Published online Sep 15, 2026. doi: 10.4251/wjgo.120170
Revised: April 6, 2026
Accepted: May 7, 2026
Published online: September 15, 2026
Processing time: 204 Days and 17.7 Hours
IQGAP1 has been identified as a key regulator of tumor progression in multiple malignancies, although its specific role and molecular mechanism in cholangiocarcinoma (CCA), the second most common primary hepatobiliary malignancy, remain largely uncharacterized. The Nrf2/KEAP1 pathway is the core axis re
To define the oncogenic role and mechanism of IQGAP1 in CCA.
We screened differentially expressed genes in CCA via bioinformatic analysis of four public datasets (The Cancer Genome Atlas, GSE107943, GSE26566, GSE762
IQGAP1 was significantly upregulated in CCA tissues and cell lines, and its high expression promoted the proliferation, migration, and anti-apoptotic ability of CCA cells in vitro, as well as tumor growth in vivo. Mechanistically, IQGAP1 recruited the deubiquitinase ubiquitin-specific peptidase 28 to directly interact with MCM3, reducing K48-linked ubiquitination and degradation of MCM3 protein, thereby stabilizing MCM3 expression. Upregulated MCM3 competitively bound to KEAP1, blocking the interaction between KEAP1 and Nrf2, which in turn inhibited Nrf2 ubiquitination, activated the Nrf2 antioxidant pathway, alleviated intracellular oxidative stress, and sup
We first demonstrate IQGAP1 drives CCA progression via post-translationally stabilizing MCM3/Nrf2 axis, ser
Core Tip: This study reveals for the first time that IQGAP1 drives cholangiocarcinoma progression by recruiting ubiquitin-specific peptidase 28 to stabilize MCM3 protein, inhibiting its ubiquitination. This stabilization activates the Nrf2 pathway, alleviating oxidative stress and suppressing apoptosis, thereby promoting tumor cell survival and growth. Inhibition of MCM3 reverses these effects. The findings identify IQGAP1 as a key regulator of the MCM3/Nrf2 axis and a promising therapeutic target.
- Citation: Ren ZY, Zhang HY, Xie CX, Zhou GP, Chen PY, Yuan H, Zhang K, Xu Y, Wang YY, Chen TY, Li QS, Yu HB. IQGAP1 promotes tumor progression by stabilizing MCM3/Nrf2 in cholangiocarcinoma. World J Gastrointest Oncol 2026; 18(9): 120170
- URL: https://www.wjgnet.com/1948-5204/full/v18/i9/120170.htm
- DOI: https://dx.doi.org/10.4251/wjgo.120170
Cholangiocarcinoma (CCA) is a highly aggressive and lethal malignancy originating from the epithelial cells of the intrahepatic, perihilar, or distal biliary tree, and it is the second most common primary hepatobiliary malignancy world
Scaffold proteins play a pivotal role in cellular signal transduction[7]. The IQGAP1, which contains an IQ motif, influences numerous cellular activities by facilitating several key signaling pathways[8,9], including those involved in carcinogenesis[10]. Two decades of research have established that IQGAP1 is integral to cancer progression. This protein is overexpressed in various cancer types, and its elevated expression correlates with poorer survival outcomes among cancer patients[11-14]. Given the significant role of IQGAP1 in CCA development, anti-tumor therapies targeting IQGAP1 or its associated signaling pathways may offer therapeutic benefits for patients suffering from this disease.
MCM3, a core MCM family protein, is essential for initiating DNA replication and it mediates DNA damage response and repair, a pathway critical for cancer cell genomic stability and chemoresistance[15,16]. MCM3 is aberrantly overexpressed in various cancers, including breast, colorectal and prostate cancer, with its high expression linked to tumor progression, metastasis and poor prognosis; prior studies also highlight its superior clinical relevance over Ki-67 in salivary gland tumors and pro-proliferative, anti-apoptotic roles in renal cancer[17-19]. However, MCM3 remains poorly characterized in CCA, and its detailed regulatory mechanisms in biliary tract malignancies are largely undefined. Nrf2 is the master transcription factor governing cellular redox homeostasis. Under physiological conditions, Nrf2 is ubiquitinated by KEAP1 and degraded via the proteasome pathway; under stress, Nrf2 translocates to the nucleus and activates antioxidant gene transcription[20]. In cancer, constitutive Nrf2 activation drives malignant progression, stemness and chemoresistance, and is well documented to promote CCA development, correlate with advanced disease and chemothe
In CCA, preliminary studies have documented aberrant upregulation of IQGAP1 and its association with enhanced tumor invasive capacity, yet the precise molecular mechanisms underlying IQGAP1-mediated CCA progression, especially its regulatory network involving the MCM3/Nrf2 signaling axis, remain largely unexplored. Notably, several critical knowledge gaps persist in this field: The specific biological function and upstream regulatory mechanism of MCM3 in CCA are poorly elucidated; the potential crosstalk between IQGAP1 and the MCM3/Nrf2 axis has not been reported in any cancer type to date; and the functional role of the IQGAP1-MCM3-Nrf2 cascade in CCA malignant progression and oxidative stress regulation remains completely uncharacterized. Accordingly, the present study holds three major innovative values compared with existing literature. First, we for the first time identify IQGAP1 as a novel upstream regulator of MCM3 in CCA, and elucidate the deubiquitination mechanism whereby IQGAP1 stabilizes MCM3 protein by recruiting USP28. Second, we establish the first regulatory connection between IQGAP1 and the Nrf2-mediated antioxidant signaling pathway in CCA, verifying that IQGAP1 activates Nrf2 signaling in a MCM3-dependent manner. Third, we systematically validate the pro-tumorigenic role of the IQGAP1/MCM3/Nrf2 axis using both in vitro cellular assays and in vivo xenograft models, uncovering a previously unrecognized post-translational regulatory axis that links scaffold protein function to redox homeostasis in CCA.
