©The Author(s) 2022.
World J Gastrointest Oncol. Feb 15, 2022; 14(2): 450-477
Published online Feb 15, 2022. doi: 10.4251/wjgo.v14.i2.450
Published online Feb 15, 2022. doi: 10.4251/wjgo.v14.i2.450
Table 1 The RNA sequences used in this study
| Name | Primer sequence | Primer length |
| HIF-1α | F→TCCAGCAGACCCAGTTACAGA; R→GCCACTGTATGCTGATGCCTT | 182bp |
| TNF-α | F→AGCACAGAAAGCATGATCCG; R→CACCCCGAAGTTCAGTAGACA | 162bp |
| VEGF | F→GAACCAGACCTCTCACCGGAA; R→ACCCAAAGTGCTCCTCGAAG | 135bp |
| MMP-9 | F→GCCCTGGAACTCACACGACA; R→GTAGCCCACGTCGTCCACC | 139bp |
| GAPDH | F→GCGACTTCAACAGCAACTCCC; R→CACCCTGTTGCTGTAGCCGTA | 122bp |
Table 2 The effective candidate ingredients of frankincense and myrrh
| Mol ID | Molecule name | OB (%) | DL | Medicine |
| MOL001215 | Tirucallol | 42.12 | 0.75 | Frankincense |
| MOL001241 | O-acetyl-α-boswellic acid | 42.73 | 0.70 | Frankincense |
| MOL001243 | 3alpha-Hydroxy-olean-12-en-24-oic-acid | 39.32 | 0.75 | Frankincense |
| MOL001255 | Boswellic acid | 39.55 | 0.75 | Frankincense |
| MOL001263 | 3-oxo-tirucallic, acid | 42.86 | 0.81 | Frankincense |
| MOL001265 | Acetyl-alpha-boswellic,acid | 42.73 | 0.70 | Frankincense |
| MOL001272 | Incensole | 45.59 | 0.22 | Frankincense |
| MOL001295 | Phyllocladene | 33.40 | 0.27 | Frankincense |
| MOL000098 | Quercetin | 46.43 | 0.28 | Myrrh |
| MOL000358 | Beta-sitosterol | 36.91 | 0.75 | Myrrh |
| MOL000449 | Stigmasterol | 43.83 | 0.76 | Myrrh |
| MOL000490 | Petunidin | 30.05 | 0.31 | Myrrh |
| MOL000979 | 2-methoxyfuranoguaia-9-ene-8-one | 66.18 | 0.18 | Myrrh |
| MOL000988 | 4,17(20)-(cis)-pregnadiene-3,16-dione | 51.42 | 0.48 | Myrrh |
| MOL000996 | Guggulsterol IV | 33.59 | 0.74 | Myrrh |
| MOL001001 | Quercetin-3-O-β-D-glucuronide | 30.66 | 0.74 | Myrrh |
| MOL001002 | Ellagic acid | 43.06 | 0.43 | Myrrh |
| MOL001004 | Pelargonidin | 37.99 | 0.21 | Myrrh |
| MOL001006 | Poriferasta-7,22E-dien-3beta-ol | 42.98 | 0.76 | Myrrh |
| MOL001009 | Guggulsterol-VI | 54.72 | 0.43 | Myrrh |
| MOL001013 | Mansumbinoic acid | 48.10 | 0.32 | Myrrh |
| MOL001019 | (7S,8R,9S,10R,13S,14S,17Z)-17-ethylidene-7-hydroxy-10,13-dimethyl-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta(a)phenanthrene-3,16-dione | 35.75 | 0.48 | Myrrh |
| MOL001021 | 7β,15β- dihydroxypregn-4-ene-3,16-dione | 43.11 | 0.51 | Myrrh |
| MOL001022 | 11α-hydroxypregna-4,17(20)-trans-diene-3,16-dione | 36.62 | 0.47 | Myrrh |
| MOL001026 | Myrrhrrhanol C | 39.96 | 0.58 | Myrrh |
| MOL001027 | Myrrhrrhanone A | 40.25 | 0.63 | Myrrh |
| MOL001028 | (8R)-3-oxo-8-hydroxy-polypoda-13E,17E,21-triene | 44.83 | 0.59 | Myrrh |
| MOL001029 | Myrrhrrhanones B | 34.39 | 0.67 | Myrrh |
| MOL001031 | Epimansumbinol | 61.81 | 0.40 | Myrrh |
| MOL001033 | Diayangambin | 63.84 | 0.81 | Myrrh |
| MOL001040 | (2R)-5,7-dihydroxy-2-(4-hydroxyphenyl)chroman-4-one | 42.36 | 0.21 | Myrrh |
