©The Author(s) 2019.
World J Gastrointest Oncol. Nov 15, 2019; 11(11): 998-1010
Published online Nov 15, 2019. doi: 10.4251/wjgo.v11.i11.998
Published online Nov 15, 2019. doi: 10.4251/wjgo.v11.i11.998
Table 1 Nucleotide primer sequences, polymerase chain reaction conditions and minor allele frequency for polymorphisms TLR9-1237 T/C (rs5743836) and -1486 T/C (rs187084)
| Genes | Location | MAF | Primers, 5’-3’ | Cycles | T melting | Enzyme | Genotypes, bp |
| TLR9-1237 T/C (rs5743836) | Chromosome 3: 52226766 (intron variant) | 0.1725 (C) | F: TGGGAGCAGAGACATAATGGA | 35 | 60 °C | BstNI | CC = 60 + 48 + 27 |
| R: CTGCTTGCAGTTGACTGTGT | CT = 108 + 60 + 48 + 27 | ||||||
| TT = 108 + 27 | |||||||
| TLR9-1486 C/T (rs187084) | Chromosome 3: 52227015 (intron variant) | 0.3776 (C) | F: TCCCAGCAGCAACAATTCATTA | 30 | 60 °C | AflII | CC = 499 |
| R: CTGCTTGCAGTTGACTGTGT | TC = 499 + 327 + 172 | ||||||
| TT = 327 + 172 |
Table 2 Genotype and allele frequencies of TLR9-1237 T/C and TLR9-1486 C/T SNPs in both case and control groups (GC vs C, CG vs C, and GC vs CG)
| Polymorp-hisms | Models | Genotypes/ Alleles | C, n = 200 | Cases | ||||
| GC, n = 161 | OR (95%CI), P value | CG, n = 248 | OR (95%CI), P value | |||||
| TLR9-1237 T/C (rs5743836) | Dominant | TT | 148 (74%) | 78 (48.5%) | 1.00 | 188 (75.8%) | 1.00 | |
| TC + CC | 52 (26%) | 83 (51.5%) | 3.03 (1.95-4.71), < 0.0001 | 60 (24.2%) | 0.91 (0.59-1.40), 0.6600 | |||
| Recessive | TT + TC | 188 (94%) | 122 (75.8%) | 1.00 | 232 (93.5%) | 1.00 | ||
| CC | 12 (6%) | 39 (24.2%) | 5.01 (2.52-9.94), < 0.0001 | 16 (6.5%) | 1.08 (0.50-2.34), 0.8400 | |||
| Log-additive | 2.37 (1.74-3.23), < 0.0001 | 0.96 (0.70-1.32), 0.8100 | ||||||
| Alleles | T | 336 (0.84) | 200 (0.62) | 1.00 | 420 (0.85) | 1.00 | ||
| C | 64 (0.16) | 122 (0.38) | 3.20 (2.25-4.54), < 0.0001 | 76 (0.15) | 0.95 (0.66-1.36), 0.7822 | |||
| GC vs CG | Dominant | 3.46 (2.23-5.37), < 0.0001 | ||||||
| OR (95%CI), P | Recessive | 4.63 (2.44-8.79), < 0.0001 | ||||||
| Log-additive | 2.46 (1.82-3.34), < 0.0001 | |||||||
| Alleles | 3.37 (2.41-4.70), < 0.0001 | |||||||
| TLR9-1486 C/T (rs187084) | Dominant | CC | 58 (29%) | 21 (13%) | 1.00 | 46 (18.6%) | 1.00 | |
| CT + TT | 142 (71%) | 140 (87%) | 2.72 (1.57-4.72), < 0.0001 | 202 (81.5%) | 1.79 (1.15-2.79), 0.0094 | |||
| Recessive | CC + CT | 164 (82%) | 122 (75.8%) | 1.00 | 182 (73.4%) | 1.00 | ||
| TT | 36 (18%) | 39 (24.2%) | 1.46 (0.87-2.43), 0.1500 | 66 (26.6%) | 1.65 (1.05-2.61), 0.0300 | |||
| Log-additive | 1.70 (1.23-2.37), 0.0013 | 1.52 (1.15-2.02), 0.0030 | ||||||
| Alleles | C | 222 (0.56) | 143 (0.44) | 1.00 | 228 (0.46) | 1.00 | ||
| T | 178 (0.44) | 179 (0.56) | 1.56 (1.16-2.09), 0.0035 | 268 (0.54) | 1.46 (1.12-1.91), 0.0048 | |||
