controls (oe-NC), as well as a FOXO1 suppression vector (sh-FOXO1, sequence: CATGGAC AACAACAGTAAATT), TERT suppression vector (sh-TERT, sequence: TTGAAGTGTCA CGGTCTATTT) and their negative controls (sh-NC), were purchased from HanBio (Shanghai, China). Lentiviruses were transfected into KEK293T cells for 48h, after which a p24 ELISA kit (Cell Biolabs, Inc., San Diego, United States) was used to measure the viral titer (1 × 109 TU/mL). MIN6 cells were subsequently infected with lentiviral vectors for 48 h before stably transfected cell lines were selected using puromycin (P8230, Beijing Solarbio Science & Technology Co., Ltd.). The transfection efficiency was assessed by western blotting and RT-qPCR.

EdU assay

Cells (5 × 103 cells per well) were seeded into a 96-well plate and treated with diluted EdU solution (1 mL) at 37 °C for 12 hours. Then, the solution was removed, and the cells were washed with PBS three times. The cells were then incubated with glycine solution (2 mg/mL, 150 μL/well) for 5 minutes, followed by 3 washes with PBS and treatment with 0.5% Triton X-100 solution for 10 min (200 μL/well). After washing with PBS, the cells were incubated with 200 μL of Hoagland’s solution per well for 30 minutes without light exposure. The cells were washed with Triton X-100 solution three times (10 minutes each), and the nuclei were stained with DAPI for 30 minutes. After washing with PBS twice, the cells were observed under a fluorescence microscope (Olympus Corporation, Japan), with three fields randomly selected for each well. The percentage of EdU-positive cells = the number of EdU-positive cells/total number of cells × 100%.

Flow cytometry

Digested cells were centrifuged and resuspended in binding buffer before they were incubated with 5 μL of Annexin V-FITC and PI from an Annexin V-FITC kit (Beyotime) for 15 minutes. The cell apoptosis rate was determined via flow cytometry (Beckman, United States). Each experiment was repeated three times.

ELISA

The insulin level in the supernatant from cells or mouse blood was measured as previously described[21,22] using an ELISA kit (JL11459, Jianglaibio, Shanghai, China).

Dual-luciferase reporter gene assay

JASPAR (http://jaspar.genereg.net/) was used to predict the binding sites of FOXO1 with ATG9A. On the basis of the prediction, the wild-type sequence (wt) and a mutant sequence (mut) were designed and synthesized before insertion into PGL3-Promotor for cotransfection with sh-FOXO1 or sh-NC into MIN6 cells. After transfection, the luciferase intensity was measured using a dual-luciferase reporter gene kit (Promega, Madison, WI, United States) and photometers (Turner BioSystems, United States).

ChIP assay

The reagents for the ChIP assays were obtained from an EZ-Magna ChIP TMA kit (17-10086, Millipore, United States). MIN6 cells in the logarithmic growth phase were covered with 1% formaldehyde for crosslinking, and after 10 minutes later, the formaldehyde was removed and replaced with 125 mmol/L glycine to terminate crosslinking. The cells were washed with PBS, centrifuged and suspended in lysis buffer containing protease inhibitors such that the cell concentration was 2 × 106 cells/200 μL. The cells were centrifuged at 5000 × g for 5 minutes and subsequently resuspended in nuclear isolation buffer and placed in ice water for 10 minutes before sonication to generate 200-1000 bp chromatin fragments. After centrifugation (14000 × g, 4 °C for 10 minutes), 100 μL of the supernatant (DNA fragment) from each group was reacted with 900 μL of ChIP dilution buffer and 20 μL of 50 × PIC, followed by mixing and rotation with 60 μL of protein A agarose/salmon sperm DNA mixture at 4 °C for 10 minutes. After centrifugation (700 × g for 1 minute), 20 μL of the supernatant was used as the input. The supernatant in the experimental group was reacted with 1 μL of an anti-FOXO1 antibody (MA5-17078, 1:100, Thermo Fisher), whereas in the control group, the supernatant was reacted with 1 μL of an anti-IgG antibody (ab172730, 1:100, Abcam). Then, 60 μL of protein A agarose/salmon sperm DNA mixture was added to each tube, followed by rotation at 4 °C for 2 hours. The mixture was incubated for 10 minutes and then centrifuged, after which the supernatant was discarded. The precipitates were washed with l mL of low-salt buffer, high-salt buffer, LiCl solution or TE solution (twice) before being eluted twice with 250 μL of ChIP wash buffer and decrosslinked with 20 μL of 5 M NaCl. The DNA was collected, and the enriched chromatin fragments were analyzed via RT-qPCR.

