BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Gastrointest Oncol. Jun 15, 2026; 18(6): 118678
Published online Jun 15, 2026. doi: 10.4251/wjgo.v18.i6.118678
Hsa_circ_0003848 promotes gastric cancer via miR-144-3p/mesenchymal-epithelial transition factor and serves as a plasma biomarker in Helicobacter pylori infection
Zhe Li, Bo Zhang, Ke-Feng Hu, Department of Gastroenterology, The First Affiliated Hospital of Ningbo University, Ningbo 315010, Zhejiang Province, China
Chun-Li Cao, The Second Affiliated Hospital of Jiaxing University, Jiaxing 314000, Zhejiang Province, China
ORCID number: Zhe Li (0000-0002-1359-4317); Ke-Feng Hu (0000-0002-5546-5230).
Author contributions: Li Z was responsible for collection and assembly of data; Li Z, Zhang B and Hu KF were responsible for provision of study materials or patients, prepared figures; Li Z, Zhang B and Cao CL were responsible for data analysis and interpretation, wrote the main manuscript text, performed experiments and verified the results; Li Z and Cao CL were responsible for administrative support; all authors were responsible for conception and design, reviewed the manuscript and approved the final version to be published.
Supported by Medical and Health Research Project of Zhejiang Province, No. 2023RC262 and No. 2024KY1491; and Ningbo Top Medical and Health Research Program, No. 2023020612.
Institutional review board statement: This study was approved by the Ethics Committee of the First Affiliated Hospital of Ningbo University, No. 2023176A-02.
Conflict-of-interest statement: All authors declare no conflict of interest in publishing the manuscript.
Data sharing statement: All data generated or analyzed during this study are included in this published article.
Corresponding author: Chun-Li Cao, MD, The Second Affiliated Hospital of Jiaxing University, 1518 Huancheng North Road, Jiaxing 314000, Zhejiang Province, China. liswan95@foxmail.com
Received: January 9, 2026
Revised: February 2, 2026
Accepted: March 19, 2026
Published online: June 15, 2026
Processing time: 152 Days and 7.4 Hours

Abstract
BACKGROUND

As non-coding RNA molecules, circular RNAs exhibit high stability and tissue-specific expression, and accumulating evidence indicates their critical roles in the progression and prognosis of gastric cancer (GC). However, the functional mechanisms of many circular RNAs remain unclear. This study focuses on hsa_circ_0003848, exploring its involvement in malignant GC phenotypes and its underlying molecular signaling, particularly in the context of Helicobacter pylori (H. pylori) infection. The experimental strategy combines loss-of-function and gain-of-function approaches.

AIM

To investigate the hsa_circ_0003848’s oncogenic role and biomarker potential in H. pylori-positive GC.

METHODS

Expression of hsa_circ_0003848 was detected in paired GC tissues, adjacent non-tumor tissues, and plasma from GC patients/healthy controls. Bioinformatics analysis was performed to predict target miRNAs. SiRNA-mediated hsa_circ_0003848 knockdown was achieved in GC cells, followed by cell counting kit-8, wound-healing/Transwell migration and apoptosis assays. Dual-luciferase reporter and AGO2-RIP assays were conducted to validate RNA interactions; mesenchymal-epithelial transition factor (MET)-overexpression rescue experiments were performed to confirm the functional axis.

RESULTS

Hsa_circ_0003848 was significantly upregulated in both GC tissues and plasma, with particularly elevated levels in H. pylori-positive patients, demonstrating strong diagnostic potential (e.g., high area under the curve in receiver operating characteristic analysis). Knockdown of hsa_circ_0003848 suppressed GC cell proliferation and migration while inducing apoptosis. Mechanistically, hsa_circ_0003848 functioned as a competing endogenous RNA by directly binding to and sequestering hsa-miR-144-3p, thereby relieving miR-144-3p-mediated repression of MET. Overexpression of MET effectively reversed the anti-migratory effects caused by hsa_circ_0003848 silencing, confirming the hsa_circ_0003848/miR-144-3p/MET regulatory axis.

CONCLUSION

Hsa_circ_0003848 promotes GC by sponging miR-144-3p to upregulate MET, showing promise as a non-invasive biomarker and therapeutic target, especially in H. pylori-positive cases.

Key Words: Hsa_circ_0003848; Gastric cancer; Biomarkers; Competing endogenous RNA network; MiR-144-3p/mesenchymal-epithelial transition factor axis

Core Tip: Hsa_circ_0003848 is significantly upregulated in gastric cancer, particularly in Helicobacter pylori-positive cases, and functions as an oncogenic competing endogenous RNA by sponging miR-144-3p to activate mesenchymal-epithelial transition factor signaling. Its detectable elevation in plasma highlights its dual potential as a non-invasive diagnostic biomarker and a promising therapeutic target.



