BPG is committed to discovery and dissemination of knowledge
Case Report Open Access
©2012 Baishideng. All rights reserved.
World J Gastrointest Oncol. May 15, 2012; 4(5): 119-124
Published online May 15, 2012. doi: 10.4251/wjgo.v4.i5.119
Greater omentum gastrointestinal stromal tumor with PDGFRA-mutation and hemoperitoneum
Yoko Murayama, Ryuichiro Iwasaki, Tamana Miyazaki, Yukiko Saji, Department of Gastroenterology and Hepatology, Itami City Hospital, Itami 6648540, Japan
Masayuki Yamamoto, Masahiro Hiratsuka, Department of Surgery, Itami City Hospital, Itami 6648540, Japan
Haruki Fukuda, Department of Pathology, Itami City Hospital, Itami 6648540, Japan
Yoshinori Doi, Department of Gastroenterology and Hepatology, Otemae Hospital, Osaka 5400008, Japan
Seiichi Hirota, Department of Surgical Pathology, Hyogo College of Medicine, Nishinomiya 6638501, Japan
Author contributions: All authors read and approved this manuscript; Murayama Y, Iwasaki R, Miyazaki T, Saji Y and Doi Y were involved in the care of the patient; Fukuda H and Hirota S studied the specimens; Yamamoto M and Hiratsuka M performed the surgery; Murayama Y wrote the paper.
Correspondence to: Yoko Murayama, MD, PhD, Department of Gastroenterology and Hepatology, Itami City Hospital, 1-100 Koyaike, Itami 6648540, Japan. murayama@hosp.itami.hyogo.jp
Telephone: +81-72-7773773 Fax: +81-72-7819888
Received: September 21, 2011
Revised: February 12, 2012
Accepted: March 14, 2012
Published online: May 15, 2012

Abstract

Although gastrointestinal stromal tumor (GIST) occurs generally in the digestive tract, omental GIST is very rare. We report the first case of an adult greater omental GIST with a new platelet-derived growth factor receptor α gene (PDGFRA)-mutation with hemoperitoneum. A 43-year-old man was admitted to our hospital complaining of acute abdominal pain. Abdominal contrast-enhanced computed tomography revealed a huge mass in the right abdominal cavity, and a large accumulation of fluid in the pelvic cavity, suggesting hemoperitoneum. We diagnosed the rupture as an intra-abdominal tumor, and an emergency tumorectomy was performed with resection of the greater omentum. This tumor was located in the distal right side of the greater omentum, and showed no continuity with the gastric wall. The tumor occurred primarily in the greater omentum. The resected tumor was about 19 cm × 12 cm × 14 cm in diameter, and weighed 1529 g. Histologically, the tumor was composed of epithelioid-shaped cells with high cellularity, and was positive for CD117 and CD34, and negative for S-100, α-smooth muscle actin. The mitosis was 6/50 under high power field. This case showed exon 18 mutation of PDGFRA with 846 (Asp to Glu) substitution, 848 (Asn to Lys) substitution. This is the first report of this PDGFRA mutation in omental GIST, and this might play an important role in the tumorigenesis of this case. Based on these findings, the tumor was diagnosed as high risk GIST primarily occurring in the greater omentum. The patient was treated with imatinib at a dose of 400 mg/d as adjuvant chemotherapy, and has been followed up for 24 mo with no evidence of recurrence.

Key Words: Gastrointestinal stromal tumor; Greater omentum; Hemoperitoneum; Platelet-derived growth factor receptor α gene; KIT



INTRODUCTION

Gastrointestinal stromal tumors (GISTs), while relatively rare, are the most common mesenchymal tumors of the digestive tract and are believed to originate from the interstitial cells of Cajal (ICCs) or from their precursors in the gastrointestinal tract[1,2].

GISTs can occur anywhere in the gastrointestinal tract where ICCs are present, including the stomach (40%-60%), small intestine (30%-40%), anorectum (7%), colon, and esophagus, as well as in extra-gastrointestinal locations such as mesentery, omentum, and peritoneum[1,3]. Omental, mesenteric, and retroperitoneal tumors comprise less than 5%[4-9]. Tumors occurring in the greater omentum are very rare, and the diagnosis of such lesions is difficult. The incidence of primary GIST in the greater omentum has been reported to be less than 1%[10-12].

