Copyright
©The Author(s) 2025.
World J Gastrointest Oncol. May 15, 2025; 17(5): 104776
Published online May 15, 2025. doi: 10.4251/wjgo.v17.i5.104776
Published online May 15, 2025. doi: 10.4251/wjgo.v17.i5.104776
Table 1 Primer sequences used for qRT-PCR analysis
| Gene | Sequence (5′-3′) |
| miR-16 | CAGCACGTAAATATTGGCGA |
| miR-17 | GCAAAGTGCTTACAGTGCAGGTAG |
| miR-18 | CCGGTAAGGTGCATCTAGT |
| miR-19a | TGTGCAAATCTATGCAAAACTG |
| miR-19b | GCATCCCAGTGTGCAAATCC |
| miR-20 | GGTAAAGTGCTTATAGTGCAGGTAG |
| miR-92 | ATTGCACTTGTCCCGGCCTGT |
Table 2 Correlation between the expression levels of the serum exosomal miR-17-92 cluster and clinical pathological parameters in patients with gastric cancer
| Variable | No. of patients (n = 72) | miR-17 expression | P value | miR-18 expression | P value | miR-19a expression | P value | miR-92 expression | P value |
| Age (years) | |||||||||
| < 60 | 30 | 14.083 (11.920-16.247) | 0.188 | 10.297 (8.681-11.913) | 0.629 | 11.383 (9.945-12.822) | 0.117 | 31.007 (26.953-35.060) | 0.34 |
| ≥ 60 | 42 | 16.179 (13.968-18.389) | 10.793 (9.473-12.112) | 9.864 (8.585-11.144) | 28.633 (25.534-31.733) | ||||
| Sex | |||||||||
| Male | 39 | 16.021 (14.083-17.958) | 0.323 | 10.659 (9.408-11.910) | 0.876 | 10.255 (8.832-11.677) | 0.643 | 28.936 (25.170-32.701) | 0.544 |
| Female | 33 | 14.460 (11.867-17.054) | 10.500 (8.822-12.178) | 10.703 (9.369-12.036) | 30.433 (27.359-33.508) | ||||
| Tumor size (cm) | |||||||||
| < 5 | 46 | 13.600 (11.773-15.427) | 0.003b | 9.774 (8.547-11.001) | 0.03a | 10.602 (9.456-11.748) | 0.772 | 29.585 (26.414-32.756) | 0.968 |
| ≥ 5 | 26 | 18.323 (15.718-20.928) | 12.023 (10.348-13.699) | 10.312 (8.523-12.101) | 29.688 (25.697-33.680) | ||||
| Histological grade | |||||||||
| Well-moderately differentiated | 32 | 15.075 (12.525-17.625) | 0.794 | 10.463 (8.935-11.990) | 0.827 | 9.725 (8.216-11.234) | 0.149 | 28.931 (25.705-32.158) | 0.615 |
| Poorly differentiated | 40 | 15.490 (13.468-17.512) | 10.685 (9.306-12.064) | 11.115 (9.877-12.353) | 30.175 (26.531-33.819) | ||||
| Tumor depth | |||||||||
| T1-T2 | 35 | 13.613 (11.290-15.972) | 0.036a | 9.946 (8.494-11.397) | 0.216 | 9.197 (5.529-10.457) | 0.007b | 27.006 (23.425-30.586) | 0.036a |
| T3-T4 | 37 | 16.889 (14.852-18.926) | 11.192 (9.778-12.606) | 11.727 (10.378-13.076) | 32.097 (28.851-35.344) | ||||
| Lymph node metastasis | |||||||||
| Absent | 24 | 15.121 (11.663-18.574) | 0.883 | 9.938 (8.007-11.868) | 0.364 | 9.071 (7.624-10.518) | 0.033a | 27.521 (23.749-31.293) | 0.225 |
| Present | 48 | 15.398 (13.720-17.076) | 10.910 (9.722-12.098) | 11.21 (9.999-12.422) | 30.673 (27.509-33.837) | ||||
| Venous invasion | |||||||||
| Negative | 51 | 15.448 (12.109-18.786) | 0.908 | 10.282 (9.005-11.560) | 0.348 | 10.682 (9.474-11.890) | 0.511 | 29.159 (26.302-32.016) | 0.557 |
| Positive | 21 | 15.247 (13.452-17.042) | 11.324 (9.762-12.886) | 10.048 (8.494-11.602) | 30.748 (25.785-35.710) |
- Citation: Han Y, Guo XP, Zhi QM, Xu JJ, Liu F, Kuang YT. Circulating exosomal miR-17-92 cluster serves as a novel noninvasive diagnostic marker for patients with gastric cancer. World J Gastrointest Oncol 2025; 17(5): 104776
- URL: https://www.wjgnet.com/1948-5204/full/v17/i5/104776.htm
- DOI: https://dx.doi.org/10.4251/wjgo.v17.i5.104776
