Nuclear localization of proteasome subunit beta 5 serves as an independent prognostic biomarker and promotes invasion in colorectal cancer

doi:10.4251/wjgo.122057

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 18, Issue 8

This Article

(4)

(5)

(0)

(15)

Peer-Review Report of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Supplementary Materials of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Journal Information of This Article

Publication Name

World Journal of Gastrointestinal Oncology

ISSN

1948-5204

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Basic Study

Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.

World J Gastrointest Oncol. Aug 15, 2026; 18(8): 122057
Published online Aug 15, 2026. doi: 10.4251/wjgo.122057

Table 1 Sequences of primers used for quantitative real-time polymerase chain reaction

Gene name	Primer sequence (5’ → 3’)	Product size (bp)	GenBank accession No.
PSMB5	Forward: AGC TGC TGG AGG AGT TCA TC	152	NM_002797.4
PSMB5	Reverse: GGT CCA GGT CCA GAA GTT GT	152	NM_002797.4
GAPDH	Forward: GGA GCG AGA TCC CTC CAA AAT	197	NM_002046.7
GAPDH	Reverse: GGC TGT TGT CAT ACT TCT CAT GG	197	NM_002046.7

PSMB5: Proteasome subunit beta 5; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Full Size Table

Table 2 Sequences of the small interfering RNAs in the proteasome subunit beta 5-targeting pool

siRNA name/ID	Target sequence (DNA notation)	Actual synthesized oligo (5’ → 3’)	Target position
siPSMB5-#1	TCGAATCTATGAGCTTCGAAATA	UCGAAUCUAUGAGCUUCGAAAUAdTdT	385-407
siPSMB5-#2	GTGCTTGAAACCTAAGTCATTTG	GUGCUUGAAACCUAAGUCAUUUGdTdT	538-560
siPSMB5-#3	GACTGTCATTGGTAATACGGACA	GACUGUCAUUGGUAAUACGGACAdTdT	935-955
Scramble (siControl)	TTCTCCGAACGTGTCACGTTT	UUCUCCGAACGUGUCACGUdTdT	N/A

All small interfering RNAs were synthesized as RNA oligos with 3’dTdT overhangs. si: Small interfering; PSMB5: Proteasome subunit beta 5; N/A: Not applicable.

Full Size Table

Table 3 Proteasome subunit beta 5 expression in primary colorectal cancer, adjacent normal mucosa, and metastatic tissues

Tissues	Total	-	+	++	+++	P value
Adjacent normal mucosa	129	90	14	18	7
Primary CRC	129	3	28	48	50	< 0.01^b
Lymph node metastasis	56	1	2	17	36	0.04^a
Liver metastasis	4	0	0	2	2	> 0.05¹

^aP < 0.05 lymph node metastasis vs primary colorectal cancer.

^bP < 0.01 primary colorectal cancer vs adjacent normal mucosa.

¹Liver metastasis vs primary colorectal cancer.

CRC: Colorectal cancer.

Full Size Table

Table 4 Proteasome subunit beta 5 expression and clinicopathological features in colorectal cancer

Parameters	Total number (n = 129)	High expression (n = 98)	Low expression (n = 31)	χ² value	P value
Age (years)
< 60	55	40	15	0.552	0.458
≥ 60	74	58	16	0.552	0.458
Gender
Male	66	50	16	0.003	0.954
Female	63	48	15	0.003	0.954
Tumor size (cm)
< 5	64	48	16	0.065	0.798
≥ 5	65	50	15	0.065	0.798
Differentiation
Well/moderate	105	74	31	9.327	0.002^a
Poor	24	24	0	9.327	0.002^a
Depth of invasion
T1-T2	21	11	10	7.645	0.006^a
T3-T4	108	87	21	7.645	0.006^a
Lymph node metastasis
No	73	45	28	18.902	0.001^a
Yes	56	53	3	18.902	0.001^a
Distant metastasis
No	100	69	31	11.834	0.001^a
Yes	29	29	0	11.834	0.001^a
TNM stage
I-II	61	33	28	30.320	0.001^a
III-IV	68	65	3	30.320	0.001^a

^aP < 0.01.

TNM: Tumor, node, and metastasis.