The majority of adult GIST cases (83.6%-88.2%) have activation mutations in the KIT gene, which codes for the KIT receptor tyrosine kinase. These mutations result in constitutive activation of the receptor, and subsequently cell survival and proliferation, in the absence of ligand binding. In addition, platelet-derived growth factor receptor α gene (PDGFRA) mutations account for a further 2.6%-4.7% of cases while the remaining 7.1%-13.8% are wild types for either receptor[13,14].

Here we report the first case of the greater omentum GIST with the new PDGFRA-mutation and hemoperitoneum.

CASE REPORT

A 43-year-old man was admitted to our hospital for acute abdominal pain. He had no past medical or surgical history, was taking no medications, and never had a previous colonoscopy or upper endoscopy. There was no family history of any gastrointestinal malignancies. His height was 173 cm, weight was 108 kg (BMI: 36). The only positive findings on examination were right lower abdominal pain, tenderness, and defense. Hematological examination found slight anemia with a hemoglobin level of 6.8 g/dL and high levels of C-reactive protein of 4.46 mg/dL. The levels of CEA, CA19-9, and AFP were within the normal ranges. A contrast-enhanced computed tomography (CT) scan of the abdomen and pelvis showed a huge mass in the right abdominal cavity. The interior was heterogeneous, with some high density area, but comprised mostly of low density regions which seemed to be a cystic component or interstitial mucous (Figure 1A and B). Moreover a large amount bloody ascites was found in the pelvic cavity, suggesting hemoperitoneum. We diagnosed the rupture as an intra-abdominal tumor, and an emergency tumorectomy was performed. This tumor was located in the distal right side of omentum. The disconnect was successfully ligated to the greater omentum mass insertion, and the tumor showed no continuity with the gastric wall. The tumor size was oval, 19 cm × 12 cm × 14 cm in diameter, and the weighed 1529 g. There was about 850 mL of bloody asictes in the abdominal cavity. On gross examination, the resected tumor was a dark-red, relatively hard mass, and mixed with partly bleeding blood clots. The cut surface of the tumor showed cystic degeneration, and focal hemorrhage (Figure 2A and B). The tumor occurred primarily in the greater omentum. Tumor invasion to adjacent organs, liver metastasis, peritoneal dissemination, and omental lymph node swelling were not observed. Haematoxylin and eosin (HE) staining and immunohistochemistry were carried out on paraffin wax sections of the formalin-fixed tissues[10]. HE staining showed that the tumor cells were composed of epithelioid-shaped cells with high cellularity (Figure 3A and B). The mitosis was 6/50 under high power field. Immunohistochemical staining showed that the tumor cells were positive for CD117 (Figure 3C), positive for CD34 (Figure 3D), and negative for S-100 and α-smooth muscle actin (α-SMA), consistent with a GIST. Therefore, these features strongly indicate clinical malignancy with abdominal hemorrhage, most likely GIST[4].

Figure 1
Figure 1 Contrast-enhanced axial (A) and coronal (B) abdominal computed tomography. A huge mass was seen in the right abdominal cavity showing internal heterogeneity, with some high density area, but comprised mostly of low density regions which seemed to be a cystic component or interstitial mucous. The high density area was not enhanced, thus hemorrhage was suggested. Moreover a large amount of bloody ascites was seen in the pelvic cavity.
Figure 2
Figure 2 Gross appearance of the resected specimen. A: The tumor appeared as a dark-red, relatively hard mass mixed with partly bleeding blood clots; B: The cut surface of the tumor showed cystic degeneration, and focal hemorrhage.
Figure 3
Figure 3 Histopathological findings of the resected specimen of the tumor. A and B: The tumors were characterized by epithelioid-shaped cells and showed high cellularity (HE staining, A: × 40, B: × 200); C: Immunostaining of CD117 (KIT) was positive; D: Immunostaining of CD34 was positive (C, D: × 200).

