BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastrointest Oncol. May 15, 2025; 17(5): 104776
Published online May 15, 2025. doi: 10.4251/wjgo.v17.i5.104776
Circulating exosomal miR-17-92 cluster serves as a novel noninvasive diagnostic marker for patients with gastric cancer
Ye Han, Xing-Po Guo, Qiao-Ming Zhi, Yu-Ting Kuang, Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006, Jiangsu Province, China
Jing-Jing Xu, Department of Central Laboratory, The First Affiliated Hospital of Soochow University, Suzhou 215006, Jiangsu Province, China
Fei Liu, Department of Gastroenterology, The First Affiliated Hospital of Soochow University, Suzhou 215006, Jiangsu Province, China
ORCID number: Yu-Ting Kuang (0009-0009-4560-8857).
Co-first authors: Ye Han and Xing-Po Guo.
Co-corresponding authors: Fei Liu and Yu-Ting Kuang.
Author contributions: Han Y, Liu F, and Kuang YT conceptualized and designed the research; Han Y, Guo XP, and Zhi QM screened patients and acquired clinical data; Guo XP, Zhi QM, and Xu JJ collected blood specimens and performed laboratory analysis; Han Y, Xu JJ, and Liu F performed data analysis; Han Y, Liu F, and Kuang YT wrote the paper; All authors have read and approved the final manuscript. Liu F and Kuang YT have played important and indispensable roles in the experimental design, data interpretation, and manuscript preparation as the co-corresponding authors.
Supported by National Natural Science Foundation of China, No. 81902805; Jiangsu Provincial Natural Science Foundation, No. BK20190174; Suzhou Gusu Health Talent Research Project, No. GSWS2023039; and Suzhou Medical Youth Talents Project, No. Qngg2024004.
Institutional review board statement: This study was approved by the Institutional Ethics Committee of the First Affiliated Hospital of Soochow University (Approval No. 2019113).
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
Data sharing statement: No additional data are available.
Corresponding author: Yu-Ting Kuang, MD, Department of General Surgery, The First Affiliated Hospital of Soochow University, No. 188 Shizi Street, Suzhou 215006, Jiangsu Province, China. sudaytkuang@163.com
Received: January 2, 2025
Revised: February 25, 2025
Accepted: March 13, 2025
Published online: May 15, 2025
Processing time: 135 Days and 2 Hours

Abstract
BACKGROUND

Gastric cancer (GC) is among the most common malignant tumors and remains a leading cause of cancer-related mortality worldwide. Furthermore, exosomal miRNAs are regarded as promising noninvasive biomarkers for diagnosing malignant tumors.

AIM

To investigate the expression of exosomal miR-17-92 clusters and develop a potential biomarker for GC diagnosis

METHODS

Exosomes were isolated from serum samples obtained from 72 GC patients and 20 healthy controls. The isolated exosomes were validated using transmission electron microscopy, nanoparticle tracking analysis, and western blotting. Exosomal RNA was then extracted, and the expression profile of the miR-17-92 cluster was analyzed using qRT-PCR. Statistical methods were employed to evaluate the relationship between the serum exosomal miR-17-92 cluster expression and the clinicopathological parameters of GC patients as well as to assess the diagnostic utility of these miRNAs.

RESULTS

The expression of four members of the exosomal miR-17-92 cluster-miR-17, miR-18, miR-19a, and miR-92-was significantly upregulated in the serum samples of patients with GC compared with those of healthy controls. The miR-17-92 cluster panel demonstrated substantially higher clinical diagnostic value for GC than any individual component or pair. Additionally, the expression of traditional tumor biomarkers-carcinoembryonic antigen and carbohydrate antigen 19-9-was significantly elevated in the serum of patients with GC compared with that of healthy controls. Each biomarker, whether alone or in combination, effectively differentiated the patients from healthy controls. Furthermore, a combined panel of the two traditional tumor biomarkers and the four miR-17-92 cluster members exhibited the highest diagnostic accuracy for GC. Elevated miR-17-92 expression was also strongly associated with tumor size, tumor depth, lymph node metastasis, distant metastasis, and tumor-node-metastasis stage.

