©The Author(s) 2025.
World J Gastrointest Oncol. May 15, 2025; 17(5): 104686
Published online May 15, 2025. doi: 10.4251/wjgo.v17.i5.104686
Published online May 15, 2025. doi: 10.4251/wjgo.v17.i5.104686
Table 1 Sequences of primers used for real-time polymerase chain reaction
| Gene | Sequence (5’ to 3’) | |
| SPDL1 | Forward | GCTGCTGAATCAAAGCTTCAAACA |
| Reverse | TTGAGGCAAGTGGCACCGTA | |
| ACTB | Forward | GTCATTCCAAATATGAGATGCGT |
| Reverse | GCTATCACCTCCCCTGTGTG | |
Table 2 Relationship between the expression of SPDL1 and clinicopathological features of colorectal cancer, n (%)
| Clinicopathological characteristic | SPDL1 | P value | |
| + | - | ||
| Sex | 0.169 | ||
| Male | 48 (57.1) | 36 (42.9) | |
| Female | 20 (44.4) | 25 (55.6) | |
| Age (years) | 0.517 | ||
| ≤ 60 | 28 (50.9) | 27 (49.1) | |
| > 60 | 40 (54.1) | 34 (45.9) | |
| Tumor size | 0.708 | ||
| < 5 cm | 47 (51.6) | 44 (48.4) | |
| ≥ 5 cm | 21 (55.3) | 17 (44.7) | |
| Tumor differentiation | 0.034 | ||
| Well | 8 (80.0) | 2 (20.0) | |
| Moderate | 58 (52.7) | 52 (47.3) | |
| Poor | 2 (22.2) | 7 (77.8) | |
| Tumor-node-metastasis stage | 0.033 | ||
| I | 15 (62.5) | 9 (37.5) | |
| II | 30 (65.2) | 16 (34.8) | |
| III | 19 (41.3) | 27 (59.7) | |
| IV | 4 (30.8) | 9 (69.2) | |
| Depth of infiltration | 0.975 | ||
| T1 + T2 | 18 (52.9) | 16 (47.1) | |
| T3 + T4 | 50 (52.6) | 45 (47.4) | |
| Lymph node metastasis | 0.02 | ||
| N0 | 47 (62.7) | 28 (37.3) | |
| N1 | 12 (44.4) | 15 (55.6) | |
| N2 | 9 (33.3) | 18 (66.7) | |
| Distant metastasis | 0.095 | ||
| M0 | 64 (55.2) | 52 (44.8) | |
| M1 | 4 (30.8) | 9 (69.2) | |
- Citation: Peng P, Sun J, Li MS, Cheng RX, Liu SQ, Qin MB, Zhang JX, Huang JA. SPDL1 inhibition enhances colorectal cancer progression via epidermal growth factor receptor/extracellular signal-regulated kinase pathways. World J Gastrointest Oncol 2025; 17(5): 104686
- URL: https://www.wjgnet.com/1948-5204/full/v17/i5/104686.htm
- DOI: https://dx.doi.org/10.4251/wjgo.v17.i5.104686