Full Size Table

Table 5 Proteasome subunit beta 5 localization and clinicopathological features in colorectal cancer

Parameters	Total number (n = 126)	Cytoplasm (n = 56)	Nucleus (n = 41)	Cytoplasm and nucleus (n = 29)	χ² value	P value
Age (years)
< 60	54	25	19	10	0.186	0.911
≥ 60	72	34	23	15	0.186	0.911
Gender
Male	65	30	18	17	2.233	0.442
Female	61	26	23	12	2.233	0.442
Tumor size (cm)
< 5	62	31	18	13	1.018	0.601
≥ 5	64	28	24	12	1.018	0.601
Differentiation
Well/moderate	102	57	27	18	18.246	0.001^a
Poor	24	2	15	7	18.246	0.001^a
Depth of invasion
T1-T2	19	16	2	1	12.566	0.002^a
T3-T4	107	43	40	24	12.566	0.002^a
Lymph node metastasis
No	71	52	11	8	45.793	0.001^a
Yes	55	7	31	17	45.793	0.001^a
Distant metastasis
No	97	55	25	17	17.143	0.001^a
Yes	29	4	17	8	17.143	0.001^a
TNM stage
I-II	59	49	4	6	59.797	0.001^a
III-IV	67	10	38	19	59.797	0.001^a

^aP < 0.01.

Three cases with completely negative proteasome subunit beta 5 expression by immunohistochemistry were excluded from subcellular localization analysis. TNM: Tumor, node, and metastasis.

Full Size Table

Table 6 Univariate and multivariate Cox regression analyses for overall survival in colorectal cancer patients

Parameters	Univariate Cox regression			Multivariate Cox regression
Parameters	HR	95%CI for HR	P value	HR	95%CI for HR	P value
Age	1.716	0.836-3.525	0.141
Gender	0.829	0.422-1.628	0.586
Tumor size	0.677	0.342-1.340	0.263
Differentiation	0.266	0.132-0.532	0.001^b	0.548	0.261-1.151	0.112
Depth of invasion	27.467	0.637-1184.629	0.085
Lymph node metastasis	3.599	1.717-7.543	0.001^b	0.325	0.120-0.876	0.026^a
Distant metastasis	7.417	3.692-14.898	0.001^b	2.521	1.071-5.934	0.034^a
TNM stage	19.904	4.760-83.235	0.001^b	9.455	1.434-62.343	0.020^a
PSMB5 expression	6.477	1.549-27.075	0.010^a	0.856	0.097-7.515	0.888
PSMB5 localization¹			0.001^b			0.016^a
PSMB5 localization (1)²	41.534	5.576-309.408	0.001^b	18.069	2.137-152.804	0.008^b
PSMB5 localization (2)³	33.024	5.256-320.203	0.001^b	24.432	2.754-216.782	0.004^b

^aP < 0.05.

^bP < 0.01.

¹Proteasome subunit beta 5 localization represents the overall comparison among the three expression patterns (nuclear, cytoplasmic, and combined nuclear + cytoplasmic).

²Proteasome subunit beta 5 localization (1) represents the comparison between nuclear expression and cytoplasmic expression.

³Proteasome subunit beta 5 localization (2) represents the comparison between combined nuclear + cytoplasmic expression and cytoplasmic expression.

TNM: Tumor, node, and metastasis; PSMB5: Proteasome subunit beta 5; HR: Hazard ratio; CI: Confidence interval.

Full Size Table

Citation: Xu AP, She SP, Xiao YS, Lang J, Yuan JF, Zeng YF. Nuclear localization of proteasome subunit beta 5 serves as an independent prognostic biomarker and promotes invasion in colorectal cancer. World J Gastrointest Oncol 2026; 18(8): 122057
URL: https://www.wjgnet.com/1948-5204/full/v18/i8/122057.htm
DOI: https://dx.doi.org/10.4251/wjgo.122057

Xu AP, She SP, Xiao YS, Lang J, Yuan JF, Zeng YF. Nuclear localization of proteasome subunit beta 5 serves as an independent prognostic biomarker and promotes invasion in colorectal cancer. World J Gastrointest Oncol 2026; 18(8): 122057 [DOI: 10.4251/wjgo.122057]

All content on this site: Copyright © 1993-2026 Baishideng Publishing Group Inc, its licensors, and contributors. All rights are reserved, including those for text and data mining, AI training, and similar technologies. For all open access content, the relevant licensing terms apply.