Statistical analysis

GraphPad Prism 8 was used for data analyses, and the data are expressed as the mean ± SD. Data between two groups were analyzed using an unpaired t test, whereas data among multiple groups were analyzed using one-way ANOVA with Tukey’s multiple comparisons test as a post hoc analysis. Statistical significance was set at P < 0.05.

RESULTS
Deregulated expression of TERT, FOXO1 and ATG9A in mice with T2DM

After establishing a T2DM mouse model (STZ/HFD group), the established models were assessed for weight, fasting blood glucose (FBG) level, and plasma insulin level. Compared with those in the control group, the mice in the STZ/HFD group had lower body weights and plasma insulin levels but higher FBG levels (Figure 1A-C). H&E staining revealed that the islets of the mice in the control group were ellipsoid shaped with clear boundaries and an even distribution of cells, whereas the islets of the mice in the STZ/HFD group were atrophic with unclear boundaries and swollen cells (Figure 1D). Immunohistochemistry (IHC) was used to assess insulin levels in islet tissues and revealed that mice in the STZ/HFD group had lower insulin levels than did those in the control group (Figure 1E). The expression of TERT, FOXO1 and ATG9A in mouse pancreatic tissues was assessed via RT-qPCR and western blotting. Figure 1F and G shows elevated expression of TERT and FOXO1 and reduced expression of ATG9A in the mice in the STZ/HFD group. HG-treated MIN6 cells were also evaluated for TERT, FOXO1 and ATG9A expression, and the results were consistent with those of the in vivo experiments (Supplementary Figure 1). Pearson correlation analysis revealed that FOXO1 expression in islet tissues was positively correlated with that of TERT but negatively correlated with that of ATG9A (Figure 1H). The above results suggested that TERT, FOXO1 and ATG9A expression in the islet tissues of T2DM mice was deregulated.

Figure 1
Figure 1 Altered expression of TERT, FOXO1 and ATG9A was found in the pancreatic tissues of type 2 diabetes mellitus model mice. A type 2 diabetes mellitus model was generated by feeding mice a high-fat diet and administering intraperitoneal injections of streptozotocin. A and B: Mouse body weight and fasting blood glucose; C: Plasma insulin levels were measured using ELISAs; D: H&E staining was used to assess morphological changes in islet tissues (× 200); E: Immunohistochemistry was used to assess changes in insulin levels(× 400); F and G: TERT, FOXO1 and ATG9A mRNA and protein expression levels were analyzed via reverse transcription quantitative polymerase chain reaction and western blotting; H: Pearson correlation analysis was used to determine the correlations among TERT, FOXO1 and ATG9A. The data are expressed as mean ± SD. n = 10 for in vivo experiments. aP < 0.05 vs control group, bP < 0.01 vs control group. FBG: Fasting blood glucose; HFD: High-fat diet; STZ: Streptozotocin.
FOXO1 knockdown protects β-cells against HG-induced dysfunction by activating autophagy

To elucidate the function of FOXO1 in islet β-cells, we transfected sh-FOXO1 into MIN6 cells (Figure 2A and B). Subsequent assessments of cell viability and apoptosis revealed that, compared with those in the control group, the cells in the HG group exhibited lower cell viability and higher apoptosis rates; cells in the sh-FOXO1 group exhibited higher viability and lower apoptosis rates than those observed for cells in the sh-NC group (Figure 2C and D). Insulin levels, as determined by ELISAs, revealed that insulin levels were lower in the HG group and greater in the sh-FOXO1 group than in the control and sh-NC groups, respectively (Figure 2E). Considering the negative correlation between FOXO1 and the autophagy protein ATG9A, as well as the vital role of autophagy in the dysfunction of islet β-cells[23], we measured the expression of the autophagy proteins LC3B and p62. In vitro experiments revealed suppressed LC3B expression and increased p62 expression in cells in the HG group, supporting the findings of the in vivo experiments (Supplementary Figure 2). Compared with cells transfected with sh-FOXO1, those transfected with sh-FOXO1 presented increased LC3B expression and reduced p62 expression (Figure 2F), suggesting that FOXO1 may regulate autophagy to mediate islet β-cell dysfunction. MIN6 cells were treated with a combination of the autophagy inhibitor 3-MA (2 mmol/L)[24] and sh-FOXO1. Combined treatment with 3-MA reversed the promoting effect of sh-FOXO1 on β-cell autophagy (Figure 2). These results indicate that FOXO1 knockdown can activate autophagy to protect β-cells against HG-induced dysfunction.