Against this background and the existing knowledge gaps, the present study aimed to clarify the expression pattern and biological function of IQGAP1 in CCA, as well as its underlying molecular regulatory mechanisms. Specifically, we first sought to characterize IQGAP1 expression in CCA and explore its pro-tumorigenic functions in CCA cells. Second, we aimed to identify the downstream interacting proteins of IQGAP1 in CCA cells, and investigate the post-translational regulatory mechanisms by which IQGAP1 modulates its target proteins. Third, we intended to elucidate the role of the MCM3/Nrf2 axis in mediating the oncogenic activity of IQGAP1 in CCA. Finally, we planned to validate the tumor-promoting effect of the IQGAP1/MCM3/Nrf2 axis in vivo using CCA xenograft mouse models, and provide preclinical evidence for targeting IQGAP1 as a novel therapeutic strategy for CCA.
The experiments on animals were conducted in strict accordance with the guidelines approved by the Animal Ethical and Welfare Committee of Guangzhou Yongnuo Medical Experimental Animal Center (Approval No. IACUC-AEWC-F250801002). The animals were raised according to the principles of animal care approved by the National Society for Medical Research and the Guideline for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources/National Institutes of Health). Four to six-week-old male BALB/c nude mice were purchased from Henan Scribes Biotechnology Co., Ltd., Henan Province, China and housed in a specific pathogen-free environment to perform the animal experiments. To induce a solid tumor, BALB/c nude mice were anesthetized with isoflurane at a dose of 1% in pure oxygen at a flow rate of 1 L/minute. Preconditioned HUCCT1 cells stably transfected were prepared as follows: HUCCT1 cells were divided into three groups for stable cell line construction: Negative control group (transfected with empty lentiviral vector), IQGAP1 overexpression (OE) group (transfected with lentiviral vector carrying full-length human IQGAP1 coding sequence), and rescue (OE-IQGAP1 + shMCM3) group (co-transfected with OE-IQGAP1 lentivirus and MCM3-targeting shRNA lentivirus). Preconditioned HUCCT1 cells (1 × 107) were mixed in approximately 100 μL phosphate-buffered saline. The injection site was selected in the inguinal region. The volume of tumors was calculated using the following formula: Volume = 1/2 × width2 × length, and the weight was detected by an electronic scale. At the end of the experiment, the mice were euthanized by intraperitoneal injection of 0.3 mL of 1% pentobarbital sodium. Once deep anesthesia was confirmed by the absence of reflexes, the tumors were collected, fixed, and embedded in paraffin wax for further histological examination. The maximum diameter of the detached tumor should not exceed 1.5 cm, which meets the requirements of ethical review by the ethics committee.
Total proteins were extracted from CCA cells and immunoprecipitation (IP) was performed with the IQGAP1 antibodies and protein A/G-agarose beads (Thermo Scientific, MA, United States). The mass spectrometry analyses were carried out by BGI Tech Solutions Co., Ltd (BGI Shenzhen, China).
To assess the proliferation of QBC939 and HUCCT1 cells, they were first seeded into a 96-well plate at an optimized density of 4 × 103 cells/well (QBC939) and 5 × 103 cells/well (HUCCT1), with an even distribution across each well. This seeding density was determined via systematic pilot experiments, which confirmed that this parameter could maintain cell confluence at 30%-50% after 24 hours incubation, avoiding cell overlap and ensuring the accuracy of subsequent cell counting. Subsequently, 100 μL DMEM medium supplemented with 10% FBS was added to each well, and the cells were incubated at 37 °C for 24 hours. Following incubation, 5-ethynyl-2’-deoxyuridine (EdU) labeling reagent (Ribio, Guangzhou, Guangdong Province, China) was prepared at a dilution of 1:1000 and added to the designated wells. After a 2-hours incubation period, the cells were fixed with a 4% paraformaldehyde solution for 30 minutes and then permeabilized with 0.3% Triton X-100 at room temperature for 20 minutes. According to the manufacturer’s protocol, an EdU 555 In Vitro Kit (Ribio, Guangzhou, Guangdong Province, China) was utilized for further incubation with the cells. Ul
Previously treated cells were seeded into 6-well plates at a density of 1 × 103 cells/well and incubated at 37 °C for two weeks. Following incubation, the cells were fixed with a 4% paraformaldehyde solution (Beyotime, China) for 30 minutes and then stained with 0.1% crystal violet (Beyotime, China) for 1 hour. Subsequently, the colonies were meticulously counted and photographed for documentation.
The upper chamber was carefully seeded with an appropriate number of treated cells—QBC939 and HUCCT1, each at 2 × 104, and incubated in serum-free medium. A total of 500 μL complete medium was added to the lower chamber. After being cultured at 37 °C for 48 hours, the medium was removed, and the cells were fixed using 4% paraformaldehyde (Beyotime, China) for 30 minutes. Subsequently, the cells were stained with 0.1% crystal violet (Beyotime, China) for 15 minutes. The migrated cells were then observed under an optical microscope and quantified using Image J software.
