Toll-like receptor 9 polymorphisms and Helicobacter pylori influence gene expression and risk of gastric carcinogenesis in the Brazilian population.

Table 1 Nucleotide primer sequences, polymerase chain reaction conditions and minor allele frequency for polymorphisms TLR9-1237 T/C (rs5743836) and -1486 T/C (rs187084)

Genes	Location	MAF	Primers, 5’-3’	Cycles	T melting	Enzyme	Genotypes, bp
TLR9-1237 T/C (rs5743836)	Chromosome 3: 52226766 (intron variant)	0.1725 (C)	F: TGGGAGCAGAGACATAATGGA	35	60 °C	BstNI	CC = 60 + 48 + 27
			R: CTGCTTGCAGTTGACTGTGT				CT = 108 + 60 + 48 + 27
							TT = 108 + 27
TLR9-1486 C/T (rs187084)	Chromosome 3: 52227015 (intron variant)	0.3776 (C)	F: TCCCAGCAGCAACAATTCATTA	30	60 °C	AflII	CC = 499
			R: CTGCTTGCAGTTGACTGTGT				TC = 499 + 327 + 172
							TT = 327 + 172

Minor allele frequency was extracted from 1000 Genomes Project Phase 3. MAF: Minor allele frequency.

Table 2 Genotype and allele frequencies of TLR9-1237 T/C and TLR9-1486 C/T SNPs in both case and control groups (GC vs C, CG vs C, and GC vs CG)

Polymorp-hisms	Models	Genotypes/ Alleles	C, n = 200	Cases
				GC, n = 161	OR (95%CI), P value		CG, n = 248	OR (95%CI), P value
TLR9-1237 T/C (rs5743836)	Dominant	TT	148 (74%)	78 (48.5%)	1.00		188 (75.8%)	1.00
		TC + CC	52 (26%)	83 (51.5%)	3.03 (1.95-4.71), < 0.0001		60 (24.2%)	0.91 (0.59-1.40), 0.6600
	Recessive	TT + TC	188 (94%)	122 (75.8%)	1.00		232 (93.5%)	1.00
		CC	12 (6%)	39 (24.2%)	5.01 (2.52-9.94), < 0.0001		16 (6.5%)	1.08 (0.50-2.34), 0.8400
	Log-additive				2.37 (1.74-3.23), < 0.0001			0.96 (0.70-1.32), 0.8100
	Alleles	T	336 (0.84)	200 (0.62)	1.00		420 (0.85)	1.00
		C	64 (0.16)	122 (0.38)	3.20 (2.25-4.54), < 0.0001		76 (0.15)	0.95 (0.66-1.36), 0.7822
GC vs CG	Dominant			3.46 (2.23-5.37), < 0.0001
OR (95%CI), P	Recessive			4.63 (2.44-8.79), < 0.0001
	Log-additive			2.46 (1.82-3.34), < 0.0001
	Alleles			3.37 (2.41-4.70), < 0.0001
TLR9-1486 C/T (rs187084)	Dominant	CC	58 (29%)	21 (13%)		1.00	46 (18.6%)	1.00
		CT + TT	142 (71%)	140 (87%)		2.72 (1.57-4.72), < 0.0001	202 (81.5%)	1.79 (1.15-2.79), 0.0094
	Recessive	CC + CT	164 (82%)	122 (75.8%)		1.00	182 (73.4%)	1.00
		TT	36 (18%)	39 (24.2%)		1.46 (0.87-2.43), 0.1500	66 (26.6%)	1.65 (1.05-2.61), 0.0300
	Log-additive					1.70 (1.23-2.37), 0.0013		1.52 (1.15-2.02), 0.0030
	Alleles	C	222 (0.56)	143 (0.44)		1.00	228 (0.46)	1.00
		T	178 (0.44)	179 (0.56)		1.56 (1.16-2.09), 0.0035	268 (0.54)	1.46 (1.12-1.91), 0.0048
GC vs CG	Dominant			1.15 (0.72-1.84), 0.5700
OR (95%CI), P	Recessive			0.69 (0.39-1.24), 0.2100
	Log-additive			0.95 (0.69-1.31), 0.7500
	Alleles			0.93 (0.70-1.24), 0.6670

C: Control; OR: Odds ratio; CI: Confidence interval; GC: Gastric cancer; CG: Chronic gastritis.

Table 3 Haplotype frequency distribution of TLR9 polymorphisms between GC, CG and control groups

Haplotypes	GC, %	C, %	X2	P value	CG, %	C, %	X2	P value	GC, %	CG, %	X2	P value
TLR9-1237/-1486
T-C	35.2	47.7	38.284	≤ 0.0001	40.5	48.4	5.617	0.0178	24.9	39.7	19.098	≤ 0.0001
T-T	36.9	36.3	0.024	0.8772	44.2	35.6	6.778	0.0092	37.3	45.0	4.838	0.0278
C-T	18.7	8.2	17.656	≤ 0.0001	9.8	8.9	0.233	0.6290	18.3	9.0	15.335	≤ 0.0001
C-C	19.2	7.8	20.475	≤ 0.0001	5.5	7.1	1.000	0.3158	19.6	6.3	33.560	≤ 0.0001

C: Control; GC: Gastric cancer; CG: Chronic gastritis.

Table 4 Combined effect of TLR9-1237 T/C and TLR9-1486 C/T polymorphisms on risk of GC and CG

Risk genotype		Groups			OR (95%CI), P value
TLR9-1237	TLR9-1486	C, n = 200	GC, n = 161	CG, n = 248	GC × C	CG × C	GC × CG
TT	CC	50	7	38	1.00	1.00	1.00
TC/CC	CC	5	13	7	18.57 (5.06-68.15), < 0.0001	1.842 (0.54-6.25), 0.3665	10.08 (2.96-34.24). 0.0002
TT	CT/TT	98	70	150	5.102 (2.18-11.92), < 0.0001	7.737(4.72-12.66), < 0.0001	2.533 (1.07-5.95), 0.0307
TC/CC	CT/TT	47	71	53	10.79 (4.50-25.83), < 0.0001	1.484 (0.83-1.64), 0.1911	7.272 (3.01-17.56), < 0.0001

GC: Gastric cancer; CG: Chronic gastritis.

Table 5 Relative gene expression levels of TLR9 for GC and CG

Variables	Cases
	GC, n = 23	CG, n = 48
Median	9.24	1.55
Range	3.64-24.06	1.04-3.87
P value	< 0.00011

¹Mann Whitney U Test. GC: Gastric cancer; CG: Chronic gastritis.

Table 6 TLR9 gene expression levels of GC and CG groups to assess influence of polymorphic genotypes

Groups		TLR9-1237T/C (rs5743836)		P value	TLR9-1486 C/T (rs187084)		P value
		TT	TC/CC		CC	CT / TT
		Upregulated cases			Upregulated cases
GC (n = 26)	Median	5.24	13.01	0.0083	7.37	9.90	0.8763
	Range	1.72-9.27	7.55-189.00		5.74-14.16	2.49-53-75
CG (n = 48)	Median	1.47	1.45	0.8442	3.26	1.50	0.1515
	Range	0.77-4.19	0.75-3.82		1.39-8.46	0.75-3.00

GC: Gastric cancer; CG: Chronic gastritis.