Figure 2
Figure 2 FOXO1 knockdown activates autophagy to protect β-cells against high glucose-induced dysfunction. sh-FOXO1 and/or the autophagy inhibitor 3-MA were used to treat high glucose-treated MIN6 cells. A and B: Reverse transcription quantitative polymerase chain reaction and western blotting were used to analyze FOXO1 mRNA and protein expression; C: EdU staining was used to analyze cell proliferation ability (red staining: the labeled proliferating cells, blue staining: the nuclei); D: Flow cytometry was used to assess the cell apoptosis rate; E: Insulin levels were measured via ELISA; F: The expression of the autophagy proteins LC3B and p62 was analyzed via western blotting. The data are expressed as mean ± SD. Each experiment was conducted in triplicate. aP < 0.05 vs control group, bP < 0.05 vs control group, cP < 0.05 vs HG + sh-NC group, dP < 0.05 vs HG + sh-FOXO1 group. HG: High glucose.
FOXO1 knockdown attenuates disease progression in mice with T2DM

The effect of FOXO1 knockdown on T2DM disease progression was observed in mice. Compared with that in the islet tissue of mice in the STZ/HFD + sh-NC group, FOXO1 expression in the islet tissue of mice in the STZ/HFD+sh-FOXO1 group was lower (Figure 3A and B). Compared with those in the STZ/HFD + sh-NC group, the T2DM mice in the STZ/HFD + sh-FOXO1 group weighed more, had higher insulin levels and had lower FBG levels (Figure 3C-E). H&E staining and immunohistochemical staining revealed that the islet morphology and insulin secretion of the mice in the STZ/HFD + sh-FOXO1 group improved (Figure 3F and G). Compared with those in the STZ/HFD + sh-NC group, LC3B protein expression was higher and p62 protein expression was lower in the islet tissue of mice in the STZ/HFD + sh-FOXO1 group, as determined by western blots (Figure 3H).

Figure 3
Figure 3 FOXO1 knockdown suppresses type 2 diabetes mellitus progression in mice. sh-FOXO1 was injected into type 2 diabetes mellitus mice. A and B: FOXO1 mRNA and protein expression was analyzed via reverse transcription quantitative polymerase chain reaction and western blot; C and D: Body weight and fasting blood glucose; E: Insulin levels were measured via ELISAs; F: Morphology of islet tissues via H&E staining (× 200); G: Insulin levels were analyzed via immunohistochemistry (× 200); H: Western blotting was used to assess the expression of LC3B and p62. The data are expressed as means ± SD. n = 10 for in vivo experiments. aP < 0.05 vs STZ/HFD + sh-NC group, bP < 0.01 vs STZ/HFD + sh-NC group. FBG: Fasting blood glucose; HFD: High-fat diet; STZ: Streptozotocin.
TERT activates FOXO1 transcription to inhibit ATG9A expression

We used the JASPAR database to predict FOXO1 binding sites, and the result indicated that FOXO1 binds to the promoter of the autophagy-related protein ATG9A (Figure 4A). We then hypothesized that TERT activates FOXO1 transcription to increase FOXO1 expression and that FOXO1 overexpression can inhibit ATG9A expression. The binding of FOXO1 with ATG9A was verified by a ChIP assay (Figure 4B), and luciferase reporter gene assays revealed that, compared with sh-NC, sh-FOXO1 significantly increased the luciferase activity of wt-ATG9A but not that of mut-ATG9A (Figure 4C). ATG9A protein expression level decreased in HG-treated MIN6 cells after sh-ATG9A transfection (Supplementary Figure 3). The expression of TERT and FOXO1 decreased and that of ATG9A increased in cells after sh-TERT or sh-ATG9A transfection, whereas cotransfection of sh-TERT and sh-ATG9A led to suppressed ATG9A expression but had no significant effect on TERT or FOXO1 expression compared with that in cells transfected with sh-TERT alone (Figure 4D and E). These results indicate that TERT can activate FOXO1 transcription to suppress ATG9A to mediate islet β-cell dysfunction.

Figure 4
Figure 4 TERT activates FOXO1 transcription to inhibit ATG9A expression. A: JASPAR was used to analyze the binding of FOXO1 to the ATG9A promoter; B and C: Dual-luciferase reporter gene and ChIP assays were used to verify the targeting of FOXO1 to ATG9A; D and E: Reverse transcription quantitative polymerase chain reaction and western blotting were used to analyze the expression of TERT, FOXO1 and ATG9A in cells after the cells were transfected with sh-TERT or/and sh-ATG9A. The data are expressed as mean ± SD. Each experiment was conducted in triplicate. aP < 0.05 vs sh-NC, IgG, and NC groups, bP < 0.05 vs sh-NC, IgG, and NC groups, cP < 0.05 vs sh-TERT + sh-NC group. HG: High glucose.
The TERT/FOXO1 axis mediates HG-induced islet β-cell dysfunction via ATG9A-mediated autophagy