In the wound healing assay, treated cells were seeded into a six-well plate, and a sterile 200 μL pipette tip was em
Cell viability was determined using the cell counting kit-8 (CCK-8) assay. QBC939 and HUCCT1 cells, subjected to various stimulation conditions, were plated into 96-well plates at a density of 1 × 103 cells/well. A 10% concentration of CCK-8 solution was prepared by diluting it in serum-free DMEM medium (Gibco, United States) and added to each well. The plates were then incubated in a cell culture chamber for 2 hours at 37 °C. Subsequently, the optical density (OD) values were measured using a spectrophotometric plate reader (United States, 450 nm). These OD values were utilized to evaluate cell proliferation and viability.
Transfected cells were evaluated using an Annexin V-PI apoptosis assay kit, by staining with Annexin V and Propidium Iodide (Vazyme, A211-01), as per the manufacturer’s instructions.
The reactive oxygen species (ROS) contents were measured using dihydroethidium staining (10 μM; S0063, Beyotime) at 37 °C for 30 minutes in a humidified and dark chamber according to the manufacturer’s instructions.
TUNEL cell apoptosis was detected using (C1086, Beyotime) at 37 °C for 60 minutes in a humidified and dark chamber according to the manufacturer’s instructions.
Total RNA was extracted from cells and tissues using TRIzol (Invitrogen, United States) according to the manufacturer’s instructions. HiScript Q RT SuperMix (Vazyme, China) was used for reverse transcription. The quantitative real-time PCR (qRT-PCR) was performed with AceQ qPCR SYBR Green Master Mix (Vazyme, China). Relative expression of coding genes was calculated using the 2-∆∆Ct method with β-actin as an endogenous control. The sequences of the related primers are listed below: IQGAP1, forward primer AGAACGTGGCTTATGAGTACCT, reverse primer CCAGTCGCCTTGTATCTGGT; MCM3, forward primer TCAGAGAGATTACCTGGACTTCC, reverse primer TCAGCCGGTATTGGTTGTCAC; GAPDH, forward primer ACCACAGTCCATGCCATCAC, reverse primer TCCACCACCCTGTTGCTGTA.
Protein in cell lines was extracted using RIPA lysis buffer with 1 mmol/L PMSF added (Beyotime, China). Proteins were separated by SDS-PAGE and then transferred to PVDF membranes. The 5% nonfat powdered milk TBST solution was used to block the PVDF membranes for approximately 2 hours. Membranes were then incubated at 4 °C in appropriate primary antibodies overnight. The membranes were incubated in the corresponding horseradish peroxidase secondary antibody for 2 hours in an ambient environment. The primary antibody of the related protein is listed below. The nuclear protein extraction kit was purchased from Thermo Scientific and extracted according to the manufacturer’s instructions. MG132 and CHX were purchased from MedChemExpress. IQGAP1 (Proteintech Cat. 22167-1-AP), MCM3 (Proteintech Cat. 15597-1-AP), Ubiquitin (Proteintech Cat. 10201-2-AP), Nrf2 (Proteintech Cat. 16396-1-AP), KEAP1 (Proteintech Cat. 10503-2-AP), and GAPDH (Proteintech Cat. 10494-1-AP).
All statistical analyses were performed with SPSS v24.0 (IBM, SPSS, United States) and GraphPad Prism 7 (GraphPad Software, La Jolla, CA, United States). Differences between the two groups were analyzed by Student’s t-test. Differences of P < 0.05, P < 0.01, P < 0.001, or P < 0.0001, were considered statistically significant. Further materials and methods are provided in the Supplementary material.
The identification of highly and differentially expressed genes (DEGs) was performed using four large-scale datasets (The Cancer Genome Atlas, GSE107943, GSE26566, and GSE76297). This initial analysis revealed that 116 DEGs were common to all datasets (Figure 1A). A subsequent intersection analysis with the top 10 up-regulated DEGs from GSE76297, the dataset with the largest number of CCA patient samples, identified a shortlist of five genes. From these, IQGAP1 emerged as the primary candidate due to its previously unreported link to CCA pathogenesis (Figure 1B). Its significant OE was further corroborated by volcano plot analysis of the GSE76297 dataset (Supplementary Figure 1A).
Organizational differential expression was further investigated via the Tumor Immune Estimation Resource (http://timer.cistrome.org/). In this dataset, a significant increase in IQGAP1 expression was observed in 36 CCA tissues compared to 9 normal tissue samples (Figure 1C). This finding was consistent across all databases examined, with IQGAP1 mRNA levels being robustly overexpressed in tumor tissues vs matched non-tumor tissues, supporting its association with a malignant phenotype (Figure 1D-G, Supplementary Figure 1B).
To establish suitable CCA cell models for functional investigation, we began by assessing IQGAP1 expression across a panel of CCA cell lines. The qRT-PCR and Western blot analyses showed that both IQGAP1 mRNA and protein levels were significantly elevated in QBC939 cells compared to normal bile duct epithelial cells, whereas HUCCT1 cells displayed relatively low expression (Figure 2A and B). Based on this distinct expression pattern, we selected QBC939 cells for IQGAP1 knockdown and HUCCT1 cells for its OE to delineate IQGAP1’s functional roles. Transfection efficiency was verified by both qRT-PCR and Western blot (Supplementary Figure 2A and B).