INTRODUCTION

Gastric cancer (GC) is the fifth most diagnosed malignancy and the fourth leading cause of cancer-related death worldwide[1]. The global burden of GC is expected to increase by 62% by 2040, posing major public health challenges[2]. The highest incidence occurs in East Asia, particularly China and Japan, which together account for more than half of new cases globally. Key risk factors include Helicobacter pylori (H. pylori) infection, smoking, alcohol consumption, and intake of preserved foods. Frequently mutated genes in GC include TP53, LRP1B, and ARID1A[3,4]. According to GLOBOCAN statistics, China contributes 37.0% of new GC cases and 39.5% of GC-related deaths globally, the highest among all nations[5]. National prevention strategies primarily rely on the eradication of H. pylori and endoscopic screening[5]. Despite progress in treatment, the prognosis of advanced GC remains poor due to the lack of early clinical symptoms and limited efficacy of current therapies in late-stage or metastatic disease[6]. Therefore, identifying novel biomarkers and therapeutic targets is crucial for early diagnosis and improved prognosis.

Circular RNAs (circRNAs) are covalently closed single-stranded RNAs produced by back-splicing of precursor mRNAs, lacking a 5′ m7G cap and 3′ poly(A) tail. Based on their sequence origin, circRNAs are classified as exonic, intronic, or exon-intron circRNAs, with the exonic form being most prevalent[7]. Advances in sequencing technologies and functional databases have revealed the diversity and cancer-associated roles of circRNAs[8-10]. CircRNAs can function as miRNA sponges, regulate RNA-binding proteins, and even encode proteins, thereby modulating GC progression and therapeutic resistance[10,11].

A well-characterized mechanism is the competing endogenous RNA (ceRNA) model, in which circRNAs act as miRNA sponges to regulate downstream mRNA targets via 3′ untranslated region binding[12,13]. CircRNAs also affect the localization and stability of RNA-binding proteins, influencing gene transcription, protein interactions, and key cellular processes[14,15]. Although traditionally considered non-coding RNAs, circRNAs have been shown to be translatable via non-canonical pathways such as internal ribosome entry sites, m6A-modified internal ribosome entry sites, and rolling-circle amplification, despite lacking classical translation elements[16,17].

Recent studies have identified specific circRNAs associated with GC development, progression, and prognosis. For example, circCSPP1 and circBIRC6 are overexpressed in GC and associated with tumor aggressiveness and poor outcomes[18,19]. Moreover, silencing of circRHBDD1 enhances anti-tumor immune responses[20]. These findings highlight the potential of circRNAs as diagnostic biomarkers and therapeutic targets in GC[21].

In our previous study, we identified differentially expressed circRNAs in GC using high-throughput sequencing[22,23]. Among them, hsa_circ_0003848 was selected for further investigation. We quantified its expression in plasma and tissues and explored its regulatory effects on GC cell behavior. Bioinformatics prediction and validation identified hsa-miR-144-3p and mesenchymal-epithelial transition factor (MET) as potential downstream effectors, suggesting a novel circRNA-miRNA-mRNA axis involved in GC pathogenesis.

MATERIALS AND METHODS
Clinical samples

From 2019 to 2023, advanced GC tissues and matched adjacent normal tissues, along with preoperative and postoperative plasma samples, were collected from patients at the First Affiliated Hospital of Ningbo University. Additionally, plasma samples were obtained from 30 healthy individuals, 60 patients with precancerous gastric lesions, and 60 patients with early-stage GC. All samples were pathologically confirmed. The study was approved by the Ethics Committee of the First Affiliated Hospital of Ningbo University (No. 2023176A-02), and written informed consent was obtained from all participants.

Cell lines

Human GC cell lines (AGS, HGC-27, NCI-N87, MGC-803, SGC-7901, BGC-823) were purchased from Haixing Biotechnology Co., Ltd (Jiangsu Province, China). Normal gastric epithelial cells (GES-1) and HEK-293T cells were purchased from Procell Biotechnology Co., Ltd (Hubei Province, China).

Bioinformatics analysis

To identify candidate circRNAs involved in H. pylori-associated gastric carcinogenesis, we retrieved public circRNA expression profiles from the Gene Expression Omnibus database. These datasets contain paired GC tissues and chronic gastritis tissues. Moreover, the GSE183628 dataset includes the infection status of H. pylori in GC tissues and chronic gastritis tissues. Differential expression analysis was performed using the ‘limma’ R package to compare GC tissues against their corresponding non-tumor counterparts. The screening criteria were set at a fold change |log 2FC| > 1.0 and an adjusted P < 0.05. By intersecting the significantly upregulated circRNAs across these H. pylori-related datasets, hsa_circ_0003848 was identified as a key candidate for further clinical and functional validation in this study.

RNA stability and circularity characterization

To confirm the circular structure of hsa_circ_0003848, total RNA was subjected to RNase R digestion (37 °C, 30 minutes). Resistance to this exonuclease, compared to the degradation of linear PSEN1, verified circularity. Additionally, an oligo (dT) priming assay was performed; the lack of a 3’ poly(A) tail in hsa_circ_0003848 resulted in significantly lower reverse transcription efficiency compared to random hexamer priming. For stability assessment, cells were treated with actinomycin D (2 μg/mL) to inhibit transcription. Hsa_circ_0003848 exhibited a significantly longer half-life (> 24 hours) than linear PSEN1 (< 8 hours), demonstrating its superior transcript stability.