Genomic DNA was extracted from the formalin-fixed, paraffin wax-embedded tissues using the QIAamp DNA Mini Kit (QIAGEN, Valencia, CA, USA), and Exon 9, 11, 13, 17 of KIT and exon 12, 14 or 18 of PDGFRA, were amplified using polymerase chain reaction (PCR), as described previously[15] and PCR primers listed in Table 1. This analysis of extracted genomic DNA revealed no mutations of exons 9, 11, 13, 17 of KIT and exons 12 or 14 of PDGFRA. There was, however, exon 18 mutation of PDGFRA with 846 (Asp to Glu) substitution and 848 (Asn to Lys) substitution (Figure 4). Informed consent for the present analysis was previously obtained. Based on these findings, the tumor was diagnosed as high risk GIST primarily occurring in the greater omentum. The patient was treated with imatinib at a dose of 400 mg/d as adjuvant chemotherapy, and has been followed up for 24 mo with no evidence of recurrence.

Table 1 Polymerase chain reaction primers used to analyze c-kit and PDGFRA gene exons.
GeneExonForward primerReverse primer
c-kit9TTCCCTTTAGATGCTCTGCTTCTCCTTTGTTGTTACCTTTAAATGC
11GAGTGCTCTAATGACTGAGAAAAGGTGACATGGAAAGCCC
13GCTTGACATCAGTTTGCCAGAAAGGCAGCTTGGACACGGCTTTA
17GTTTTCTTTTCTCCTCCAACTGCAGGACTGTCAAGCAGAG
PDGFRA12GGACTTTGGTAATTCACCAGTGTAAAGTTGTGTGCAAGGG
14ACAGGAAGTTGGTAGCTCAGTCACAACCACATGTGTCCAG
18ACCATGGATCAGCCAGTCTTTGAAGGAGGATGAGCCTGACC
Figure 4
Figure 4 Representative sequencing results of omentum gastrointestinal stromal tumor. This case showed a codon 846 (Asp to Glu) substitution, and a codon 848 (Asn to Lys) substitution within exon 18 of PDGFRA gene.
DISCUSSION

In general, GISTs are the most common mesenchymal tumors of the gastrointestinal tract, occurring mainly in stomach, and small and large intestine. They are considered to be derived from the ICCs[1], and the incidence of the primary GIST lesion in the greater omentum is very rare[10-12].

It has been reported that GIST in the mesentery and greater omentum, structures which lack ICCs, are derived from mesenchymal cells that are less differentiated than ICCs[16]. These may be ICC precursors straying into the abdominal cavity[1], or KIT-positive cells similar to ICCs immediately below mesothelial cells in the greater omentum[11] although the precise etiology remains to be clarified. The present case has shown KIT-positive and CD34 positive cells within specimens from the greater omentum. However, the meaning of this is uncertain.

It has previously been reported that omental GISTs are clinicopathologically heterogeneous[17,18]. Patients with solitary tumors usually show gastric GIST-like morphology and have a better prognosis than those with multiple tumors, whose tumors usually show small intestinal GIST-like histology. Omental GISTs unattached to the gastrointestinal tract often resemble gastric GISTs, suggesting that they may be gastric GISTs directly extending into, or parasitically attached to the omentum, whereas multiple omental GISTs more often resemble small intestinal GISTs, suggesting that they may be metastases or derived from this source. Most single omental GISTs are relatively indolent tumors compatible with long-term patient survival, despite large tumor size. The present case was a solitary omental GIST, suggesting overall similarity with gastric GISTs.

Recent studies have established that activating mutations in the KIT gene are present in up to 92% of GISTs. PDGFRA mutations account for a further 2.6%-4.7% of cases, while the remaining 7.1%-13.8% are WT for either receptor[13,14]. These gain-of-function mutations result in constitutive KIT or PDGFRA activation without ligand stimulation and are considered to be a cause of GISTs[18]. The respective oncoproteins exhibit constitutive tyrosine kinase activity and promote cell growth, and might play a central role in GIST pathogenesis[2,18,19]. Imatinib mesylate, a tyrosine kinase inhibitor known to inhibit the activities of BCR-ABL, KIT, and PDGFR, is currently being used for the treatment of both chronic myeloid leukemia and metastatic GIST. In Table 2 we summarize the collected data on PDGFRA mutation primarily from omental GIST case-reports (Table 2)[5,12,17,20-22]. In addition, Miettinen et al[18] reported PDGFRA mutations in 10 cases. There were exon 18 D842V substitutions in 6 cases, exon 18 deletions of 842-845 in 1 case, exon 18 deletions of 841-845 in 1 case, exon 12 substitution V561D in 1 case, and exon 12 deletion of 566-571 in 1 case. Of the 21 cases available for molecular study, 17 cases (81%) had PDGFRA gene mutations at exon 18 and 4 cases (19%) had PDGFRA gene mutations at exon 12. Only case 5 had both PDGFRA12 and KIT11 mutation. The majority of KIT-negative extra-gastrointestinal stromal omental tumors were characterized by epithelioid cell type, predominant PDGFRA mutation genotype, and showed low mitotic activity and a relatively favorable prognosis, despite a large tumor size[18,22]. However, as molecular genetic data has been reported in only a small number of omental GIST, further studies with a larger number of omental GIST cases will be needed. The present case showed exon 18 mutation of PDGFRA with 846 (Asp to Glu) substitution and 848 (Asn to Lys) substitution. This is the first report of this PDGFRA mutation in an omental GIST, and this might play an important role in the tumorigenesis of this case.