Functional characterization demonstrated that silencing IQGAP1 in QBC939 cells markedly inhibited proliferation, as measured by CCK-8 assay (Figure 2C), reduced the proportion of EdU-positive cells (Figure 2D), and impaired clonoge
To elucidate the molecular mechanisms by which IQGAP1 promotes CCA progression, we began by identifying its interacting proteins. Silver staining of co-immunoprecipitated complexes, followed by mass spectrometry, revealed a prominent interaction with MCM3 (Figure 3A). MCM3 is a key DNA replication licensing factor and a core component of the MCM2-7 helicase complex, which has been reported to exhibit oncogenic properties in several malignancies, including breast and colorectal cancers. Among the other interacting proteins, USP28 was also highly ranked. Given its known function as a scaffold protein, we hypothesized that IQGAP1 might bridge MCM3 and USP28. Subsequent co-IP experiments confirmed that IQGAP1 robustly co-precipitates with both MCM3 and USP28 in CCA cells, and reciprocally, both proteins were found in IQGAP1 immunoprecipitates (Figure 3B). Furthermore, modulating IQGAP1 levels (knockdown or OE) led to corresponding changes in MCM3 protein levels, whereas USP28 levels remained unaffected (Figure 3C and Supplementary Figure 2A and B). Western blot analysis further demonstrated that IQGAP1 OE enhanced the interaction between MCM3 and USP28, while its knockdown attenuated this interaction (Figure 3D). Immunofluorescence staining confirmed the colocalization of IQGAP1 and MCM3 in CCA cells (Figure 3E). Importantly, changes in MCM3 protein levels were not attributable to alterations in its mRNA levels (Supplementary Figure 2C), prompting us to further investigate the mechanism underlying its post-translational regulation.
By predicting the secondary structures of three proteins through α-Fold and conducting molecular docking, it was found that the three proteins could directly bind to each other in space (Figure 4A). ASP-709, LYS-1653, and LYS-1571 of IQGAP1 could form 4 hydrogen bonds with ASP-706, LYS-165, GLU-714, respectively on MCM3. This proved that there is interaction between IQGAP1 and MCM3 (Figure 4B). LYS-283, GLU-285, ASP-255, GLU-250 of USP28 can form 4 hydrogen bonds with LYS-248, LYS-177, GLN-386, and GLU-185, respectively on MCM3, which proves that there is interaction between USP28 and MCM3 (Figure 4C). Furthermore, SER-1084, ASP-1081, GLU-1078, and ASP-1090 of IQGAP1 can form 4 hydrogen bonds with SER-205, THR-207, ARG-247, LYS-262, and LYS-99, respectively, on USP28, and this proved that there is interaction between IQGAP1 and USP28 (Figure 4D).
We found that the decrease in MCM3 protein levels caused by USP28 knockout was reversed when the proteasome inhibitor MG132 was added (Figure 4E). To further clarify the regulatory effect of USP28 on the stability of MCM3, we treated cells with the protein synthesis inhibitor CHX and observed the degradation rate of endogenous MCM3 protein. The results showed that the half-life of MCM3 protein was significantly shortened in USP28 knockout CCA cells. In cells overexpressing USP28, the half-life of MCM3 was significantly prolonged (Figure 4F and Supplementary Figure 3). This indicated that USP28 maintains its protein stability by inhibiting the degradation pathway of MCM3. The ubiquitin plasmid labeled with HA-tag was transferred into MG132 treated cells, and the results showed that knocking down USP28 upregulated the ubiquitination level of MCM3, and OE downregulated the ubiquitination level. After mutating the ubiquitination active site of USP28, the ubiquitination level of MCM3 was restored (Figure 4G). The wild-type ubiquitin, K48, and K63 ubiquitin chain plasmids, as well as the USP28 plasmid, were transferred into cells, and the test results showed that USP28 mainly affects the K48 ubiquitin chain of MCM3 (Figure 4H).
The qRT-PCR analysis confirmed that IQGAP1 did not regulate MCM3 at the mRNA level. Building on prior evidence suggesting IQGAP1 modulated MCM3 protein stability by recruiting the deubiquitinase USP28, we further validated this mechanism. Treatment with the proteasome inhibitor MG132 effectively rescued the reduction in MCM3 protein levels caused by IQGAP1 knockout (Figure 5A), implicating the ubiquitin-proteasome pathway in this regulatory process. To assess the effect of IQGAP1 on endogenous MCM3 protein stability, we measured its half-life under protein synthesis inhibition using CHX. Notably, MCM3 protein degradation was accelerated in IQGAP1-knockdown CCA cells but delayed in IQGAP1-overexpressing cells compared to controls (Figure 5B and Supplementary Figure 4). Subsequent ubiquitination assays in MG132-treated CCA cells revealed that IQGAP1 knockdown markedly enhanced MCM3 ubiquitination, whereas IQGAP1 OE suppressed this modification (Figure 5C). Importantly, USP28 was essential for IQGAP1-mediated regulation of MCM3 ubiquitination (Figure 5D). A literature review indicated that MCM3 competes with Nrf2 for KEAP1 binding to influence Nrf2 stability. Co-IP experiments demonstrated that IQGAP1 OE attenuated the KEAP1-Nrf2 interaction, thereby reducing Nrf2 ubiquitination and increasing its protein expression; conversely, IQGAP1 knockdown exerted the opposite effect. Western blot analysis confirmed that Nrf2 protein levels were positively correlated with IQGAP1 expression without altering KEAP1 abundance (Figure 5E and F). As a master regulator of cellular antioxidant responses, upregulated Nrf2 enhanced oxidative stress resistance in CCA cells, suppressed apoptosis, and promoted tumor progression (Figure 5G and H).