CONCLUSION

Our findings revealed that the circulating exosomal miR-17-92 cluster may be used as a potential noninvasive biomarker to improve diagnostic efficiency for GC.

Key Words: Gastric cancer; Serum; Exosome; miR-17-92 cluster; Diagnosis

Core Tip: The expression levels of exosomal miR-17-92 clusters were significantly upregulated in the serum of patients with gastric cancer (GC). Elevated expression levels of exosomal miR-17-92 were closely correlated with tumor size, tumor depth, lymph node metastasis, distant metastasis, and tumor-node-metastasis stage of these patients. The combined panel of miR-17, miR-18, miR-19a, and miR-92 showed substantially higher clinical diagnostic value for GC than any individual component or pair. The newly developed panel comprising carcinoembryonic antigen, carbohydrate antigen 19-9, and the four miR-17-92 cluster members exhibited the most robust clinical diagnostic value for GC.



INTRODUCTION

Gastric cancer (GC) ranks fifth among the most common types of cancer and is the fifth leading cause of cancer-related mortality worldwide[1]. Although remarkable progress has been made in GC therapy, the 5-year survival rate for patients with GC remains unsatisfactory[2]. Early diagnosis could substantially improve the prognosis of GC; however, most patients are diagnosed at an advanced stage[3,4]. Carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9) are conventional serum tumor biomarkers that have been shown to be useful indicators for the early diagnosis, prognosis, and recurrence of GC[5,6]. However, these biomarkers are not ideal for early-stage GC diagnosis due to their limited specificity and sensitivity[7]. Therefore, there is an urgent need to identify novel and definitive markers for early GC detection. Furthermore, imaging screening is generally time-consuming, and its sensitivity is low in identifying GC during the early stages. Additionally, biopsy for histopathologic examination is not widely used for GC screening because of its invasive nature. Conversely, peripheral blood tests offer several advantages for cancer screening due to their noninvasive, easily obtainable, and high-efficiency characteristics. However, biomarkers with high sensitivity and/or specificity for the detection and monitoring of GC remain scarce. Therefore, there is a pressing need to identify more original and effective biomarkers for the early diagnosis of GC.

MicroRNAs (miRNAs) are small, single-stranded, noncoding RNAs that regulate the expression of their target genes[8]. miRNAs play pivotal roles in several cellular processes, including cell growth, proliferation, apoptosis, migration, and metabolism[9-12]. miR-17-92 cluster is one of the most well-known oncogenic miRNA clusters and includes miR-17, miR-18, miR-19a, miR-19b, miR-20, and miR-92[13]. Research has shown that dysregulation of the miR-17-92 cluster is frequently observed in various cancers; moreover, it is associated with tumor initiation, progression, and metastasis[14]. In contrast, downregulation of miR-17-92 is associated with certain types of cancer, such as lymphoma[15] and lung cancer[16]. Decreased expression of these miRNAs can lead to uncontrolled cell proliferation, metastasis, and resistance to chemotherapy.

Exosomes are membrane-enclosed nanovesicles of endosomal origin, with diameters ranging from 30 to 150 nm[17]. They are generated from the internal vesicles of multivesicular bodies and can be secreted by various cell types. Exosomes are abundantly present in the blood, urine, and other body fluids[18]. Research on exosomes in cancer has rapidly attracted attention owing to their easy, noninvasive collection and detection[19-21]. Exosomes participate in many pathological processes, including tumor invasion, angiogenesis, metastasis, and chemoresistance[22-25]. Exosomal miRNAs, such as miR-155, miR-17-92 cluster, and miR-1246, hold valuable potential for the diagnosis and prognosis of numerous cancer types[26].

Herein, we systematically investigated the expression profile of the exosomal miR-17-92 cluster in the serum of patients with GC. Additionally, we aimed to develop a potential diagnostic panel by combining this cluster with traditional serum biomarkers, CEA and CA19-9, to achieve optimal diagnosis of GC with high sensitivity and specificity. Our study focused on the clinical diagnostic value of circulating exosomal miR-17-92 cluster expression as a novel noninvasive diagnostic marker for patients with GC.