Oe-ATG9A was transfected or cotransfected with oe-TERT and oe-FOXO1 into HG-treated cells. Compared with those in the NC group, the ATG9A expression in cells transfected with oe-ATG9A was greater, but no significant change in TERT or FOXO1 expression was detected. Compared with oe-ATG9A transfection alone, the cotransfection with oe-ATG9A and oe-TERT led to higher TERT and FOXO1 expression and lower ATG9A expression. Cells cotransfected with oe-ATG9A and oe-FOXO1 presented elevated FOXO1 expression and suppressed ATG9A expression, whereas no difference in TERT expression was detected (Figure 5A and B). Compared with the NC, oe-ATG9A alone increased cell viability, insulin levels and LC3B expression but also suppressed cell apoptosis and reduced p62 expression (Figure 5C-F). Furthermore, transfection with oe-TERT or oe-FOXO1 abolished the promoting effect of oe-ATG9A on islet β-cell dysfunction and autophagy (Figure 5). These results suggest that the TERT/FOXO1 axis suppresses ATG9A-mediated autophagy to induce islet β-cell dysfunction.

Figure 5
Figure 5 TERT/FOXO1 suppresses ATG9A-mediated autophagy to increase high glucose-induced islet β-cell dysfunction. oe-ATG9A was transfected or cotransfected with oe-TERT and oe-FOXO1 into high glucose-treated MIN6 cells. A and B: Reverse transcription quantitative polymerase chain reaction and western blotting were used to analyze TERT, FOXO1 and ATG9A mRNA and protein expression; C: EdU staining was used to analyze cell proliferation ability (red staining: the labeled proliferating cells, blue staining: the nuclei); D: Flow cytometry was used to assess the cell apoptosis rate; E: Insulin levels were measured via ELISAs; F: The expression of the autophagy proteins LC3B and p62 was analyzed via western blotting. The data are expressed as mean ± SD. Each experiment was conducted in triplicate. aP < 0.05 vs NC group, bP < 0.05 vs NC group, cP < 0.05 vs the oe-ATG9A group. NS: No significance; HG: High glucose.
DISCUSSION

Autophagy is an important biological process involved in maintaining the function and survival of β-cells[25]. In this study, the level of the autophagy protein ATG9A was markedly reduced in the islet tissues of mice exposed to STZ/HFD. Moreover, our study experimentally revealed that the suppression of FOXO1 activated autophagy to protect β-cells against HG-induced dysfunction, potentially through the activation of ATG9A-dependent autophagy. Furthermore, TERT induced the transcription of FOXO1 to suppress ATG9A and thus impair the autophagy of β-cells, resulting in β-cell dysfunction (Figure 6).

Figure 6
Figure 6 Par-4/TET/FOXO1 and autophagy dysfunction/apoptosis of islet β cells. Par-4 inhibits TERT interact with FOXO1 after nuclear entry, suppresses its expression at the transcriptional level, induces autophagy dysfunction, and leads to islet β cell apoptosis.

FOXO1 was abundantly expressed in the context of T2DM, and FOXO1 expression was inversely related to ATG9A expression in the pancreatic tissues of STZ-treated/HFD-fed mice. The shRNA-mediated silencing of FOXO1 effectively attenuated the apoptosis of β-cells but increased their survival potential and promoted the autophagy mediated by ATG9A. FOXO1, a transcription factor that participates in gluconeogenesis and glycogenolysis, has been proposed as a therapeutic target in traditional Chinese medicine for the treatment of diabetes[26]; it can also serve as a therapeutic target for obesity and obesity-related T2DM[27]. The pharmacological FOXO1 inhibitor AS1842856 has been shown to relieve T2DM-associated diastolic dysfunction while promoting glucose oxidation in diabetic C57BL/6J mice[28]. Furthermore, compound 10, which can target FOXO1, has been shown to have a glucose-lowering effect on insulin-resistant diabetic mice by increasing insulin sensitivity and improving β-cell function[13]. Studies have suggested that FOXO1 may serve as a decisive mediator of autophagy[29,30]. Moreover, FOXO1-mediated autophagy plays a protective role in β-cell survival under hypoxic conditions[31]. In this study, our animal experiments revealed that FOXO1 knockdown increased the body weight and plasma insulin level of STZ-treated/HFD-fed mice, with an increase in the level of the autophagy marker LC3B and a reduction in the level of the autophagy marker p62 in pancreatic tissues. These findings confirmed the proautophagic role of FOXO1 knockdown in T2DM. Recently, FOXO1 has been proposed to interact with ATG genes, such as ATG7, to mediate autophagy[32]. ATG9A acts as a scramblase that is involved in phagophore expansion in the early phase of autophagy by transferring phospholipids between liposome leaflets[33]; its trafficking function is a critical mechanism for autophagosome formation and is thus involved in the process of autophagy induction[34]. In this study, we FOXO1 was predicted to bind to the promoter of ATG9A, and this interaction was validated using luciferase and ChIP assays. The results of our study suggest that FOXO1 interacts with ATG9A and that FOXO1 knockdown activates protective autophagy to reverse the deregulation of β-cell function by inhibiting ATG9A expression.