RNA extraction and cDNA synthesis

Total RNA was extracted from tissues, plasma, and cells using Trizol LS according to the manufacturer’s instructions. RNA purity and concentration were assessed using a spectrophotometer (A260/A280 ratio: 1.8-2.0). For cDNA synthesis, 2 μg RNA was reversely transcribed using the GoScript™ Reverse Transcription System (Promega, Madison, WI, United States) under the following conditions: (1) 25 °C for 5 minutes; (2) 42 °C for 60 minutes; and (3) 70 °C for 15 minutes.

Real-time quantitative PCR

Real-time quantitative PCR (qRT-PCR) was performed on a QuantStudio 3 Real-Time PCR system using SYBR Green Master Mix (Promega, Madison, WI, United States). Primer sequences are listed in Table 1. Data were analyzed using the 2-ΔΔCt method, with GAPDH as the internal control.

Table 1 Primer sequences.
Gene name
Sequence (5’-3’)
Hsa_circ_0003848Forward: CAGTTGCTCCAATGACAGAGT
Reverse: CCCAGATTAGGTCTGGCTACG
GAPDHForward: AAGGTGAAGGTCGGAGTCAA
Reverse: AATGAAGGGGTCATTGATGG
PSEN1Forward: GCAGTATCCTCGCTGGTGAAGA
Reverse: CAGGCTATGGTTGTGTTCCAGTC
PTENForward: TGAGTTCCCTCAGCCGTTACCT
Reverse: GAGGTTTCCTCTGGTCCTGGTA
ARID1AForward: AAGCCACCAACTCCAGCATCCA
Reverse: CGCTTCTGGAATGTGGAGTCAC
EZH2Forward: GACCTCTGTCTTACTTGTGGAGC
Reverse: CGTCAGATGGTGCCAGCAATAG
KPNA2Forward: CTGTTGGCTCTCCTTGCAGTTC
Reverse: GCAGGATTCTTGTTGCGGCAAAG
METForward: TGCACAGTTGGTCCTGCCATGA
Reverse: CAGCCATAGGACCGTATTTCGG
ZEB1Forward: GGCATACACCTACTCAACTACGG
Reverse: TGGGCGGTGTAGAATCAGAGTC
Functional assays

Cell proliferation (cell counting kit-8 assay): (1) Cells (1 × 10³/well) were seeded in 96-well plates; and (2) Absorbance was measured at 450 nm following cell counting kit-8 incubation.

Cell migration (Transwell assay): (1) Cells (2 × 104/well) were plated in serum-free medium; and (2) Migrated cells were stained with 0.1% crystal violet.

Flow cytometry: (1) Apoptosis was measured using annexin V-fluorescein isothiocyanate/propidium iodide staining; and (2) Cell cycle distribution was analyzed by propidium iodide/RNase staining.

Dual-luciferase reporter assay

HEK-293T cells were co-transfected with wild-type or mutant plasmids and miRNA mimics. Luciferase activity was measured using the Dual-Luciferase® Reporter Assay System (Promega).

Western blot

Total proteins were extracted using radio immunoprecipitation assay buffer and quantified by the BCA method. Protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes. After blocking, membranes were incubated with primary antibodies against MET (1:1000) and GAPDH (1:5000). The bands were visualized using an ECL detection system. To provide a quantitative assessment, densitometric analysis was performed using ImageJ software. The integrated optical density of each MET band was measured and normalized to the corresponding GAPDH band as an internal loading control. Data from three independent biological replicates were used for statistical analysis.

RNA immunoprecipitation

RNA immunoprecipitation (RIP) was conducted using the Magna RIP Kit (Merck) with argonaute2 (AGO2) antibodies. Precipitated RNA was analyzed by qRT-PCR.

Statistical analysis

Data are presented as mean ± SD. Statistical significance was assessed using Student’s t-test or analysis of variance (GrapHpad Prism 10). Significance was denoted with superscripted alphabetical letters: aP < 0.05, bP < 0.01, cP < 0.001 vs the control group.

RESULTS
Identification and characterization of hsa_circ_0003848

By intersecting differentially expressed circRNAs from our RNA sequencing data (GC vs adjacent normal tissues) with three independent Gene Expression Omnibus datasets (GSE183628, GSE163416, and GSE78092), we identified hsa_circ_0003848 as a novel GC-associated circRNA (Figure 1A). This circRNA, derived from exons 2-3 of the PSEN1 gene (chr14:73614502-73614814, 222 nt), exhibited significant upregulation in GC (Figure 1B). Sanger sequencing confirmed its back-spliced junction (Figure 1C). Resistance to oligo (dT)-based reverse transcription confirmed its circularity (Figure 1D). Actinomycin D treatment revealed superior stability of hsa_circ_0003848 compared to linear PSEN1 (half-life > 24 hours vs < 8 hours) (Figure 1E). Subcellular localization analysis showed cytoplasmic enrichment in GC cells (Figure 1F).