MATERIALS AND METHODS
Clinical samples

Peripheral blood samples were collected from 72 patients with GC at the Department of General Surgery, the First Affiliated Hospital of Soochow University, between January 2020 and December 2020. None of the patients had received chemotherapy or radiotherapy prior to serum collection. Samples from 20 healthy controls were obtained from individuals undergoing routine health examinations. Informed consent was obtained from all participants. All GC diagnoses were confirmed through pathological examination. The histological grade was determined according to the World Health Organization classification[27]. This study was approved by the Institutional Ethics Committee of the First Affiliated Hospital of Soochow University (No. 2019113).

Exosome isolation

Exosomes were isolated from serum using the ExoQuick exosome precipitation solution (System Biosciences, CA, United States), following the manufacturer’s instructions. Briefly, serum was separated from whole blood samples through centrifugation at 3000 × g for 15 minutes at 4 °C. Cellular debris was removed through centrifugation at 12000 × g for 10 minutes at 4 °C. Next, 250 μL of serum was mixed with 63 μL of ExoQuick solution and incubated overnight at 4 °C. After incubation, the samples were centrifuged for 30 minutes at 1500 × g and 4 °C, and the exosome pellet was resuspended in 50 μL of phosphate-buffered saline (PBS). The isolated exosomes were stored at -80 °C until further use.

RNA extraction and qRT-PCR

Exosomal miRNAs were extracted from serum using the miRNeasy Serum/Plasma Kit (Qiagen, Germany), following the manufacturer’s instructions. The miRNAs were reverse transcribed using the miScript II RT Kit (Qiagen), and the miScript SYBR Green PCR Kit (Qiagen) was used for detecting miRNA expression with the CFX96 Touch RT-PCR Detection System (Bio-Rad, United States). The relative expression levels of miR-17-92 in serum exosomes from patients with GC were normalized to those of miR-16. For relative expression analysis, ∆Ct was calculated as CtmiR-17-92 - CtmiR-16, and ∆∆Ct was calculated as ∆CtGC patients - ∆Cthealthy controls. The 2-∆∆Ct method was used to analyze the relative expression of exosomal miR-17-92 between patients with GC and healthy controls. The 2-∆Ct method was used to analyze the relationship between exosomal miR-17-92 expression and clinicopathological characteristics. Primers for miRNA detection were supplied by Invitrogen (Shanghai, China), and the primer sequences used for qRT-PCR analysis are listed in Table 1.

Table 1 Primer sequences used for qRT-PCR analysis.
Gene
Sequence (5′-3′)
miR-16CAGCACGTAAATATTGGCGA
miR-17GCAAAGTGCTTACAGTGCAGGTAG
miR-18CCGGTAAGGTGCATCTAGT
miR-19aTGTGCAAATCTATGCAAAACTG
miR-19bGCATCCCAGTGTGCAAATCC
miR-20GGTAAAGTGCTTATAGTGCAGGTAG
miR-92ATTGCACTTGTCCCGGCCTGT
Transmission electron microscopy

Twenty microliters of freshly extracted exosomes were placed onto formvar carbon-coated 200-mesh copper grids and allowed to adsorb for 10 minutes. The adsorbed exosomes were then negatively stained with 2% (w/v) phosphotungstic acid (pH 6.8) for 5 minutes and air-dried under an incandescent lamp. The morphology of the exosomes was observed using a transmission electron microscope (FEI Tecnai 12, Philips).

Nanoparticle tracking analysis

The extracted exosomes were suspended in PBS and analyzed using a Malvern Zetasizer Nano ZS90 (Malvern, United Kingdom), following the manufacturer’s protocol. The size distribution and concentration of the exosomes were then determined using the Nanoparticle Tracking Analysis 2.0 software.

Western blot analysis

The total protein from the serum exosome samples was extracted using RIPA buffer supplemented with proteinase inhibitors, following the manufacturer’s instructions. Equal amounts of protein were loaded onto a 12% SDS-PAGE gel and separated through electrophoresis. Subsequently, the proteins were transferred to a polyvinylidene difluoride membrane, blocked with 5% (w/v) nonfat milk, and incubated with primary antibodies. The membranes were then washed and incubated with the appropriate secondary antibodies. Protein detection was performed using a Gel Imaging System (PeiQing, China). Primary antibodies against CD9 (#ab92726) and CD81 (#ab109201) were obtained from Abcam, and secondary antibodies against rabbit IgG and horseradish peroxidase-linked antibody (#7074) were obtained from Cell Signaling Technology.