The results of our research further suggested that TERT was positively related to FOXO1, the expression of which was significantly increased in the islet β-cells of diabetic mice. The interaction between TERT and FOXO1, which is involved in tumor proliferation and therapeutic response, has been reported in a previous study[14]. T2DM patients have shortened telomeres of β-cells[35], and telomere attrition in islet β-cells is involved in the pathophysiology of T2DM by impairing cell survival and insulin secretion and accelerating cell death[36]. hTERC, hTEP1, dyskerin, and human TERT consist of telomerase subunits. The transcription of TERT is essential for the enzymatic activity of telomerase[37]. TERT, a core part of telomerase, can increase telomerase activity and participates in the regulation of cell death[38]. A previous study suggested a regulatory function of TERT in the insulin-insensitive pathway in human and mouse glucose uptake[39]. In the present study, TERT overexpression reversed the promoting effects of ATG9A on β-cell function and autophagy. Our results suggest that TERT/FOXO1 regulates ATG9A-dependent autophagy, leading to HG-induced β-cell dysfunction.

It is worth noting that previous studies on the effect of FOXO1 on autophagy in different organs or cells have drawn varying conclusions. The expression levels of pFOXO1 and p62 were significantly elevated in the renal tissues of diabetic rats, Conversely, the expression levels of LC3B and Beclin1 were markedly reduced[40]. HG stimulation leads to overactive autophagy flux and increased nuclear translocation of FoxO1 in cardiomyocytes[41]. Acetylated FoxO1 interacts with endogenous ATG7 and induces autophagy and suppresses cell viability in cancer cells[42]. Consequently, the influence of FOXO1 on autophagy is multifaceted and may vary depending on specific disease states, cell types, experimental conditions, or distinct signaling pathways.

CONCLUSION

Taken together, our research revealed the mechanism by which TERT/FOXO1 mediates ATG9A to inhibit autophagy in mouse β cells. These findings indicate that FOXO1 is a potential target for the treatment of T2DM by acting as an autophagy regulator, deepening the understanding of the autophagy mechanisms involved in the regulation of β-cell function in the context of T2DM. Nevertheless, the effects and mechanisms of FOXO1 on autophagy warrant in-depth investigation, and additional studies are essential to elucidate the regulation of autophagy-related proteins. In addition, further validation is needed to assess whether TERT/FOXO1 signaling regulation of ATG9A expression affects autophagy and islet function in human diabetic patients.