To definitively establish whether MCM3 serves as the critical downstream effector through which IQGAP1 promotes CCA progression, we performed a series of rescue experiments in HUCCT1 cells. We concurrently overexpressed IQGAP1 and knocked down MCM3 (Supplementary Figure 5A and B), aiming to determine if depleting MCM3 could counteract the oncogenic phenotypes induced by IQGAP1. Our results consistently demonstrated that MCM3 knockdown effectively reversed the anti-apoptotic effects of IQGAP1. Both TUNEL staining and flow cytometry analysis confirmed that the suppression of apoptosis by IQGAP1 was rescued upon MCM3 inhibition (Figure 6A and B, Supplementary Figure 5C). Similarly, in functional proliferation assays, including CCK-8, EdU incorporation, and colony formation, the enhanced proliferative capacity driven by IQGAP1 OE was markedly attenuated when MCM3 was knocked down (Figure 6C-E, Supplementary Figure 5D and E). Furthermore, the pro-metastatic role of IQGAP1 was also found to be MCM3-dependent. Transwell and wound healing assays showed that the increased migratory and invasive capacities conferred by IQGAP1 were substantially abolished by concurrent MCM3 knockdown (Figure 6F and G, Supplementary Figure 5F and G). In summary, this comprehensive set of rescue experiments confirms that the oncogenic functions of IQGAP1, including inhibiting apoptosis, promoting proliferation, and enhancing migration, are critically dependent on MCM3. These findings solidify the conclusion that IQGAP1 drives CCA progression primarily by modulating MCM3.
To explore the function of IQGAP1 and MCM3 in vivo, we established xenotransplantation models by subcutaneously injecting appropriate amounts of cells transfected with viruses into nude mice (Figure 7A). The final results showed that OE of IQGAP1 significantly promoted tumor growth, while downregulation of MCM3 reversed tumor growth induced by OE of IQGAP1 (Figure 7B and C). Immunohistochemical staining of subcutaneous tumors showed that MCM3 content was up-regulated and tumor proliferation index was increased in the IQGAP1 OE group (Figure 7D). In summary, these results suggested that IQGAP1 promoted CCA growth by regulating MCM3 in vivo.
CCA is a highly lethal biliary tract malignancy with rising global incidence and persistently dismal 5-years overall survival, limited by few early diagnostic markers, high chemoresistance, and incomplete understanding of its molecular pathogenesis. Dysregulated redox homeostasis is a well-established hallmark of CCA, enabling tumor cells to survive and proliferate in the highly oxidative tumor microenvironment[24-26]; however, the upstream regulatory networks linking scaffold protein signaling to redox balance in CCA remain largely uncharacterized. The scaffold protein IQGAP1 is implicated as an oncogene in multiple solid tumors, but its specific biological function, detailed molecular mechanism, and clinical relevance in CCA have never been systematically elucidated. In this study, we identified and functionally validated a previously unrecognized IQGAP1/USP28/MCM3/Nrf2 regulatory axis that drives CCA progression by tuning cellular redox homeostasis, filling a critical knowledge gap in CCA pathogenesis, particularly for the high-incidence Chinese population.
Emerging evidence has established the pivotal oncogenic role of IQGAP1 in breast cancer, colorectal cancer, and hepatocellular carcinoma, where it modulates cell proliferation, migration, invasion, and cytoskeletal organization[13,27,28]. However, unlike in these well-studied malignancies, the oncogenic potential of IQGAP1 in CCA has not been explored in previous research. Our study is the first to systematically characterize the role of IQGAP1 in CCA: We validated the significant upregulation of IQGAP1 in CCA tissues using four independent public datasets, and through integrated loss- and gain-of-function assays, we demonstrated that IQGAP1 exerts potent pro-proliferative, pro-migratory, and anti-apoptotic effects in CCA cells, confirming its conserved oncogenic function in solid tumors. Notably, we identified MCM3 as a novel downstream interacting partner of IQGAP1 for the first time, expanding the functional scope of IQGAP1 beyond its well-documented role in cytoskeletal regulation.