Statistical analysis

Statistical analysis was performed using SPSS 20.0 software (IBM, Chicago, IL, United States). GraphPad Prism 5 (San Diego, CA, United States) was used to generate scatter plots. All experiments were performed at least thrice. Differences in the serum exosomal miRNA levels between patients with GC and healthy controls were analyzed using the Mann-Whitney U test. The area under the receiver operating characteristic (ROC) curve was used to assess the ability of miRNAs to differentially diagnose patients with GC and healthy controls. A P value of < 0.05 was considered statistically significant, whereas that of < 0.01 was considered highly significant. The statistical methods of this study were reviewed by Prof. Jin Zhou from Soochow University.

RESULTS
Identification and characterization of exosomes in cell-free serum specimens

Transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA), and western blot analysis were performed to determine whether exosomes were successfully extracted from the serum samples of 72 patients with GC and 20 healthy controls. The morphology of the exosomes was directly observed through TEM, which revealed that the exosomes exhibited a spherical or oval vesicle shape, with a lipid bilayer membrane structure and a diameter of 50-100 nm (Figure 1A). NTA revealed that the diameter of exosomes from the serum of patients with GC was similar to that of exosomes from the serum of healthy controls, with an average size of 50-100 nm (Figure 1B). Additionally, the concentration of exosomes in the serum of patients with GC was higher than that in the serum of healthy controls (P < 0.01; Figure 1C). Furthermore, western blot analysis confirmed that the isolated exosomes from both patients with GC and healthy controls expressed specific exosomal markers, such as CD9 and CD81 (Figure 1D). Taken together, these results demonstrate that exosomes were successfully isolated from serum samples, providing a solid foundation for further investigation of exosomal biomarkers.

Figure 1
Figure 1 Characterization of exosomes derived from the serum of patients with gastric cancer and healthy controls. A: Transmission electron microscopy (TEM) images of serum exosomes; B: The size distribution of the exosomes was examined through nanoparticle tracking analysis; C: The exosome samples were derived from patients with gastric cancer (GC) and healthy controls; D: Western blot analysis of exosomal protein markers, including CD9 and CD81, in the exosome-depleted supernatant (EDS) and exosomes from the serum of patients with GC and healthy controls. aP < 0.05; EDS: Exosome-depleted supernatant; E-GC: Exosomes from the serum of patients with gastric cancer; E-Ctrl: Exosomes from the serum of healthy controls.
Screening and evaluation of exosomal miR-17-92 cluster in serum samples from patients with GC

The expression profiles of the serum exosomal miR-17-92 cluster, including miR-17, miR-18, miR-19a, miR-19b, miR-20, and miR-92, were assessed using RT-qPCR. As shown in Figure 2, all six members of the exosomal miR-17-92 cluster were detectable in the serum samples from both patients with GC and healthy controls, although at different levels. Our data demonstrated that the expression level of serum exosomal miR-17 in patients with GC was significantly higher than that in healthy controls (P < 0.001; Figure 2A). Additionally, the expression levels of serum exosomal miR-18, miR-19a, and miR-92 were also higher in patients with GC than in healthy controls (Figure 2B, C and F). However, no significant differences were observed in the expression of serum exosomal miR-19b and miR-20 between patients with GC and healthy controls (P > 0.05; Figure 2D and E). Thus, our results indicate that the expression profile of the serum exosomal miR-17-92 cluster in patients with GC differs from that in healthy controls.