Table 2 Clinicopathologic findings in 11 cases of omental gastrointestinal stromal tumor.
Case No.Age (yr)/sexSize (cm)Mitosis/50HPFRisk groupCell typeMutationFollow up (mo)OutcomeRef.
173/F431LowMyxoid EpExon18 del D842V4NED[5]
252/M> 2041HighEpExon18 D842_H845del13NED[5]
349/F1713bEpExon18 D842_H845del48NED[12]
465/M2023bMyxoid EpExon12 V561D6NED[20]
564/M151156bSpExon12 polymorphism Q567PNANED[21]
662/F1133bEpExon 18 D842V87NED[22]
741/M1903bEpExon 18 D842V27NED[22]
869/M8.513aEpExon18 del IMHD843-84620NED[22]
954/F20186bEpExon 18 del DIMH842-84515DOD[22]
1059/M3313bEpExon 18 D842Y2DOD[22]
1143/M1966bEpExon18 D846E, N848K24NEDOur case

The mean diameter of omental GISTs has been reported to be about 15.35 cm[17] and was 19cm in the present case. Moreover, mitotic activity, cellularity and presence of necrosis have been found to be associated with worse outcomes. A high mitotic rate (> 5/50 HPF) and a high Ki-67 labeling index (> 10%) indicate a significantly poorer outcome[4]. In the present case, the large size, high mitotic counts and extensive hemorrhagic necrosis were malignant features, so the tumor was diagnosed as malignant GIST. Although peritoneal metastasis was not seen in the present case, we must pay attention to tumor recurrence because the tumor ruptured. PDGFRA may become a molecular therapeutic target of imatinib in at least some populations of omentum GIST. The preliminary clinical data and in vitro studies have demonstrated that GISTs with a PDGFRA D842V substitution were resistant to imatinib, but some populations of other PDGFRA mutants were sensitive[8,23-25]. Todoroki et al[20] and Kim et al[21] used STI-571 as adjuvant postoperative treatment. Because the PDGFRA genotype in this case might be sensitive to imatinib, the patient was treated with adjuvant chemotherapy imatinib at a dose of 400 mg/d before possible tumor recurrence was identified. This patient remains alive without disease 24 mo after surgery. We will carefully follow up with CT and expect to conduct further clinical investigation.

In conclusion, we have reported the first case of the greater omentum GIST with a new type of PDGFRA-mutation and hemoperitoneum. Both immunohistochemical evaluation and molecular analysis are necessary not only to confirm the diagnosis, but also to determine the therapeutic strategy. The existing data on greater omentum GIST is not sufficient to make a firm conclusion on the prognosis and survival. Further studies are necessary to distinguish between the PDGFRA-mutation and clinicopathologic factors or biologic behaviors.

ACKNOWLEDGMENTS

We greatly appreciate Hikari Kishimoto for assisting with the preparation of the manuscript.