References
1.  Campbell JE, Newgard CB. Mechanisms controlling pancreatic islet cell function in insulin secretion. Nat Rev Mol Cell Biol. 2021;22:142-158.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 521]  [Cited by in RCA: 428]  [Article Influence: 85.6]  [Reference Citation Analysis (1)]
2.  Halban PA, Polonsky KS, Bowden DW, Hawkins MA, Ling C, Mather KJ, Powers AC, Rhodes CJ, Sussel L, Weir GC. β-cell failure in type 2 diabetes: postulated mechanisms and prospects for prevention and treatment. Diabetes Care. 2014;37:1751-1758.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 417]  [Cited by in RCA: 376]  [Article Influence: 31.3]  [Reference Citation Analysis (0)]
3.  White MG, Shaw JA, Taylor R. Type 2 Diabetes: The Pathologic Basis of Reversible β-Cell Dysfunction. Diabetes Care. 2016;39:2080-2088.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 148]  [Cited by in RCA: 135]  [Article Influence: 13.5]  [Reference Citation Analysis (0)]
4.  DeFronzo RA, Ferrannini E, Groop L, Henry RR, Herman WH, Holst JJ, Hu FB, Kahn CR, Raz I, Shulman GI, Simonson DC, Testa MA, Weiss R. Type 2 diabetes mellitus. Nat Rev Dis Primers. 2015;1:15019.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1901]  [Cited by in RCA: 1504]  [Article Influence: 136.7]  [Reference Citation Analysis (3)]
5.  Lascar N, Brown J, Pattison H, Barnett AH, Bailey CJ, Bellary S. Type 2 diabetes in adolescents and young adults. Lancet Diabetes Endocrinol. 2018;6:69-80.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 699]  [Cited by in RCA: 604]  [Article Influence: 75.5]  [Reference Citation Analysis (8)]
6.  Nauck MA, Wefers J, Meier JJ. Treatment of type 2 diabetes: challenges, hopes, and anticipated successes. Lancet Diabetes Endocrinol. 2021;9:525-544.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 264]  [Cited by in RCA: 207]  [Article Influence: 41.4]  [Reference Citation Analysis (4)]
7.  Gloyn AL, Drucker DJ. Precision medicine in the management of type 2 diabetes. Lancet Diabetes Endocrinol. 2018;6:891-900.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 162]  [Cited by in RCA: 118]  [Article Influence: 14.8]  [Reference Citation Analysis (0)]
8.  Cheng F, Carroll L, Joglekar MV, Januszewski AS, Wong KK, Hardikar AA, Jenkins AJ, Ma RCW. Diabetes, metabolic disease, and telomere length. Lancet Diabetes Endocrinol. 2021;9:117-126.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 168]  [Cited by in RCA: 147]  [Article Influence: 29.4]  [Reference Citation Analysis (0)]
9.  Qi Nan W, Ling Z, Bing C. The influence of the telomere-telomerase system on diabetes mellitus and its vascular complications. Expert Opin Ther Targets. 2015;19:849-864.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 41]  [Cited by in RCA: 35]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
10.  Gao X, Yu X, Zhang C, Wang Y, Sun Y, Sun H, Zhang H, Shi Y, He X. Telomeres and Mitochondrial Metabolism: Implications for Cellular Senescence and Age-related Diseases. Stem Cell Rev Rep. 2022;18:2315-2327.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 144]  [Cited by in RCA: 124]  [Article Influence: 31.0]  [Reference Citation Analysis (0)]
11.  Sethi I, Bhat GR, Singh V, Kumar R, Bhanwer AJ, Bamezai RN, Sharma S, Rai E. Role of telomeres and associated maintenance genes in Type 2 Diabetes Mellitus: A review. Diabetes Res Clin Pract. 2016;122:92-100.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 37]  [Cited by in RCA: 31]  [Article Influence: 3.1]  [Reference Citation Analysis (0)]
12.  Kitamura T. The role of FOXO1 in β-cell failure and type 2 diabetes mellitus. Nat Rev Endocrinol. 2013;9:615-623.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 193]  [Cited by in RCA: 180]  [Article Influence: 13.8]  [Reference Citation Analysis (3)]
13.  Lee YK, Diaz B, Deroose M, Lee SX, Belvedere S, Accili D, Leibel RL, Lin HV. FOXO1 inhibition synergizes with FGF21 to normalize glucose control in diabetic mice. Mol Metab. 2021;49:101187.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 25]  [Cited by in RCA: 21]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
14.  Batsios G, Taglang C, Tran M, Stevers N, Barger C, Gillespie AM, Ronen SM, Costello JF, Viswanath P. Deuterium Metabolic Imaging Reports on TERT Expression and Early Response to Therapy in Cancer. Clin Cancer Res. 2022;28:3526-3536.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 37]  [Cited by in RCA: 31]  [Article Influence: 7.8]  [Reference Citation Analysis (0)]
15.  Mohammadi-Motlagh HR, Sadeghalvad M, Yavari N, Primavera R, Soltani S, Chetty S, Ganguly A, Regmi S, Fløyel T, Kaur S, Mirza AH, Thakor AS, Pociot F, Yarani R. β Cell and Autophagy: What Do We Know? Biomolecules. 2023;13.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 22]  [Cited by in RCA: 18]  [Article Influence: 6.0]  [Reference Citation Analysis (0)]