| MOL001045 | (13E,17E,21E)-8-hydroxypolypodo-13,17,21-trien-3-one | 44.34 | 0.58 | Myrrh |
| MOL001046 | (13E,17E,21E)-polypodo-13,17,21-triene-3,18-diol | 39.96 | 0.58 | Myrrh |
| MOL001049 | 16-hydroperoxymansumbin-13(17)-en-3β-ol | 41.05 | 0.49 | Myrrh |
| MOL001052 | Mansumbin-13(17)-en-3,16-dione | 41.78 | 0.45 | Myrrh |
| MOL001061 | (16S,20R)-dihydroxydammar-24-en-3-one | 37.34 | 0.78 | Myrrh |
| MOL001062 | 15α-hydroxymansumbinone | 37.51 | 0.44 | Myrrh |
| MOL001063 | 28-acetoxy-15α-hydroxymansumbinone | 41.85 | 0.67 | Myrrh |
| MOL001069 | 3β-acetoxy-16β,20(R)-dihydroxydammar-24-ene | 38.72 | 0.81 | Myrrh |
| MOL001088 | 1α-acetoxy-9,19-cyclolanost-24-en-3β-ol | 44.40 | 0.78 | Myrrh |
| MOL001092 | {(3R,5R,8R,9R,10R,13R,14R,17S)-17-[(2S,5S)-5-(2-hydroxypropan-2-yl)-2-methyloxolan-2-yl]-4,4,8,10,14-pentamethyl-2,3,5,6,7,9,11,12,13,15,16,17-dodecahydro-1H-cyclopenta(a)phenanthren-3-yl} acetate | 33.07 | 0.80 | Myrrh |
| MOL001093 | Cabraleone | 36.21 | 0.82 | Myrrh |
| MOL001095 | Isofouquierone | 40.95 | 0.78 | Myrrh |
| MOL001126 | [(5aS,8aR,9R)-8-oxo-9-(3,4,5-trimethoxyphenyl)-5,5a,6,9-tetrahydroisobenzofurano(6,5-f)(1,3)benzodioxol-8a-yl] acetate | 44.08 | 0.90 | Myrrh |
| MOL001131 | Phellamurin_qt | 56.60 | 0.39 | Myrrh |
| MOL001138 | (3R,20S)-3,20-dihydroxydammar-24-ene | 37.49 | 0.75 | Myrrh |
| MOL001145 | (20S)-3β-acetoxy-12β,16β,25-tetrahydroxydammar-23-ene | 34.89 | 0.82 | Myrrh |
| MOL001146 | (20S)-3β,12β,16β,25-pentahydroxydammar-23-ene | 37.94 | 0.75 | Myrrh |
| MOL001147 | (20R)-3β-acetoxy-16β-dihydroxydammar-24-ene | 40.36 | 0.82 | Myrrh |
| MOL001148 | 3β-hydroxydammar-24-ene | 40.27 | 0.82 | Myrrh |
| MOL001156 | 3-methoxyfuranoguaia-9-en-8-one | 35.15 | 0.18 | Myrrh |
| MOL001164 | [(5S,6R,8R,9Z)-8-methoxy-3,6,10-trimethyl-4-oxo-6,7,8,11-tetrahydro-5H-cyclodeca(b)furan-5-yl] acetate | 34.76 | 0.25 | Myrrh |
| MOL001175 | Guggulsterone | 42.45 | 0.44 | Myrrh |
Table 3 Virtual docking of biologically active ingredients from frankincense and myrrh for hepatocellular carcinoma targets
| Mol ID | Molecule name | Scores/(kcal∙mol-1) | ||
| AKT1 | VEGFA | EGFR | ||
| MOL000098 | Quercetin | -7.6 | -5.7 | -7.2 |
| MOL000358 | Beta-sitosterol | -8.1 | -6.9 | -9.2 |
| MOL000449 | Stigmasterol | -8.6 | -6.8 | -9.6 |
| MOL001243 | 3alpha-Hydroxy-olean-12-en-24-oic-acid | -8.7 | -7.1 | -8.3 |
| MOL001255 | Boswellic acid | -8.8 | -7.0 | -9.3 |
- Citation: Zheng P, Huang Z, Tong DC, Zhou Q, Tian S, Chen BW, Ning DM, Guo YM, Zhu WH, Long Y, Xiao W, Deng Z, Lei YC, Tian XF. Frankincense myrrh attenuates hepatocellular carcinoma by regulating tumor blood vessel development through multiple epidermal growth factor receptor-mediated signaling pathways. World J Gastrointest Oncol 2022; 14(2): 450-477
- URL: https://www.wjgnet.com/1948-5204/full/v14/i2/450.htm
- DOI: https://dx.doi.org/10.4251/wjgo.v14.i2.450