References
1.  Kindblom LG, Remotti HE, Aldenborg F, Meis-Kindblom JM. Gastrointestinal pacemaker cell tumor (GIPACT): gastrointestinal stromal tumors show phenotypic characteristics of the interstitial cells of Cajal. Am J Pathol. 1998;152:1259-1269.  [PubMed]  [DOI]
2.  Hirota S, Isozaki K, Moriyama Y, Hashimoto K, Nishida T, Ishiguro S, Kawano K, Hanada M, Kurata A, Takeda M. Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors. Science. 1998;279:577-580.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3570]  [Cited by in RCA: 3066]  [Article Influence: 109.5]  [Reference Citation Analysis (0)]
3.  Miettinen M, Monihan JM, Sarlomo-Rikala M, Kovatich AJ, Carr NJ, Emory TS, Sobin LH. Gastrointestinal stromal tumors/smooth muscle tumors (GISTs) primary in the omentum and mesentery: clinicopathologic and immunohistochemical study of 26 cases. Am J Surg Pathol. 1999;23:1109-1118.  [PubMed]  [DOI]
4.  Reith JD, Goldblum JR, Lyles RH, Weiss SW. Extragastrointestinal (soft tissue) stromal tumors: an analysis of 48 cases with emphasis on histologic predictors of outcome. Mod Pathol. 2000;13:577-585.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 323]  [Cited by in RCA: 323]  [Article Influence: 12.4]  [Reference Citation Analysis (0)]
5.  Sakurai S, Hishima T, Takazawa Y, Sano T, Nakajima T, Saito K, Morinaga S, Fukayama M. Gastrointestinal stromal tumors and KIT-positive mesenchymal cells in the omentum. Pathol Int. 2001;51:524-531.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 95]  [Cited by in RCA: 68]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
6.  Joensuu H, Fletcher C, Dimitrijevic S, Silberman S, Roberts P, Demetri G. Management of malignant gastrointestinal stromal tumours. Lancet Oncol. 2002;3:655-664.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 416]  [Cited by in RCA: 377]  [Article Influence: 15.7]  [Reference Citation Analysis (0)]
7.  Fletcher CD, Berman JJ, Corless C, Gorstein F, Lasota J, Longley BJ, Miettinen M, O'Leary TJ, Remotti H, Rubin BP. Diagnosis of gastrointestinal stromal tumors: A consensus approach. Hum Pathol. 2002;33:459-465.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2469]  [Cited by in RCA: 2099]  [Article Influence: 87.5]  [Reference Citation Analysis (0)]
8.  Heinrich MC, Corless CL, Demetri GD, Blanke CD, von Mehren M, Joensuu H, McGreevey LS, Chen CJ, Van den Abbeele AD, Druker BJ. Kinase mutations and imatinib response in patients with metastatic gastrointestinal stromal tumor. J Clin Oncol. 2003;21:4342-4349.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1886]  [Cited by in RCA: 1612]  [Article Influence: 70.1]  [Reference Citation Analysis (0)]
9.  Miettinen M, Lasota J. Gastrointestinal stromal tumors (GISTs): definition, occurrence, pathology, differential diagnosis and molecular genetics. Pol J Pathol. 2003;54:3-24.  [PubMed]  [DOI]
10.  Hirota S, Ohashi A, Nishida T, Isozaki K, Kinoshita K, Shinomura Y, Kitamura Y. Gain-of-function mutations of platelet-derived growth factor receptor alpha gene in gastrointestinal stromal tumors. Gastroenterology. 2003;125:660-667.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 529]  [Cited by in RCA: 464]  [Article Influence: 20.2]  [Reference Citation Analysis (0)]
11.  Kim TW, Lee H, Kang YK, Choe MS, Ryu MH, Chang HM, Kim JS, Yook JH, Kim BS, Lee JS. Prognostic significance of c-kit mutation in localized gastrointestinal stromal tumors. Clin Cancer Res. 2004;10:3076-3081.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 126]  [Cited by in RCA: 118]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
12.  Yamamoto H, Oda Y, Kawaguchi K, Nakamura N, Takahira T, Tamiya S, Saito T, Oshiro Y, Ohta M, Yao T. c-kit and PDGFRA mutations in extragastrointestinal stromal tumor (gastrointestinal stromal tumor of the soft tissue). Am J Surg Pathol. 2004;28:479-488.  [PubMed]  [DOI]
13.  Cypriano MS, Jenkins JJ, Pappo AS, Rao BN, Daw NC. Pediatric gastrointestinal stromal tumors and leiomyosarcoma. Cancer. 2004;101:39-50.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 61]  [Cited by in RCA: 44]  [Article Influence: 2.0]  [Reference Citation Analysis (1)]