Figure 2
Figure 2 Expression levels of the exosomal miR-17-92 cluster members in the serum samples of patients with gastric cancer and healthy controls. A: Expression level of miR-17; B: Expression level of miR-18; C: Expression level of miR-19a; D: Expression level of miR-19b; E: Expression level of miR-20; F: Expression level of miR-92. aP < 0.05; bP < 0.01; GC: Gastric cancer.
Evaluation of the diagnostic potential of the serum exosomal miR-17-92 cluster for GC

ROC curve analysis was performed to assess the diagnostic utility of the serum exosomal miR-17-92 cluster for GC, using sensitivity as the y-axis and 1-specificity as the x-axis. The area under the curve (AUC) for serum exosomal miR-17 was 0.750 (95%CI: 0.626-0.874), with a sensitivity of 84.7% and specificity of 70.0% (Figure 3A). Similarly, the AUC for miR-18 was 0.736 (95%CI: 0.590-0.881), with a sensitivity of 88.9% and specificity of 65.0% (Figure 3B). Furthermore, the AUCs for miR-19a and miR-92 were 0.700 (95%CI: 0.562-0.838) and 0.689 (95%CI: 0.567-0.811), respectively (Figure 3C and D). These findings revealed that the AUC of serum exosomal miR-17 was the highest among the four miR-17-92 cluster members, indicating that miR-17 possessed the strongest diagnostic efficacy for GC. Additionally, we examined whether combining the four exosomal miR-17-92 cluster members could more effectively distinguish patients with GC from healthy controls. As shown in Figure 3E, the combined detection of miR-17 and miR-18-the top two upregulated members of the miR-17-92 cluster in patients with GC-achieved an AUC of 0.774 (95%CI: 0.638-0.911), with a sensitivity of 87.5% and specificity of 70.0%. This combination appeared to exhibit a higher predictive value for GC diagnosis than either miR-17 or miR-18 alone. Furthermore, we evaluated whether the combination of all four cluster members can provide the most effective predictive marker for GC diagnosis. As expected, the combined panel comprising miR-17, miR-18, miR-19a, and miR-92 achieved an AUC of 0.808 (95%CI: 0.680-0.937), with a sensitivity of 90.3% and specificity of 70.0% (Figure 3F), demonstrating higher clinical diagnostic value for GC than any individual marker or any pairwise combination. Overall, these findings indicate that the serum exosomal miR-17-92 cluster could serve as a potential predictive biomarker for GC diagnosis and that the exosomal miRNA combination panel could further enhance diagnostic accuracy for GC.

Figure 3
Figure 3 Receiver operating characteristic curve analysis using the serum exosomal miR-17-92 cluster for distinguishing patients with gastric cancer from healthy controls. A: Receiver operating characteristic curve (ROC) curve for miR-17; B: ROC curve for miR-18; C: ROC curve for miR-19a; D: ROC curve for miR-92; E: ROC curve for miR-17 + miR-18; F: ROC curve for miR-17 + miR-18 + miR-19a + miR-92. AUC: The area under the curve.
Combining multiple biomarkers enhances the diagnostic efficacy of GC

To better evaluate the diagnostic potential of exosomal miR-17-92, we collected clinical data from 72 patients with GC and 20 healthy controls for further evaluation. Traditional tumor biomarkers, such as CEA and CA19-9, were commonly used in our clinical practice and were compared between patients with GC and healthy controls. As shown in Figure 4A, the expression of CEA was significantly upregulated in the serum of patients with GC compared with healthy controls. Similarly, the expression of CA19-9 was also upregulated in patients with GC compared with healthy controls (Figure 4B). ROC analysis was performed to explore the diagnostic efficiency of the two traditional tumor biomarkers. The AUC for CEA was 0.697 (95%CI: 0.569-0.825), with a sensitivity of 56.9% and specificity of 85.0% (Figure 4C). The AUC for CA19-9 was 0.676 (95%CI: 0.547-0.805), with a sensitivity of 70.8% and specificity of 65.0% (Figure 4D). Additionally, a combined panel of CEA and CA19-9 was developed to further investigate the diagnostic efficiency for GC. As expected, the combination of CEA and CA19-9 demonstrated higher diagnostic value, with an AUC of 0.738 (95%CI: 0.615-0.861), compared with either biomarker alone (Figure 4E). Furthermore, we developed a diagnostic panel consisting of the two traditional tumor biomarkers and the four miR-17-92 cluster members, and the ROC of this newly developed diagnostic panel was calculated. Our results showed that the AUC for the new panel was 0.881 (95%CI: 0.765-0.998), with a sensitivity of 91.7% and specificity of 90.0% (Figure 4F), demonstrating the highest clinical diagnostic efficacy for GC. Taken together, these findings indicate that the serum exosomal miR-17-92 cluster, combined with traditional tumor biomarkers, can significantly enhance the diagnostic efficacy for GC.

