©2013 Baishideng Publishing Group Co.
World J Gastrointest Oncol. Mar 15, 2013; 5(3): 50-59
Published online Mar 15, 2013. doi: 10.4251/wjgo.v5.i3.50
Published online Mar 15, 2013. doi: 10.4251/wjgo.v5.i3.50
Table 1 Primers used for the detection of CagPAI genes
| Gene | Primer | Sequence 5’-3’ | Product size (bp) | Reference |
| cagE | 101 | TTGAAAACTTCAAGGATAGGATAGAGC | 510 | [16] |
| 102 | GCCTAGCGTAATATCACCATTACCC | |||
| cagT | cagTF | ATGAAAGTGAGAGCAAGTGT | 823 | [30] |
| cagTR | TCACTTACCACTGAGCAAAC | |||
| cag10 | cag10F | ATGGAAGACTTTTTGTATAA | 2208 | [30] |
| cag10R | TCACAGTTCGCTTGAACCCA |
Table 2 Induction of interleukin-8 expression and cell elongation by cagPAI-functional Helicobacter pylori strains according to the histopathological diagnosis
| Pathology | IL-8 (pg/mL) | Elongation | ||||||
| 6 h | 30 h | 6 h | 24 h | |||||
| mean | 95%CI | mean | 95%CI | mean | 95%CI | mean | 95%CI | |
| Gastritis | 256.1 | (145.1-367.1) | 594.5 | (419.5-769.6) | 15.3% | (10.7-19.9) | 18.98% | (15.7-22.3) |
| Atrophic gastritis | 224.7 | (58.7-390.6) | 463.7 | (244.9-682.5) | 14.9% | (12.2-17.6) | 19.84% | (16.9-22.7) |
| Intestinal metaplasia | 192.7 | (89.0-296.4) | 532.1 | (398.2-666.0) | 15.32% | (12.2-18.4) | 17.7% | (18.5-20.6) |
| Gastric cancer | 265.5 | (107.5-423.5) | 589.5 | (355.4-823.5) | 16.3% | (12.8-19.9) | 19.55% | (15.9-23.1) |
| Duodenal ulcer | 278.9 | (154.8-402.9) | 572.2 | (343.6-800.8) | 14.72% | (13.6-15.8) | 19.8% | (17.2-22.4) |
-
Citation: Fajardo CA, Quiroga AJ, Coronado A, Labrador K, Acosta N, Delgado P, Jaramillo C, Bravo MM. CagA EPIYA polymorphisms in Colombian
Helicobacter pylori strains and their influence on disease-associated cellular responses. World J Gastrointest Oncol 2013; 5(3): 50-59 - URL: https://www.wjgnet.com/1948-5204/full/v5/i3/50.htm
- DOI: https://dx.doi.org/10.4251/wjgo.v5.i3.50