16.  Lee YH, Kim J, Park K, Lee MS. β-cell autophagy: Mechanism and role in β-cell dysfunction. Mol Metab. 2019;27S:S92-S103.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 68]  [Cited by in RCA: 70]  [Article Influence: 10.0]  [Reference Citation Analysis (0)]
17.  Maeda S, Yamamoto H, Kinch LN, Garza CM, Takahashi S, Otomo C, Grishin NV, Forli S, Mizushima N, Otomo T. Structure, lipid scrambling activity and role in autophagosome formation of ATG9A. Nat Struct Mol Biol. 2020;27:1194-1201.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 295]  [Cited by in RCA: 254]  [Article Influence: 42.3]  [Reference Citation Analysis (0)]
18.  Judith D, Jefferies HBJ, Boeing S, Frith D, Snijders AP, Tooze SA. ATG9A shapes the forming autophagosome through Arfaptin 2 and phosphatidylinositol 4-kinase IIIβ. J Cell Biol. 2019;218:1634-1652.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 194]  [Cited by in RCA: 157]  [Article Influence: 22.4]  [Reference Citation Analysis (3)]
19.  Ma B, Wang X, Ren H, Li Y, Zhang H, Yang M, Li J. High glucose promotes the progression of colorectal cancer by activating the BMP4 signaling and inhibited by glucagon-like peptide-1 receptor agonist. BMC Cancer. 2023;23:594.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 29]  [Article Influence: 9.7]  [Reference Citation Analysis (0)]
20.  Cheng X, Huang Y, Yang P, Bu L. miR-383 ameliorates high glucose-induced β-cells apoptosis and hyperglycemia in high-fat induced diabetic mice. Life Sci. 2020;263:118571.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 13]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
21.  Wang RR, Qiu X, Pan R, Fu H, Zhang Z, Wang Q, Chen H, Wu QQ, Pan X, Zhou Y, Shan P, Wang S, Guo G, Zheng M, Zhu L, Meng ZX. Dietary intervention preserves β cell function in mice through CTCF-mediated transcriptional reprogramming. J Exp Med. 2022;219.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 50]  [Cited by in RCA: 42]  [Article Influence: 10.5]  [Reference Citation Analysis (0)]
22.  Cao Z, Yao F, Lang Y, Feng X. Elevated Circulating LINC-P21 Serves as a Diagnostic Biomarker of Type 2 Diabetes Mellitus and Regulates Pancreatic β-cell Function by Sponging miR-766-3p to Upregulate NR3C2. Exp Clin Endocrinol Diabetes. 2022;130:156-164.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 15]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
23.  Han M, Lu Y, Tao Y, Zhang X, Dai C, Zhang B, Xu H, Li J. Luteolin Protects Pancreatic β Cells against Apoptosis through Regulation of Autophagy and ROS Clearance. Pharmaceuticals (Basel). 2023;16.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 27]  [Cited by in RCA: 19]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
24.  Zhou J, Kang X, Luo Y, Yuan Y, Wu Y, Wang M, Liu D. Glibenclamide-Induced Autophagy Inhibits Its Insulin Secretion-Improving Function in β Cells. Int J Endocrinol. 2019;2019:1265175.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 11]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
25.  Marasco MR, Linnemann AK. β-Cell Autophagy in Diabetes Pathogenesis. Endocrinology. 2018;159:2127-2141.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 104]  [Cited by in RCA: 97]  [Article Influence: 12.1]  [Reference Citation Analysis (0)]
26.  Liu Y, Fu BM, Zeng Y. Targeting FoxO1 in traditional Chinese medicine for the treatment of diabetes. Cell Mol Biol (Noisy-le-grand). 2023;69:44-51.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 3]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
27.  Benchoula K, Arya A, Parhar IS, Hwa WE. FoxO1 signaling as a therapeutic target for type 2 diabetes and obesity. Eur J Pharmacol. 2021;891:173758.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 56]  [Cited by in RCA: 48]  [Article Influence: 9.6]  [Reference Citation Analysis (0)]
28.  Gopal K, Al Batran R, Altamimi TR, Greenwell AA, Saed CT, Tabatabaei Dakhili SA, Dimaano MTE, Zhang Y, Eaton F, Sutendra G, Ussher JR. FoxO1 inhibition alleviates type 2 diabetes-related diastolic dysfunction by increasing myocardial pyruvate dehydrogenase activity. Cell Rep. 2021;35:108935.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 64]  [Cited by in RCA: 58]  [Article Influence: 11.6]  [Reference Citation Analysis (0)]
29.  Zhang L, Zhang Z, Li C, Zhu T, Gao J, Zhou H, Zheng Y, Chang Q, Wang M, Wu J, Ran L, Wu Y, Miao H, Zou X, Liang B. S100A11 Promotes Liver Steatosis via FOXO1-Mediated Autophagy and Lipogenesis. Cell Mol Gastroenterol Hepatol. 2021;11:697-724.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 75]  [Cited by in RCA: 70]  [Article Influence: 11.7]  [Reference Citation Analysis (1)]