| GC vs CG | Dominant | 1.15 (0.72-1.84), 0.5700 | ||||||
| OR (95%CI), P | Recessive | 0.69 (0.39-1.24), 0.2100 | ||||||
| Log-additive | 0.95 (0.69-1.31), 0.7500 | |||||||
| Alleles | 0.93 (0.70-1.24), 0.6670 | |||||||
Table 3 Haplotype frequency distribution of TLR9 polymorphisms between GC, CG and control groups
| Haplotypes | GC, % | C, % | X2 | P value | CG, % | C, % | X2 | P value | GC, % | CG, % | X2 | P value |
| TLR9-1237/-1486 | ||||||||||||
| T-C | 35.2 | 47.7 | 38.284 | ≤ 0.0001 | 40.5 | 48.4 | 5.617 | 0.0178 | 24.9 | 39.7 | 19.098 | ≤ 0.0001 |
| T-T | 36.9 | 36.3 | 0.024 | 0.8772 | 44.2 | 35.6 | 6.778 | 0.0092 | 37.3 | 45.0 | 4.838 | 0.0278 |
| C-T | 18.7 | 8.2 | 17.656 | ≤ 0.0001 | 9.8 | 8.9 | 0.233 | 0.6290 | 18.3 | 9.0 | 15.335 | ≤ 0.0001 |
| C-C | 19.2 | 7.8 | 20.475 | ≤ 0.0001 | 5.5 | 7.1 | 1.000 | 0.3158 | 19.6 | 6.3 | 33.560 | ≤ 0.0001 |
Table 4 Combined effect of TLR9-1237 T/C and TLR9-1486 C/T polymorphisms on risk of GC and CG
| Risk genotype | Groups | OR (95%CI), P value | |||||
| TLR9-1237 | TLR9-1486 | C, n = 200 | GC, n = 161 | CG, n = 248 | GC × C | CG × C | GC × CG |
| TT | CC | 50 | 7 | 38 | 1.00 | 1.00 | 1.00 |
| TC/CC | CC | 5 | 13 | 7 | 18.57 (5.06-68.15), < 0.0001 | 1.842 (0.54-6.25), 0.3665 | 10.08 (2.96-34.24). 0.0002 |
| TT | CT/TT | 98 | 70 | 150 | 5.102 (2.18-11.92), < 0.0001 | 7.737(4.72-12.66), < 0.0001 | 2.533 (1.07-5.95), 0.0307 |
| TC/CC | CT/TT | 47 | 71 | 53 | 10.79 (4.50-25.83), < 0.0001 | 1.484 (0.83-1.64), 0.1911 | 7.272 (3.01-17.56), < 0.0001 |
Table 5 Relative gene expression levels of TLR9 for GC and CG
| Variables | Cases | |
| GC, n = 23 | CG, n = 48 | |
| Median | 9.24 | 1.55 |
| Range | 3.64-24.06 | 1.04-3.87 |
| P value | < 0.00011 | |
Table 6 TLR9 gene expression levels of GC and CG groups to assess influence of polymorphic genotypes
| Groups | TLR9-1237T/C (rs5743836) | P value | TLR9-1486 C/T (rs187084) | P value | |||
| TT | TC/CC | CC | CT / TT | ||||
| Upregulated cases | Upregulated cases | ||||||
| GC (n = 26) | Median | 5.24 | 13.01 | 0.0083 | 7.37 | 9.90 | 0.8763 |
| Range | 1.72-9.27 | 7.55-189.00 | 5.74-14.16 | 2.49-53-75 | |||
| CG (n = 48) | Median | 1.47 | 1.45 | 0.8442 | 3.26 | 1.50 | 0.1515 |
| Range | 0.77-4.19 | 0.75-3.82 | 1.39-8.46 | 0.75-3.00 | |||
- Citation: Susi MD, Lourenço Caroline M, Rasmussen LT, Payão SLM, Rossi AFT, Silva AE, Oliveira-Cucolo JG. Toll-like receptor 9 polymorphisms and Helicobacter pylori influence gene expression and risk of gastric carcinogenesis in the Brazilian population.. World J Gastrointest Oncol 2019; 11(11): 998-1010
- URL: https://www.wjgnet.com/1948-5204/full/v11/i11/998.htm
- DOI: https://dx.doi.org/10.4251/wjgo.v11.i11.998