14.  Kinoshita K, Hirota S, Isozaki K, Ohashi A, Nishida T, Kitamura Y, Shinomura Y, Matsuzawa Y. Absence of c-kit gene mutations in gastrointestinal stromal tumours from neurofibromatosis type 1 patients. J Pathol. 2004;202:80-85.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 140]  [Cited by in RCA: 118]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
15.  Debiec-Rychter M, Sciot R, Le Cesne A, Schlemmer M, Hohenberger P, van Oosterom AT, Blay JY, Leyvraz S, Stul M, Casali PG. KIT mutations and dose selection for imatinib in patients with advanced gastrointestinal stromal tumours. Eur J Cancer. 2006;42:1093-1103.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 719]  [Cited by in RCA: 616]  [Article Influence: 30.8]  [Reference Citation Analysis (0)]
16.  Miettinen M, Lasota J. Gastrointestinal stromal tumors: review on morphology, molecular pathology, prognosis, and differential diagnosis. Arch Pathol Lab Med. 2006;130:1466-1478.  [PubMed]  [DOI]
17.  Castillo-Sang M, Mancho S, Tsang AW, Gociman B, Almaroof B, Ahmed MY. A malignant omental extra-gastrointestinal stromal tumor on a young man: a case report and review of the literature. World J Surg Oncol. 2008;6:50.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 19]  [Cited by in RCA: 25]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
18.  Miettinen M, Sobin LH, Lasota J. Gastrointestinal stromal tumors presenting as omental masses--a clinicopathologic analysis of 95 cases. Am J Surg Pathol. 2009;33:1267-1275.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 65]  [Cited by in RCA: 47]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
19.  Sakurai S, Hasegawa T, Sakuma Y, Takazawa Y, Motegi A, Nakajima T, Saito K, Fukayama M, Shimoda T. Myxoid epithelioid gastrointestinal stromal tumor (GIST) with mast cell infiltrations: a subtype of GIST with mutations of platelet-derived growth factor receptor alpha gene. Hum Pathol. 2004;35:1223-1230.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 73]  [Cited by in RCA: 64]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
20.  Todoroki T, Sano T, Sakurai S, Segawa A, Saitoh T, Fujikawa K, Yamada S, Hirahara N, Tsushima Y, Motojima R. Primary omental gastrointestinal stromal tumor (GIST). World J Surg Oncol. 2007;5:66.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 24]  [Cited by in RCA: 27]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
21.  Kim JH, Boo YJ, Jung CW, Park SS, Kim SJ, Mok YJ, Kim SD, Chae YS, Kim CS. Multiple malignant extragastrointestinal stromal tumors of the greater omentum and results of immunohistochemistry and mutation analysis: a case report. World J Gastroenterol. 2007;13:3392-3395.  [PubMed]  [DOI]
22.  Yamamoto H, Kojima A, Nagata S, Tomita Y, Takahashi S, Oda Y. KIT-negative gastrointestinal stromal tumor of the abdominal soft tissue: a clinicopathologic and genetic study of 10 cases. Am J Surg Pathol. 2011;35:1287-1295.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 76]  [Cited by in RCA: 64]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
23.  Hasegawa T, Matsuno Y, Shimoda T, Hirohashi S. Gastrointestinal stromal tumor: consistent CD117 immunostaining for diagnosis, and prognostic classification based on tumor size and MIB-1 grade. Hum Pathol. 2002;33:669-676.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 172]  [Cited by in RCA: 148]  [Article Influence: 6.2]  [Reference Citation Analysis (0)]
24.  Corless CL, Schroeder A, Griffith D, Town A, McGreevey L, Harrell P, Shiraga S, Bainbridge T, Morich J, Heinrich MC. PDGFRA mutations in gastrointestinal stromal tumors: frequency, spectrum and in vitro sensitivity to imatinib. J Clin Oncol. 2005;23:5357-5364.  [PubMed]  [DOI]  [Full Text]
25.  Lasota J, Miettinen M. Clinical significance of oncogenic KIT and PDGFRA mutations in gastrointestinal stromal tumours. Histopathology. 2008;53:245-266.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 339]  [Cited by in RCA: 279]  [Article Influence: 15.5]  [Reference Citation Analysis (0)]
Footnotes

Peer reviewer: Yukinori Kurokawa, MD, PhD, Department of Surgery, Osaka National Hospital, 2-1-14, Hoenzaka, Chuo-ku, Osaka 540-0006, Japan

S- Editor Wang JL L- Editor Hughes D E- Editor Zheng XM

Write to the Help Desk