30.  Li X, Wan T, Li Y. Role of FoxO1 in regulating autophagy in type 2 diabetes mellitus (Review). Exp Ther Med. 2021;22:707.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 26]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
31.  Liang R, Liu N, Cao J, Liu T, Sun P, Cai X, Zhang L, Liu Y, Zou J, Wang L, Ding X, Zhang B, Shen Z, Yoshida S, Dou J, Wang S. HIF-1α/FOXO1 axis regulated autophagy is protective for β cell survival under hypoxia in human islets. Biochim Biophys Acta Mol Basis Dis. 2022;1868:166356.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 31]  [Cited by in RCA: 29]  [Article Influence: 7.3]  [Reference Citation Analysis (0)]
32.  Yue J, Aobulikasimu A, Sun W, Liu S, Xie W, Sun W. Targeted regulation of FoxO1 in chondrocytes prevents age-related osteoarthritis via autophagy mechanism. J Cell Mol Med. 2022;26:3075-3082.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 35]  [Cited by in RCA: 33]  [Article Influence: 8.3]  [Reference Citation Analysis (0)]
33.  Mailler E, Guardia CM, Bai X, Jarnik M, Williamson CD, Li Y, Maio N, Golden A, Bonifacino JS. The autophagy protein ATG9A enables lipid mobilization from lipid droplets. Nat Commun. 2021;12:6750.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 118]  [Cited by in RCA: 100]  [Article Influence: 20.0]  [Reference Citation Analysis (0)]
34.  Imai K, Hao F, Fujita N, Tsuji Y, Oe Y, Araki Y, Hamasaki M, Noda T, Yoshimori T. Atg9A trafficking through the recycling endosomes is required for autophagosome formation. J Cell Sci. 2016;129:3781-3791.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 161]  [Cited by in RCA: 119]  [Article Influence: 11.9]  [Reference Citation Analysis (0)]
35.  Tamura Y, Izumiyama-Shimomura N, Kimbara Y, Nakamura K, Ishikawa N, Aida J, Chiba Y, Mori S, Arai T, Aizawa T, Araki A, Takubo K, Ito H. β-cell telomere attrition in diabetes: inverse correlation between HbA1c and telomere length. J Clin Endocrinol Metab. 2014;99:2771-2777.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 43]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
36.  Tamura Y, Takubo K, Aida J, Araki A, Ito H. Telomere attrition and diabetes mellitus. Geriatr Gerontol Int. 2016;16 Suppl 1:66-74.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 56]  [Cited by in RCA: 81]  [Article Influence: 8.1]  [Reference Citation Analysis (0)]
37.  Lewis KA, Tollefsbol TO. Regulation of the Telomerase Reverse Transcriptase Subunit through Epigenetic Mechanisms. Front Genet. 2016;7:83.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 88]  [Cited by in RCA: 79]  [Article Influence: 7.9]  [Reference Citation Analysis (2)]
38.  Palamarchuk AI, Kovalenko EI, Streltsova MA. Multiple Actions of Telomerase Reverse Transcriptase in Cell Death Regulation. Biomedicines. 2023;11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 27]  [Cited by in RCA: 21]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
39.  Shaheen F, Grammatopoulos DK, Müller J, Zammit VA, Lehnert H. Extra-nuclear telomerase reverse transcriptase (TERT) regulates glucose transport in skeletal muscle cells. Biochim Biophys Acta. 2014;1842:1762-1769.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 27]  [Cited by in RCA: 25]  [Article Influence: 2.1]  [Reference Citation Analysis (0)]
40.  Ren H, Shao Y, Wu C, Ma X, Lv C, Wang Q. Metformin alleviates oxidative stress and enhances autophagy in diabetic kidney disease via AMPK/SIRT1-FoxO1 pathway. Mol Cell Endocrinol. 2020;500:110628.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 275]  [Cited by in RCA: 250]  [Article Influence: 41.7]  [Reference Citation Analysis (1)]
41.  Zhang M, Sui W, Xing Y, Cheng J, Cheng C, Xue F, Zhang J, Wang X, Zhang C, Hao P, Zhang Y. Angiotensin IV attenuates diabetic cardiomyopathy via suppressing FoxO1-induced excessive autophagy, apoptosis and fibrosis. Theranostics. 2021;11:8624-8639.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 134]  [Cited by in RCA: 120]  [Article Influence: 24.0]  [Reference Citation Analysis (0)]
42.  Zhao Y, Yang J, Liao W, Liu X, Zhang H, Wang S, Wang D, Feng J, Yu L, Zhu WG. Cytosolic FoxO1 is essential for the induction of autophagy and tumour suppressor activity. Nat Cell Biol. 2010;12:665-675.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 532]  [Cited by in RCA: 511]  [Article Influence: 31.9]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Endocrinology and metabolism

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade A, Grade B, Grade C

Novelty: Grade B, Grade B, Grade B

Creativity or Innovation: Grade B, Grade B, Grade B

Scientific Significance: Grade A, Grade B, Grade B

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Wang Z; Zhou C S-Editor: Qu XL L-Editor: A P-Editor: Xu ZH

Write to the Help Desk