Figure 4
Figure 4 Expression levels of carcinoembryonic antigen and carbohydrate antigen 19-9 in serum samples of patients with gastric cancer and healthy controls and their clinical diagnostic values alone or with serum exosomal miRNAs. A: Expression level of carcinoembryonic antigen (CEA); B: Expression level of carbohydrate antigen 19-9 (CA19-9); C: Receiver operating characteristic curve (ROC) curve for CEA; D: ROC curve for CA19-9; E: ROC curve for CEA + CA19-9; F: ROC curve for miR-17 + miR-18 + miR-19a + miR-92 + CEA + CA19-9. aP < 0.05; AUC: The area under the curve; CEA: Carcinoembryonic antigen; CA19-9: Carbohydrate antigen 19-9.
Correlation of serum exosomal miR-17-92 expression with the clinicopathological parameters of patients with GC

To better understand the potential role of the serum exosomal miR-17-92 cluster in the development of GC, the association between the expression levels of each member of the miR-17-92 cluster and various clinicopathological features of patients with GC was further analyzed. As shown in Table 2, serum exosomal miR-17 expression was strongly associated with tumor size, tumor depth, distant metastasis, and tumor-node-metastasis (TNM) stage in these patients. However, there was no significant correlation between serum exosomal miR-17 expression and other clinicopathological characteristics such as age, sex, histological grade, lymph node metastasis, and venous invasion. Moreover, serum exosomal miR-18 expression was significantly associated with tumor size, distant metastasis, and TNM stage. Serum exosomal miR-19a expression was markedly associated with tumor depth, lymph node metastasis, and TNM stage. Furthermore, serum exosomal miR-92 expression was significantly associated with tumor depth, distant metastasis, and TNM stage but showed no significant association with other clinicopathological features. Overall, these results indicate that the exosomal miR-17-92 cluster may play an oncogenic role in the progression of GC.

Table 2 Correlation between the expression levels of the serum exosomal miR-17-92 cluster and clinical pathological parameters in patients with gastric cancer.
Variable
No. of patients (n = 72)
miR-17 expression
P value
miR-18 expression
P value
miR-19a expression
P value
miR-92 expression
P value
Age (years)
    < 603014.083 (11.920-16.247)0.18810.297 (8.681-11.913)0.62911.383 (9.945-12.822)0.11731.007 (26.953-35.060)0.34
    ≥ 604216.179 (13.968-18.389)10.793 (9.473-12.112)9.864 (8.585-11.144)28.633 (25.534-31.733)
Sex
    Male3916.021 (14.083-17.958)0.32310.659 (9.408-11.910)0.87610.255 (8.832-11.677)0.64328.936 (25.170-32.701)0.544
    Female3314.460 (11.867-17.054)10.500 (8.822-12.178)10.703 (9.369-12.036)30.433 (27.359-33.508)
Tumor size (cm)
    < 54613.600 (11.773-15.427)0.003b9.774 (8.547-11.001)0.03a10.602 (9.456-11.748)0.77229.585 (26.414-32.756)0.968
    ≥ 52618.323 (15.718-20.928)12.023 (10.348-13.699)10.312 (8.523-12.101)29.688 (25.697-33.680)
Histological grade
    Well-moderately differentiated3215.075 (12.525-17.625)0.79410.463 (8.935-11.990)0.8279.725 (8.216-11.234)0.14928.931 (25.705-32.158)0.615
    Poorly differentiated4015.490 (13.468-17.512)10.685 (9.306-12.064)11.115 (9.877-12.353)30.175 (26.531-33.819)
Tumor depth
    T1-T23513.613 (11.290-15.972)0.036a9.946 (8.494-11.397)0.2169.197 (5.529-10.457)0.007b27.006 (23.425-30.586)0.036a
    T3-T43716.889 (14.852-18.926)11.192 (9.778-12.606)11.727 (10.378-13.076)32.097 (28.851-35.344)
Lymph node metastasis
    Absent2415.121 (11.663-18.574)0.8839.938 (8.007-11.868)0.3649.071 (7.624-10.518)0.033a27.521 (23.749-31.293)0.225
    Present4815.398 (13.720-17.076)10.910 (9.722-12.098)11.21 (9.999-12.422)30.673 (27.509-33.837)
Venous invasion
    Negative5115.448 (12.109-18.786)0.90810.282 (9.005-11.560)0.34810.682 (9.474-11.890)0.51129.159 (26.302-32.016)0.557
    Positive2115.247 (13.452-17.042)11.324 (9.762-12.886)10.048 (8.494-11.602)30.748 (25.785-35.710)
DISCUSSION

In this study, we found that the expression of circulating exosomal miR-17-92 cluster was significantly upregulated in patients with GC compared with healthy controls. The elevated expression of circulating exosomal miR-17-92 was positively correlated with tumor size, tumor depth, lymph node metastasis, distant metastasis, and TNM stage in these patients. ROC analysis demonstrated that a panel of circulating exosomal miR-17-92 cluster members, including miR-17, miR-18, miR-19a, and miR-92, exhibited higher diagnostic efficiency than traditional biomarkers, such as CEA and CA19-9, for GC. Additionally, combining traditional biomarkers with the exosomal miR-17-92 cluster showed synergistic effects. These findings may provide evidence for the potential of exosomal miR-17-92 as a novel, noninvasive biomarker for GC diagnosis.

Currently, gastroscopy, CT, X-ray, and serological examinations are the primary methods used for GC diagnosis. Among these, gastroscopy combined with a pathological biopsy is considered the gold standard. However, this approach is both expensive and invasive. Contrary to traditional invasive methods, liquid biopsy-such as the analysis of circulating exosomes-is noninvasive and provides comprehensive, dynamic information throughout all stages of GC.

Emerging evidence suggests that exosomal miRNAs hold promise as biomarkers in various cancers, offering potential for diagnosis, recurrence prediction, and prognostic assessment[28,29]. Research has shown that the expression levels of exosomal miR-21[30], miR-106a[31], miR-1246[32], and miR-155[33] are upregulated in GC, whereas those of exosomal miR-122-5p[34], miR-590-5p[35], miR-92a-3p[36], and miR-23b[37] are downregulated in GC. The expression levels of serum exosomal miR-19b and miR-106a are significantly upregulated in patients with GC, and these miRNAs exhibit high diagnostic sensitivity and specificity for detecting GC[31]. Conversely, the serum levels of exosomal miR-92a-3p were significantly lower in patients with GC than in healthy controls. Moreover, the combined detection of serum exosomal miR-92a-3p, CEA, and CA19-9 showed improved sensitivity for GC diagnosis[36]. When combined with CEA, circulating exosomal miR-125a-3p significantly enhanced the sensitivity and specificity of screening for early-stage colon cancer[38]. A previous study also revealed that elevated plasma levels of exosomal miR-1290 and miR-375 are significantly associated with poor overall survival in patients with castration-resistant prostate cancer[39].

In our study, we found that the expression of the four circulating exosomal miR-17-92 cluster members was significantly higher in patients with GC compared with healthy controls. The circulating exosomal miR-17-92 cluster could serve as a novel diagnostic marker for GC, as miR-17-92 is known to play an important role in cancer proliferation, invasion, and migration. Additionally, miR-19 is reported to be highly expressed in both gastric and prostate cancer[40], while miR-18a is upregulated and promotes tumorigenesis by suppressing STK4 in prostate cancer[41]. Plasma miR-18a expression is also elevated in patients with GC, and higher miR-18a levels are associated with shorter disease-free survival and disease-specific survival[42]. miR-17-5p/20a has been linked to differentiation status and TNM stages of GC, with higher expression levels correlating with poor overall survival[43]. Furthermore, miR-19a/b is upregulated in metastatic GC, promoting cell migration, invasion, and metastasis by regulating the tumor suppressor MXD1[44]. