Copyright
©The Author(s) 2019.
World J Gastrointest Oncol. Nov 15, 2019; 11(11): 1065-1080
Published online Nov 15, 2019. doi: 10.4251/wjgo.v11.i11.1065
Published online Nov 15, 2019. doi: 10.4251/wjgo.v11.i11.1065
Table 1 Name of primers, location, and the sequence of microsatellite instability
| SNP | Location | Primer sequence |
| BAT26 | 2p16 | p1 TGACTACTTTTGACTTCAGCC |
| p2 AACCATTCAACATTTTTAACCC | ||
| D2S123 | 2p21-2p16 | p1 AAACAGGATGCCTGCCTTTA |
| p2 GGACTTTCCACCTATGGGAC | ||
| D5S346 | 5q21-5q22 | p1 ACTCACTCTAGTGATAAATCGGG |
| p2 CAGATAAGACAGTATTACTAGTT | ||
| BAT25 | 4q12 | p1 TCGCCTCCAAGAATGTAAGT |
| p2 TCTGCATTTTAACTATGGCTC | ||
| D17S250 | 17q11.2-17q12 | p1 GGAAGAATCAAATAGACAAT |
| p2 GCTGGCCATATATATATTTAAACC |
Table 2 Relationship between clinicopathological features and MutL homolog1/MutS homolog2 expression in 681 patients, n (%)
| Observation | Positivea | Negativeb | Total | χ2 | P value |
| Gender | |||||
| Male | 310 (80.10) | 77 (19.90) | 387 | 0.252 | 0.625 |
| Female | 240 (81.63) | 54 (18.37) | 294 | ||
| Age (yr) | |||||
| ≤50 | 63 (88.73) | 8 (11.27) | 71 | 3.240 | 0.072 |
| >50 | 487 (79.84) | 123 (20.16) | 610 | ||
| Location in the colon | |||||
| Left | 138 (82.14) | 30 (17.86) | 168 | 4.746 | 0.029 |
| Right | 119 (72.12) | 46 (27.88) | 165 | ||
| Location of tumor Colon | 257 (77.18) | 76 (22.82) | 333 | 5.395 | 0.025 |
| Rectum | 293 (84.20) | 55 (15.80) | 348 | ||
| Grade of differentiation | |||||
| Poor | 28 (66.67) | 14 (33.33) | 42 | 5.725 | 0.017 |
| Well-moderate | 522 (81.69) | 117 (18.31) | 639 | ||
| Tumor stage (TNM) | |||||
| II | 324 (82.03) | 71 (17.97) | 395 | 0.964 | 0.327 |
| III | 226 (79.02) | 60 (20.98) | 286 | ||
| Tumor size (cm) | |||||
| ≤4 | 210 (78.95) | 56 (21.05) | 266 | 0.927 | 0. 370 |
| >4 | 340 (81.93) | 75 (18.07) | 415 | ||
| Lymphocytic infiltration | |||||
| None or little | 336 (82.76) | 70 (17.24) | 406 | 1.195 | 0.332 |
| Marked or moderate | 214 (75.76) | 61 (27.24) | 275 | ||
| Mucin | |||||
| Positive | 108 (73.97) | 38 (26.03) | 146 | 5.517 | 0.024 |
| Negative | 442 (82.62) | 93 (17.38) | 535 | ||
| Circumscribed margin | |||||
| Negative | 482 (79.80) | 122 (20.20) | 604 | 3.184 | 0.090 |
| Positive | 68 (88.31) | 9 (11.69) | 77 |
Table 3 Prognostic factors for survival in univariate and multivariate analyses
| Observation | Univariate | Multivariate | ||||
| P | HR | 95%CI | P | HR | 95%CI | |
| Model 1a | ||||||
| Gender | ||||||
| Male vs Female | 0.932 | 0.984 | 0.684-1.417 | 0.991 | 0.998 | 0.685-1.454 |
| Age/yr | ||||||
| ≤50 vs >50 | < 0.001 | 0.288 | 0.189-0.438 | 0.025 | 0.508 | 0.213-0.995 |
| Location in the colon | ||||||
| Left vs Right | 0.730 | 1.086 | 0.678-1.740 | 0.440 | 1.211 | 0.745-1.967 |
| Location of tumor | ||||||
| Rectum vs Colon | 0.232 | 1.311 | 0.840-2.047 | 0.017 | 1.795 | 1.111-2.902 |
| Differentiation | ||||||
| Poor vs Well-moderate | 0.002 | 0.426 | 0.472-0.734 | 0.923 | 0.972 | 0.542-1.741 |
| Tumor stage | ||||||
| II vs III | 0.034 | 0.651 | 0.437-0.968 | 0.041 | 0.601 | 0.321-0.932 |
| Tumor size | ||||||
| <4 vs ≥4 cm | 0.646 | 0.921 | 0.647-1.311 | 0.421 | 0.861 | 0.598-1.240 |
| Lymphocytic infiltration | ||||||
| Positive vs Negative | < 0.001 | 2.282 | 1.092-5.756 | 0.022 | 3.665 | 1.207-7.128 |
| Mucin | ||||||
| Positive vs Negative | 0.001 | 2.361 | 1.647-3.383 | < 0.001 | 2.512 | 1.714-4.682 |
| Circumscribed margin | ||||||
| Positive vs Negative | < 0.001 | 3.908 | 2.654-5.755 | 0.011 | 2.474 | 1.433-4.270 |
| MLH1/ MSH2 | ||||||
| Positive vs Negative | < 0.001 | 3.799 | 2.205-6.546 | < 0.001 | 4.064 | 2.241-7.369 |
| Model 2b | ||||||
| Gender | ||||||
| Male vs Female | 0.761 | 0.896 | 0.441-1.821 | 0.207 | 0.622 | 0.298-1.300 |
| Age/yr | ||||||
| ≤50 vs >50 | < 0.001 | 0.150 | 0.075-0.302 | < 0.001 | 0.131 | 0.063-0.271 |
| MLH1/ MSH2 | ||||||
| Positive vs Negative | 0.014 | 4.833 | 1.382-16.899 | 0.011 | 5.583 | 1.478-21.092 |
| Therapeutic regimen | ||||||
| Operation vs Operation + Chemotherapy | 0.176 | 0.821 | 0.520-1.233 | 0.063 | 0.901 | 0.899-2.312 |
| Model 3c | ||||||
| Gender | ||||||
| Male vs Female | 0.964 | 0.990 | 0.647-1.517 | 0.748 | 0.932 | 0.607-1.432 |
| Age/yr | ||||||
| ≤50 vs >50 | 0.002 | 0.424 | 0.247-0.728 | 0.004 | 0.446 | 0.258-0.769 |
| MLH1/ MSH2 | ||||||
| Positive vs Negative | 0.041 | 1.625 | 1.042-2.803 | 0.023 | 2.289 | 1.270-4.125 |
| Therapeutic regimen | ||||||
| Operation vs Operation + Chemotherapy | 0.028 | 2.891 | 1.209-6.372 | < 0.001 | 4.002 | 1.929-9.425 |
Table 4 Predictive factors for survival in univariate and multivariate analyses
| Observation | Univariate | Multivariate | ||||
| P | HR | 95%CI | P | HR | 95%CI | |
| Model 1a | ||||||
| MLH1/MSH2 negative | ||||||
| Operation vs Operation + Chemotherapy | 0.098 | 1.021 | 0.342-2.741 | 0.147 | 1.563 | 0.481-4.441 |
| MLH1/MSH2 positive | ||||||
| Operation vs Operation + Chemotherapy | 0.081 | 1.899 | 0.127-4.114 | 0.070 | 1.267 | 0.212-5.052 |
| Model 2b | ||||||
| MLH1/MSH2 negative | ||||||
| Operation vs Operation + Chemotherapy | 0.001 | 4.393 | 2.068-12.316 | < 0.001 | 7.660 | 2.974-15.883 |
| MLH1/MSH2 positive | ||||||
| Operation vs Operation + Chemotherapy | 0.063 | 2.015 | 0.648-5.997 | 0.052 | 2.817 | 0.223-6.671 |
- Citation: Wang SM, Jiang B, Deng Y, Huang SL, Fang MZ, Wang Y. Clinical significance of MLH1/MSH2 for stage II/III sporadic colorectal cancer. World J Gastrointest Oncol 2019; 11(11): 1065-1080
- URL: https://www.wjgnet.com/1948-5204/full/v11/i11/1065.htm
- DOI: https://dx.doi.org/10.4251/wjgo.v11.i11.1065