Figure 1
Figure 1 Identification and basic features of hsa_circ_0003848 in gastric cancer. A: Venn diagram showing overlapping differentially expressed circular RNAs across datasets; B: Schematic of hsa_circ_0003848 derived from exons 2-3 of PSEN1; C: Sanger sequencing confirming the back-splice junction; D: Real-time quantitative PCR using random and oligo (dT) primers showing the circular nature of hsa_circ_0003848; E: RNA stability assay indicating that hsa_circ_0003848 is more stable than linear PSEN1; F: Subcellular localization showing cytoplasmic enrichment of hsa_circ_0003848. n = 3.
Diagnostic potential of hsa_circ_0003848 in GC

We further investigated the expression pattern and diagnostic potential of hsa_circ_0003848 in GC tissues and plasma samples. The results revealed significant upregulation of hsa_circ_0003848 in GC tissues compared to adjacent normal tissues (P < 0.001; Figure 2A), with a corresponding area under the receiver operating characteristic curve (AUC) of 0.781, indicating moderate diagnostic accuracy (Figure 2B). In plasma, levels of hsa_circ_0003848 were significantly elevated in preoperative samples and markedly decreased 10 days after surgical resection (P < 0.001; Figure 2C), with an AUC of 0.769 (Figure 2D), suggesting its potential utility for postoperative monitoring.

Figure 2
Figure 2 Diagnostic potential of hsa_circ_0003848 in gastric cancer. A: Comparison of hsa_circ_0003848 expression between gastric cancer (GC) tissues and adjacent normal tissues, n = 72; B: Receiver operating characteristic curve analysis of hsa_circ_0003848 for distinguishing GC tissues from adjacent normal tissues (area under the receiver operating characteristic curve = 0.781); C: Expression levels of hsa_circ_0003848 in plasma samples collected before and 10 days after surgery, n = 72; D: Receiver operating characteristic curve analysis of hsa_circ_0003848 for detecting preoperative and postoperative GC (area under the receiver operating characteristic curve = 0.769); E: Expression of hsa_circ_0003848 in plasma samples from healthy controls and Helicobacter pylori (H. pylori)-infected individuals; F: Expression levels of hsa_circ_0003848 across different groups: Healthy, benign lesions + H. pylori (+), and early gastric cancer + H. pylori (+), showing progressive upregulation in H. pylori-related gastric conditions. Healthy, n = 30; precancerous lesions, n = 60; early GC, n = 60, cP < 0.001. AUC: Area under the receiver operating characteristic curve; BL: Benign lesions; EGC: Early gastric cancer; HP: Helicobacter pylori.

Notably, hsa_circ_0003848 also exhibited robust diagnostic performance in H. pylori-positive individuals. Plasma levels were significantly higher in H. pylori-infected subjects compared to healthy controls (P < 0.001; Figure 2E), with an AUC of 0.885, highlighting its sensitivity in identifying H. pylori-associated pathology. Moreover, a progressive increase in hsa_circ_0003848 expression was observed across the H. pylori-positive chronic gastritis [benign lesions + H. pylori (+)] and early GC [early gastric cancer + H. pylori (+)] groups (P < 0.001; Figure 2F), with statistically significant differences from healthy controls. These findings suggest that hsa_circ_0003848 may serve as a promising non-invasive biomarker for the early detection of H. pylori-related precancerous lesions and early-stage GC.

Correlation between hsa_circ_0003848 and clinical pathological features

To further evaluate the clinical significance of hsa_circ_0003848, we analyzed the association between its expression levels and the clinicopathological characteristics of 60 GC patients. As shown in Table 2, high expression of hsa_circ_0003848 was significantly correlated with advanced TNM stage (χ2 = 6.857, P = 0.009) and distal metastasis (χ2 = 5.813, P = 0.016). However, no significant correlation was observed with other clinical parameters, including age, gender, tumor location, tumor size, or differentiation. These findings suggest that hsa_circ_0003848 expression is closely linked to the malignant progression and metastatic potential of GC, rather than the initial tumor growth or basic patient demographics.

Table 2 Association between hsa_circ_0003848 expression and clinicopathological features of gastric cancer patients.
Characteristics
n
Low expression
High expression
χ2
P value
Age (years)< 602815130.0670.796
≥ 60321517
GenderMal3820180.0720.789
Female221012
TNM stageI and II251876.8570.009b
III and IV351223
Distal metastasisM0221665.8130.016a
M1381424
Tumor locationSinuses ventriculi4023171.8350.399
Cardia16610
Others422
Diameter (cm)≥ 52615110.2680.605
< 5341519
DifferentiationPoor2810180.7140.700
Moderate20812
Well1266
Functional role of hsa_circ_0003848 in GC cells

To elucidate the functional significance of hsa_circ_0003848 in GC, we first assessed its expression levels in gastric epithelial and cancer cell lines. The qRT-PCR revealed that hsa_circ_0003848 was significantly upregulated in multiple GC cell lines (AGS, MGC803, HGC-27, SGC-7901, and BGC-823) compared with the normal gastric epithelial cell line GES-1 (P < 0.001; Figure 3A). SiRNAs targeting hsa_circ_0003848 were transfected into GES-1, AGS, and HGC-27 cells, and knockdown efficiency was confirmed by qRT-PCR (siRNA2, P < 0.001; Figure 3B).