MCM3, a core component of the minichromosome maintenance complex essential for eukaryotic DNA replication initiation, has been reported to be upregulated in multiple malignancies and linked to tumor progression, poor prognosis, and therapeutic resistance[12-16]. However, its expression pattern, biological function, and upstream regulatory mecha
The Nrf2/KEAP1 axis is the master regulator of cellular redox homeostasis, and its dysregulation is a central driver of CCA pathogenesis, conferring tumor cells with enhanced antioxidant capacity, apoptosis resistance, and chemoresistance[29-31]. However, the upstream regulatory mechanisms of Nrf2 in CCA, particularly the crosstalk between DNA replication-related proteins and the Nrf2 pathway, remain poorly defined. A recent study by Li et al[23] reported that MCM3 competes with Nrf2 for KEAP1 binding, thereby stabilizing Nrf2 and activating antioxidant signaling in bone metabolism. Our study is the first to extend this mechanistic paradigm to cancer research: We show that in CCA cells, IQGAP1-stabilized MCM3 binds to KEAP1 and blocks its interaction with Nrf2, thus inhibiting Nrf2 ubiquitination and degradation, activating the transcription of Nrf2 downstream antioxidant genes, alleviating intracellular ROS accumulation, and suppressing oxidative stress-induced apoptosis. From a pathophysiological perspective, this finding provides a novel mechanistic explanation for the adaptive survival of CCA cells: CCA is characterized by a highly oxidative tumor microenvironment, and our data establish that IQGAP1 upregulation, which we report for the first time in this malig
From a clinical perspective, our findings offer meaningful translational implications for CCA management. As the first study to systematically characterize the oncogenic role of IQGAP1 in CCA, our work provides novel mechanistic insights into CCA pathogenesis, particularly given the well-documented regional differences in the molecular characteristics of this malignancy; clinically, IQGAP1 may serve as a candidate prognostic biomarker for CCA given its association with aggressive tumor phenotypes, while the IQGAP1/MCM3/Nrf2 axis we identified may hold potential as a reference for developing targeted therapeutic strategies for CCA, especially for patients with Nrf2 activation and resistance to conventional gemcitabine-based chemotherapy, for whom effective treatment options remain limited. Despite these advances, several limitations of our study must be acknowledged: (1) Our findings were validated mainly using in vitro CCA cell lines and in vivo subcutaneous xenograft models, which cannot fully recapitulate the complex tumor microenvironment and immune context of human CCA; (2) We have not validated the prognostic value of the IQGAP1/MCM3/Nrf2 axis in a large-scale clinical CCA cohort; and (3) The preclinical therapeutic potential of targeting this axis has not been systematically evaluated. In addition, our study focused on the redox regulatory axis downstream of IQGAP1, while other potential oncogenic signaling pathways mediated by IQGAP1 in CCA remain to be explored. These limitations, alongside the persistent unmet clinical needs in CCA management, also highlight clear and actionable directions for future research: (1) Large-scale multi-center clinical studies are warranted to validate the prognostic and predictive value of this axis in CCA patients; (2) The therapeutic efficacy of targeting IQGAP1, USP28, or the MCM3-KEAP1 interaction, either as monotherapy or in combination with conventional chemotherapy or immune checkpoint inhibitors, should be systematically evaluated in preclinical CCA models including patient-derived organoids and patient-derived xenografts; (3) The role of this axis in other hepatobiliary malignancies such as hepatocellular carcinoma and gallbladder cancer should be investigated to determine whether it represents a shared oncogenic mechanism in digestive system malignancies; and (4) Single-cell and spatial transcriptomic studies are needed to explore the cell-type-specific expression of this axis in CCA tissues and its crosstalk with the tumor microenvironment.
Taken together, our study is the first to establish IQGAP1 as a key oncogenic driver in CCA, acting via the USP28/MCM3/Nrf2 axis to modulate redox homeostasis and promote tumor progression. These findings not only break new ground in our fundamental understanding of CCA pathogenesis, but also provide a novel prognostic biomarker and actionable therapeutic target for this devastating malignancy.
| 1. | Razumilava N, Gores GJ. Cholangiocarcinoma. Lancet. 2014;383:2168-2179. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1509] [Cited by in RCA: 1499] [Article Influence: 124.9] [Reference Citation Analysis (8)] |
| 2. | Banales JM, Rodrigues PM, Affò S, Andersen JB, Aspichueta P, Boulter L, Bridgewater J, Calvisi DF, Cardenas A, Cardinale V, Carpino G, Coulouarn C, Dopazo C, Edeline J, Fabris L, Folseraas T, Forner A, Goeppert B, Heikenwalder M, Kendall TJ, Khan SA, Klümpen HJ, Koerkamp BG, Lamarca A, Lindsey S, Lleo A, Luedde T, Macias RIR, Morement H, Nault JC, Olaizola P, Perugorria MJ, Raggi C, Rimassa L, Saborowski A, Valle JW, Vithayathil M, Vogel A, Braconi C; International CCA Consensus Consortium. Cholangiocarcinoma 2026: status quo, unmet needs and priorities. Nat Rev Gastroenterol Hepatol. 2026;23:65-96. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 7] [Cited by in RCA: 43] [Article Influence: 43.0] [Reference Citation Analysis (5)] |
| 3. | Ilyas SI, Gores GJ. Pathogenesis, diagnosis, and management of cholangiocarcinoma. Gastroenterology. 2013;145:1215-1229. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1086] [Cited by in RCA: 1035] [Article Influence: 79.6] [Reference Citation Analysis (7)] |
| 4. | Ilyas SI, Affo S, Goyal L, Lamarca A, Sapisochin G, Yang JD, Gores GJ. Cholangiocarcinoma - novel biological insights and therapeutic strategies. Nat Rev Clin Oncol. 2023;20:470-486. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 45] [Cited by in RCA: 176] [Article Influence: 58.7] [Reference Citation Analysis (1)] |
| 5. | Izquierdo-Sanchez L, Lamarca A, La Casta A, Buettner S, Utpatel K, Klümpen HJ, Adeva J, Vogel A, Lleo A, Fabris L, Ponz-Sarvise M, Brustia R, Cardinale V, Braconi C, Vidili G, Jamieson NB, Macias RI, Jonas JP, Marzioni M, Hołówko W, Folseraas T, Kupčinskas J, Sparchez Z, Krawczyk M, Krupa Ł, Scripcariu V, Grazi GL, Landa-Magdalena A, Ijzermans JN, Evert K, Erdmann JI, López-López F, Saborowski A, Scheiter A, Santos-Laso A, Carpino G, Andersen JB, Marin JJ, Alvaro D, Bujanda L, Forner A, Valle JW, Koerkamp BG, Banales JM. Cholangiocarcinoma landscape in Europe: Diagnostic, prognostic and therapeutic insights from the ENSCCA Registry. J Hepatol. 2022;76:1109-1121. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 296] [Cited by in RCA: 275] [Article Influence: 68.8] [Reference Citation Analysis (3)] |
| 6. | Valle J, Wasan H, Palmer DH, Cunningham D, Anthoney A, Maraveyas A, Madhusudan S, Iveson T, Hughes S, Pereira SP, Roughton M, Bridgewater J; ABC-02 Trial Investigators. Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. N Engl J Med. 2010;362:1273-1281. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3702] [Cited by in RCA: 3421] [Article Influence: 213.8] [Reference Citation Analysis (7)] |
| 7. | Good MC, Zalatan JG, Lim WA. Scaffold proteins: hubs for controlling the flow of cellular information. Science. 2011;332:680-686. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 768] [Cited by in RCA: 683] [Article Influence: 45.5] [Reference Citation Analysis (0)] |
| 8. | Smith JM, Hedman AC, Sacks DB. IQGAPs choreograph cellular signaling from the membrane to the nucleus. Trends Cell Biol. 2015;25:171-184. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 101] [Cited by in RCA: 129] [Article Influence: 11.7] [Reference Citation Analysis (0)] |
| 9. | Brown MD, Sacks DB. IQGAP1 in cellular signaling: bridging the GAP. Trends Cell Biol. 2006;16:242-249. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 259] [Cited by in RCA: 248] [Article Influence: 12.4] [Reference Citation Analysis (1)] |
| 10. | Wei T, Choi S, Buehler D, Anderson RA, Lambert PF. A PI3K/AKT Scaffolding Protein, IQ Motif-Containing GTPase Associating Protein 1 (IQGAP1), Promotes Head and Neck Carcinogenesis. Clin Cancer Res. 2020;26:301-311. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 20] [Cited by in RCA: 22] [Article Influence: 3.7] [Reference Citation Analysis (0)] |
| 11. | Cerutti C, Lucotti S, Menendez ST, Reymond N, Garg R, Romero IA, Muschel R, Ridley AJ. IQGAP1 and NWASP promote human cancer cell dissemination and metastasis by regulating β1-integrin via FAK and MRTF/SRF. Cell Rep. 2024;43:113989. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1] [Cited by in RCA: 7] [Article Influence: 3.5] [Reference Citation Analysis (0)] |
| 12. | Xiong Z, Zhuang RL, Yu SL, Xie ZX, Peng SR, Li ZA, Li BH, Xie JJ, Li YN, Li KW, Huang H. Cancer-associated fibroblasts regulate mitochondrial metabolism and inhibit chemosensitivity via ANGPTL4-IQGAP1 axis in prostate cancer. J Adv Res. 2025;75:663-678. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 23] [Cited by in RCA: 26] [Article Influence: 26.0] [Reference Citation Analysis (0)] |
| 13. | Hu HF, Gao GB, He X, Li YY, Li YJ, Li B, Pan Y, Wang Y, He QY. Targeting ARF1-IQGAP1 interaction to suppress colorectal cancer metastasis and vemurafenib resistance. J Adv Res. 2023;51:135-147. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1] [Cited by in RCA: 18] [Article Influence: 6.0] [Reference Citation Analysis (0)] |
| 14. | Liang Z, Yang Y, He Y, Yang P, Wang X, He G, Zhang P, Zhu H, Xu N, Zhao X, Liang S. SUMOylation of IQGAP1 promotes the development of colorectal cancer. Cancer Lett. 2017;411:90-99. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 27] [Cited by in RCA: 44] [Article Influence: 4.9] [Reference Citation Analysis (0)] |
| 15. | Han X, Mayca Pozo F, Wisotsky JN, Wang B, Jacobberger JW, Zhang Y. Phosphorylation of Minichromosome Maintenance 3 (MCM3) by Checkpoint Kinase 1 (Chk1) Negatively Regulates DNA Replication and Checkpoint Activation. J Biol Chem. 2015;290:12370-12378. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 21] [Cited by in RCA: 32] [Article Influence: 2.9] [Reference Citation Analysis (0)] |
| 16. | Yang Q, Xie B, Tang H, Meng W, Jia C, Zhang X, Zhang Y, Zhang J, Li H, Fu B. Minichromosome maintenance 3 promotes hepatocellular carcinoma radioresistance by activating the NF-κB pathway. J Exp Clin Cancer Res. 2019;38:263. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 14] [Cited by in RCA: 43] [Article Influence: 6.1] [Reference Citation Analysis (0)] |
| 17. | Yu S, Wang G, Shi Y, Xu H, Zheng Y, Chen Y. MCMs in Cancer: Prognostic Potential and Mechanisms. Anal Cell Pathol (Amst). 2020;2020:3750294. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 22] [Cited by in RCA: 62] [Article Influence: 10.3] [Reference Citation Analysis (0)] |
| 18. | Raja R, Shetty DC, Chandrakanta, Juneja S, Tandon A, Gulati N. MCM3 proliferative index is worthier over Ki-67 in the characterization of salivary gland tumors. Indian J Pathol Microbiol. 2021;64:22-27. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 5] [Reference Citation Analysis (0)] |
| 19. | Gao Z, Man X, Li Z, Bi J, Liu X, Li Z, Li J, Zhang Z, Kong C. PLK1 promotes proliferation and suppresses apoptosis of renal cell carcinoma cells by phosphorylating MCM3. Cancer Gene Ther. 2020;27:412-423. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 30] [Cited by in RCA: 40] [Article Influence: 6.7] [Reference Citation Analysis (0)] |
| 20. | Zhang DD, Hannink M. Distinct cysteine residues in Keap1 are required for Keap1-dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by chemopreventive agents and oxidative stress. Mol Cell Biol. 2003;23:8137-8151. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1032] [Cited by in RCA: 1217] [Article Influence: 52.9] [Reference Citation Analysis (1)] |
| 21. | Wan ZH, Jiang TY, Shi YY, Pan YF, Lin YK, Ma YH, Yang C, Feng XF, Huang LF, Kong XN, Ding ZW, Tan YX, Dong LW, Wang HY. RPB5-Mediating Protein Promotes Cholangiocarcinoma Tumorigenesis and Drug Resistance by Competing With NRF2 for KEAP1 Binding. Hepatology. 2020;71:2005-2022. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 13] [Cited by in RCA: 20] [Article Influence: 3.3] [Reference Citation Analysis (0)] |
| 22. | Chen Q, Li W, Wan Y, Xia X, Wu Q, Chen Y, Lai Z, Yu C, Li W. Amplified in breast cancer 1 enhances human cholangiocarcinoma growth and chemoresistance by simultaneous activation of Akt and Nrf2 pathways. Hepatology. 2012;55:1820-1829. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 48] [Cited by in RCA: 58] [Article Influence: 4.1] [Reference Citation Analysis (0)] |
| 23. | Li J, Zhang J, Xue Q, Liu B, Qin R, Li Y, Qiu Y, Wang R, Goltzman D, Miao D, Yang R. Pyrroloquinoline quinone alleviates natural aging-related osteoporosis via a novel MCM3-Keap1-Nrf2 axis-mediated stress response and Fbn1 upregulation. Aging Cell. 2023;22:e13912. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 38] [Reference Citation Analysis (0)] |
| 24. | Thanee M, Dokduang H, Kittirat Y, Phetcharaburanin J, Klanrit P, Titapun A, Namwat N, Khuntikeo N, Wangwiwatsin A, Saya H, Loilome W. CD44 modulates metabolic pathways and altered ROS-mediated Akt signal promoting cholangiocarcinoma progression. PLoS One. 2021;16:e0245871. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 3] [Cited by in RCA: 18] [Article Influence: 3.6] [Reference Citation Analysis (0)] |
| 25. | Yang Y, Cao X, Wang Y, Wu X, Zhou P, Miao L, Deng X. Neurokinin-1 receptor antagonist aprepitant regulates autophagy and apoptosis via ROS/JNK in intrahepatic cholangiocarcinoma. Liver Int. 2024;44:1651-1667. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 7] [Cited by in RCA: 8] [Article Influence: 4.0] [Reference Citation Analysis (0)] |
| 26. | Xiong Z, Yang L, Zhang C, Huang W, Zhong W, Yi J, Feng J, Zouxu X, Song L, Wang X. MANF facilitates breast cancer cell survival under glucose-starvation conditions via PRKN-mediated mitophagy regulation. Autophagy. 2025;21:80-101. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 4] [Cited by in RCA: 32] [Article Influence: 32.0] [Reference Citation Analysis (0)] |
| 27. | White CD, Li Z, Dillon DA, Sacks DB. IQGAP1 protein binds human epidermal growth factor receptor 2 (HER2) and modulates trastuzumab resistance. J Biol Chem. 2011;286:29734-29747. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 35] [Cited by in RCA: 38] [Article Influence: 2.5] [Reference Citation Analysis (0)] |
| 28. | He C, Jaffar Ali D, Qi Y, Li Y, Sun B, Liu R, Sun B, Xiao Z. Engineered extracellular vesicles mediated CRISPR-induced deficiency of IQGAP1/FOXM1 reverses sorafenib resistance in HCC by suppressing cancer stem cells. J Nanobiotechnology. 2023;21:154. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 33] [Reference Citation Analysis (0)] |
| 29. | Caligiuri A, Becatti M, Porro N, Borghi S, Marra F, Pastore M, Taddei N, Fiorillo C, Gentilini A. Oxidative Stress and Redox-Dependent Pathways in Cholangiocarcinoma. Antioxidants (Basel). 2023;13:28. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1] [Cited by in RCA: 12] [Article Influence: 4.0] [Reference Citation Analysis (0)] |
| 30. | Fan H, Qiu P, Lu Y, Deng Z, Tian L. An oxidative stress related gene signature predicts prognosis in cholangiocarcinoma. Discov Oncol. 2025;16:1576. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1] [Cited by in RCA: 2] [Article Influence: 2.0] [Reference Citation Analysis (0)] |
| 31. | Kaewlert W, Sakonsinsiri C, Lert-Itthiporn W, Ungarreevittaya P, Pairojkul C, Pinlaor S, Murata M, Thanan R. Overexpression of Insulin Receptor Substrate 1 (IRS1) Relates to Poor Prognosis and Promotes Proliferation, Stemness, Migration, and Oxidative Stress Resistance in Cholangiocarcinoma. Int J Mol Sci. 2023;24:2428. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 12] [Cited by in RCA: 13] [Article Influence: 4.3] [Reference Citation Analysis (0)] |