Figure 3
Figure 3 Effects of hsa_circ_0003848 on gastric cancer cell function. A: Real-time quantitative PCR shows higher expression of hsa_circ_0003848 in gastric cancer cells compared to normal GES-1 cells; B: Knockdown efficiency of hsa_circ_0003848 confirmed in GES-1, AGS, and HGC-27 cells using siRNAs; C: Cell counting kit-8 assay shows reduced proliferation in AGS and HGC-27 cells after knockdown; D: Colony formation assay indicates decreased clonogenic ability in AGS and HGC-27 after knockdown; E: Transwell assay shows reduced migration of gastric cancer cells after knockdown; F: Flow cytometry reveals increased apoptosis in AGS and HGC-27 cells after knockdown; G: Cell cycle analysis shows G1 phase arrest in AGS and HGC-27 cells after knockdown. n = 3, bP < 0.01, cP < 0.001. NC: Negative control.

Cell counting kit-8 assays demonstrated that knockdown of hsa_circ_0003848 significantly suppressed the proliferation of AGS and HGC-27 cells, whereas GES-1 cells showed no significant changes (P < 0.001; Figure 3C). Colony formation assays further confirmed that silencing hsa_circ_0003848 reduced the clonogenic capacity of AGS and HGC-27 cells (P < 0.001; Figure 3D).

In addition, Transwell migration assays revealed that the migratory ability of AGS and HGC-27 cells was markedly diminished upon hsa_circ_0003848 knockdown (P < 0.001; Figure 3E). Flow cytometry analysis showed an increased apoptotic rate in AGS and HGC-27 cells following knockdown (P < 0.001; Figure 3F), along with significant G1 phase arrest, indicating that hsa_circ_0003848 facilitates cell cycle progression (P < 0.001; Figure 3G).

Collectively, these findings suggest that hsa_circ_0003848 functions as an oncogenic circRNA in GC by promoting cell proliferation and migration, enhancing cell cycle progression, and inhibiting apoptosis.

Hsa_circ_0003848 sponges miR-144-3p to regulate MET

To elucidate the molecular mechanism by which hsa_circ_0003848 exerts its function in GC, we conducted a series of bioinformatics and experimental analyses. Venn diagram analysis integrating three prediction algorithms (miRanda, TargetScan, and CircInteractome) identified hsa-miR-144-3p as a potential miRNA target of hsa_circ_0003848 (Figure 4A). Dual-luciferase reporter assays confirmed direct interaction between hsa_circ_0003848 and hsa-miR-144-3p, as co-transfection of hsa-miR-144-3p mimics significantly reduced luciferase activity in cells transfected with the wild-type reporter but not the mutant reporter (P < 0.001; Figure 4B).

Figure 4
Figure 4 Hsa_circ_0003848 regulates mesenchymal-epithelial transition factor expression by sponging hsa-miR-144-3p. A: Venn diagram showing hsa-miR-144-3p as a shared predicted target of hsa_circ_0003848 across three databases; B: Dual-luciferase reporter assay confirming the direct binding between hsa_circ_0003848 and hsa-miR-144-3p; C: Venn diagram identifying mesenchymal-epithelial transition factor (MET) among six candidate genes potentially regulated by hsa-miR-144-3p; D: Knockdown of hsa_circ_0003848 reduced MET mRNA expression; E: Hsa-miR-144-3p directly binds to MET 3′UTR as confirmed by luciferase assay; F: Positive correlation between hsa_circ_0003848 and MET expression in gastric cancer tissues; G: Western blot showing decreased MET protein levels after silencing hsa_circ_0003848. Western blot analysis of MET protein levels following siRNA-mediated knockdown of hsa_circ_0003848. The bar chart represents the quantitative densitometry analysis relative to GAPDH (loading control) from three independent measurements; H: RNA immunoprecipitation assay showing both hsa_circ_0003848 and hsa-miR-144-3p are enriched in argonaute2 complexes. n = 3, bP < 0.01, cP < 0.001. AGO2: Argonaute2; IgG: Immunoglobulin G; MET: Mesenchymal-epithelial transition factor; NC: Negative control.

Further Venn analysis integrating validated and predicted targets of hsa-miR-144-3p revealed six candidate downstream genes (Figure 4C). Among these, knockdown of hsa_circ_0003848 by siRNA significantly decreased the mRNA levels of MET, while the other genes showed no notable change (P < 0.001; Figure 4D). Subsequent luciferase reporter assays demonstrated that hsa-miR-144-3p directly targets MET (P < 0.001; Figure 4E).

Correlation analysis of tissue samples revealed a positive association between hsa_circ_0003848 and MET expression (r = 0.5042, Figure 4F). Western blot analysis further confirmed that silencing hsa_circ_0003848 reduced MET protein levels (Figure 4G). Additionally, RIP assays using an anti-AGO2 antibody revealed that both hsa_circ_0003848 and hsa-miR-144-3p were enriched in AGO2-containing complexes, suggesting that hsa_circ_0003848 may act as a ceRNA to sponge hsa-miR-144-3p and regulate MET expression in an AGO2-dependent manner (P < 0.001; Figure 4H).

MET overexpression reversed the anti-migratory effects of hsa_circ_0003848 knockdown

To explore whether MET is a functional downstream effector of hsa_circ_0003848 in regulating GC cell migration, we conducted rescue experiments in AGS cells. Transwell migration assays demonstrated that knockdown of hsa_circ_0003848 significantly reduced cell migratory ability, confirming its pro-migratory role (P < 0.001; Figure 5A).

Figure 5
Figure 5 Mesenchymal-epithelial transition factor overexpression reverses the anti-migratory effects of hsa_circ_0003848 knockdown in gastric cancer cells. A: Transwell migration assays showing that knockdown of hsa_circ_0003848 significantly reduces AGS cell migration; B: Overexpression of hsa-miR-144-3p inhibits AGS cell migration, while inhibition of hsa-miR-144-3p promotes cell motility. Mesenchymal-epithelial transition factor overexpression reverses the migratory inhibition caused by hsa_circ_0003848 knockdown. ns, no significance, n = 3, cP < 0.001; C: Schematic model illustrating the proposed regulatory axis, where hsa_circ_0003848 functions as a competing endogenous RNA, sponging hsa-miR-144-3p to derepress mesenchymal-epithelial transition factor expression and enhance gastric cancer cell migration. MET: Mesenchymal-epithelial transition factor; NC: Negative control.

However, this inhibitory effect was effectively reversed upon MET overexpression, suggesting that MET is a key mediator of hsa_circ_0003848’s function. Parallel experiments manipulating hsa-miR-144-3p levels showed that overexpression of hsa-miR-144-3p markedly suppressed migration, while inhibition of this miRNA promoted cell motility (P < 0.001; Figure 5B). These results are consistent with our proposed mechanism in which hsa_circ_0003848 functions as a ceRNA, sponging hsa-miR-144-3p to prevent it from repressing MET expression. A schematic model summarizing this regulatory axis is presented to illustrate how hsa_circ_0003848 may enhance GC cell migration via the miR-144-3p/MET pathway (Figure 5C).

DISCUSSION

In this study, we identified hsa_circ_0003848 as a novel circRNA involved in the progression of GC. Our results demonstrate that hsa_circ_0003848 is significantly upregulated in GC tissues and plasma, and its expression correlates with key clinical features, suggesting its potential as a diagnostic biomarker for early-stage GC, particularly in H. pylori-infected individuals. Furthermore, functional assays revealed that hsa_circ_0003848 promotes GC cell proliferation, migration, and cell cycle progression while inhibiting apoptosis, underscoring its oncogenic role in GC.

Mechanistic studies revealed that hsa_circ_0003848 functions as a ceRNA by sponging hsa-miR-144-3p, thereby derepressing MET expression. MET, a receptor tyrosine kinase involved in cellular processes such as growth, survival, and migration, is a well-established factor in cancer metastasis. Our dual-luciferase reporter assays and RIP analyses confirmed the direct interaction between hsa_circ_0003848 and hsa-miR-144-3p, and the subsequent regulation of MET. Notably, overexpression of MET reversed the migratory inhibitory effects caused by hsa_circ_0003848 knockdown, suggesting that MET is a key downstream effector of this circRNA in GC progression. MET is a well-established proto-oncogene that, upon activation, typically triggers downstream signaling cascades including the phosphatidylinositol 3-kinase/protein kinase B and mitogen-activated protein kinases/extracellular signal-regulated kinase pathways to promote tumor cell motility and survival. In this study, the rescue experiments confirmed that MET is the functional executor of hsa_circ_0003848-mediated migration. Based on the established roles of MET in GC, it is highly probable that the hsa_circ_0003848/miR-144-3p/MET axis exerts its oncogenic effects through these classic downstream pathways, a hypothesis that aligns with our current functional observations. In line with our findings, the role of circRNAs as miRNA sponges in cancer biology has been widely documented. For instance, circRNAs like circCSPP1 and circBIRC6 have been shown to promote tumor progression through similar ceRNA mechanisms[18,19]. Our study adds to the growing body of evidence that circRNAs are not merely byproducts of RNA splicing, but active regulators in cancer biology, capable of influencing critical signaling pathways.

Furthermore, the diagnostic potential of hsa_circ_0003848 highlighted in our study supports its role as a non-invasive biomarker for early detection, especially in H. pylori (+)-related gastric lesions, where the expression of this circRNA progressively increases with disease severity. This is particularly significant in light of the global burden of GC and the challenges in early diagnosis and treatment. Regarding the mechanisms by which H. pylori infection leads to hsa_circ_0003848 upregulation, we hypothesize that the chronic inflammatory microenvironment plays a pivotal role. Previous studies have demonstrated that H. pylori virulence factors, such as CagA, can trigger a cascade of pro-inflammatory cytokines (e.g., tumor necrosis factor-alpha, interleukin-6), which in turn may activate specific transcription factors that promote the aberrant expression of circRNAs. Although the direct regulatory network requires further experimental elucidation, our clinical findings across different stages of infection strongly support its potential as a diagnostic indicator for H. pylori-associated gastric lesions.

Our study also provides new insights into the molecular underpinnings of GC progression, emphasizing the importance of circRNAs in regulating key signaling pathways such as the miR-144-3p/MET axis. Future studies should focus on validating these findings in larger clinical cohorts and exploring the therapeutic potential of targeting hsa_circ_0003848 and its downstream effectors for GC treatment. Despite the comprehensive in vitro functional assays and clinical validation conducted in this study, the lack of in vivo experiments, such as nude mouse xenograft models, remains a limitation. Future studies incorporating animal models are warranted to further verify the physiological relevance of the hsa_circ_0003848/miR-144-3p/MET axis in GC progression.

In conclusion, hsa_circ_0003848 emerges as a promising biomarker for GC diagnosis and a potential therapeutic target. Its role in regulating miR-144-3p and MET may offer novel strategies for combating GC progression, particularly in the context of H. pylori-related gastric lesions.

CONCLUSION

This study identifies hsa_circ_0003848 as a novel circRNA that plays a critical role in the progression of GC. Our findings suggest that hsa_circ_0003848 is significantly upregulated in both GC tissues and plasma samples, making it a potential non-invasive biomarker for early diagnosis, especially in H. pylori-positive individuals. circRNA functions as a ceRNA, sponging hsa-miR-144-3p to derepress MET expression, thereby promoting cancer cell migration, proliferation, and survival. In addition to its diagnostic potential, targeting the hsa_circ_0003848/miR-144-3p/MET pathway may offer a promising therapeutic strategy for GC, particularly for patients with H. pylori-related gastric lesions. Further studies in larger clinical cohorts are necessary to validate these findings and explore the therapeutic implications of inhibiting hsa_circ_0003848 in GC treatment.

References
1.  Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, Jemal A. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74:229-263.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16785]  [Cited by in RCA: 15748]  [Article Influence: 7874.0]  [Reference Citation Analysis (23)]
2.  Thrift AP, Wenker TN, El-Serag HB. Global burden of gastric cancer: epidemiological trends, risk factors, screening and prevention. Nat Rev Clin Oncol. 2023;20:338-349.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 625]  [Cited by in RCA: 575]  [Article Influence: 191.7]  [Reference Citation Analysis (6)]
3.  López MJ, Carbajal J, Alfaro AL, Saravia LG, Zanabria D, Araujo JM, Quispe L, Zevallos A, Buleje JL, Cho CE, Sarmiento M, Pinto JA, Fajardo W. Characteristics of gastric cancer around the world. Crit Rev Oncol Hematol. 2023;181:103841.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 334]  [Cited by in RCA: 271]  [Article Influence: 90.3]  [Reference Citation Analysis (12)]
4.  Li Y, Ren N, Zhang B, Yang C, Li A, Li X, Lei Z, Fei L, Fan S, Zhang J. Gastric cancer incidence trends in China and Japan from 1990 to 2019: Disentangling age-period-cohort patterns. Cancer. 2023;129:98-106.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 28]  [Article Influence: 9.3]  [Reference Citation Analysis (2)]
5.  Wang Z, Han W, Xue F, Zhao Y, Wu P, Chen Y, Yang C, Gu W, Jiang J. Nationwide gastric cancer prevention in China, 2021-2035: a decision analysis on effect, affordability and cost-effectiveness optimisation. Gut. 2022;71:2391-2400.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 73]  [Cited by in RCA: 63]  [Article Influence: 15.8]  [Reference Citation Analysis (4)]
6.  Wang FH, Zhang XT, Tang L, Wu Q, Cai MY, Li YF, Qu XJ, Qiu H, Zhang YJ, Ying JE, Zhang J, Sun LY, Lin RB, Wang C, Liu H, Qiu MZ, Guan WL, Rao SX, Ji JF, Xin Y, Sheng WQ, Xu HM, Zhou ZW, Zhou AP, Jin J, Yuan XL, Bi F, Liu TS, Liang H, Zhang YQ, Li GX, Liang J, Liu BR, Shen L, Li J, Xu RH. The Chinese Society of Clinical Oncology (CSCO): Clinical guidelines for the diagnosis and treatment of gastric cancer, 2023. Cancer Commun (Lond). 2024;44:127-172.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 270]  [Cited by in RCA: 273]  [Article Influence: 136.5]  [Reference Citation Analysis (2)]
7.  Zhang N, Wang X, Li Y, Lu Y, Sheng C, Sun Y, Ma N, Jiao Y. Mechanisms and therapeutic implications of gene expression regulation by circRNA-protein interactions in cancer. Commun Biol. 2025;8:77.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 25]  [Article Influence: 25.0]  [Reference Citation Analysis (0)]
8.  Liu W, Niu J, Huo Y, Zhang L, Han L, Zhang N, Yang M. Role of circular RNAs in cancer therapy resistance. Mol Cancer. 2025;24:55.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 22]  [Article Influence: 22.0]  [Reference Citation Analysis (0)]
9.  Wang M, Yu F, Zhang Y, Zhang L, Chang W, Wang K. The Emerging Roles of Circular RNAs in the Chemoresistance of Gastrointestinal Cancer. Front Cell Dev Biol. 2022;10:821609.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 15]  [Article Influence: 3.8]  [Reference Citation Analysis (4)]
10.  Han Z, Liu W, Zhu Y, Sun Y, Sun D, Jia R, Yang Y, Qi H, Zhang L, Huo Y, Zhang N, Chai J, Yang M. Non-coding RNAs in gastric cancer: mechanisms and therapeutic prospects. Mol Cancer. 2025;24:244.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 9]  [Reference Citation Analysis (0)]
11.  Bakhti SZ, Latifi-Navid S, Pahlevan AD, Sarabi L, Safaralizadeh R. The role of circular RNAs in gastric Cancer: Focusing on autophagy, EMT, and their crosstalk. Biochem Biophys Rep. 2025;43:102169.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 3]  [Reference Citation Analysis (0)]
12.  Lin W, Liu H, Tang Y, Wei Y, Wei W, Zhang L, Chen J. The development and controversy of competitive endogenous RNA hypothesis in non-coding genes. Mol Cell Biochem. 2021;476:109-123.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 21]  [Cited by in RCA: 46]  [Article Influence: 7.7]  [Reference Citation Analysis (0)]
13.  Moustafa YM, Mageed SSA, El-Dakroury WA, Moustafa HAM, Sallam AM, Abulsoud AI, Abdelmaksoud NM, Mohammed OA, Nomier Y, Elesawy AE, Abdel-Reheim MA, Zaki MB, Rizk NI, Ayed A, Ibrahim RA, Doghish AS. Exploring the molecular pathways of miRNAs in testicular cancer: from diagnosis to therapeutic innovations. Funct Integr Genomics. 2025;25:88.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 2]  [Reference Citation Analysis (0)]
14.  DeSouza NR, Nielsen KJ, Jarboe T, Carnazza M, Quaranto D, Kopec K, Suriano R, Islam HK, Tiwari RK, Geliebter J. Dysregulated Expression Patterns of Circular RNAs in Cancer: Uncovering Molecular Mechanisms and Biomarker Potential. Biomolecules. 2024;14:384.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 10]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
15.  Fan Z, Yuan X, Yuan Y. Circular RNAs in coronary heart disease: From molecular mechanism to promising clinical application (Review). Int J Mol Med. 2025;55:11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 6]  [Reference Citation Analysis (0)]
16.  Nemeth K, Bayraktar R, Ferracin M, Calin GA. Non-coding RNAs in disease: from mechanisms to therapeutics. Nat Rev Genet. 2024;25:211-232.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 697]  [Cited by in RCA: 603]  [Article Influence: 301.5]  [Reference Citation Analysis (1)]
17.  Deng X, Yu YV, Jin YN. Non-canonical translation in cancer: significance and therapeutic potential of non-canonical ORFs, m(6)A-modification, and circular RNAs. Cell Death Discov. 2024;10:412.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 15]  [Reference Citation Analysis (0)]
18.  Shi H, Kong S. A comprehensive evaluation of serum circCSPP1 as a novel diagnostic and prognostic biomarker for gastric cancer. Clin Res Hepatol Gastroenterol. 2024;48:102367.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 2]  [Reference Citation Analysis (0)]
19.  Tang Z, Li J, Lu B, Zhang X, Yang L, Qi Y, Jiang S, Wu Q, Wang Y, Cheng T, Xu M, Sun P, Wang X, Miao K, Wu H, Huang J. CircBIRC6 facilitates the malignant progression via miR-488/GRIN2D-mediated CAV1-autophagy signal axis in gastric cancer. Pharmacol Res. 2024;202:107127.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 18]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
20.  Li Y, Wang Z, Gao P, Cao D, Dong R, Zhu M, Fei Y, Zuo X, Cai J. CircRHBDD1 promotes immune escape via IGF2BP2/PD-L1 signaling and acts as a nanotherapeutic target in gastric cancer. J Transl Med. 2024;22:704.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 40]  [Article Influence: 20.0]  [Reference Citation Analysis (1)]
21.  Yang R, Xu B. The role of circular RNA in the occurrence and progression of gastric cancer: Emerging perspectives on its use as diagnostic and therapeutic biomarkers and therapeutic targets. Int J Biol Macromol. 2026;336:149442.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
22.  Li Z, Xie Y, Xiao B, Guo J. The tumor suppressor function of hsa_circ_0006282 in gastric cancer through PTEN/AKT pathway. Int J Clin Oncol. 2022;27:1562-1569.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 9]  [Reference Citation Analysis (0)]
23.  Cao C, Wu X, Li Z, Xie Y, Xu S, Guo J, Sun W. EIF4A3-Bound hsa_circ_0006847 Exerts a Tumor-Suppressive Role in Gastric Cancer. DNA Cell Biol. 2024;43:232-244.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 2]  [Reference Citation Analysis (0)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Oncology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade B, Grade B, Grade B, Grade B

Novelty: Grade B, Grade B, Grade B, Grade B

Creativity or innovation: Grade A, Grade B, Grade B, Grade C

Scientific significance: Grade A, Grade B, Grade B, Grade C

P-Reviewer: Shi B, PhD, China; Zhang JQ, MD, PhD, Associate Professor, China S-Editor: Luo ML L-Editor: A P-Editor: Zhao S

Write to the Help Desk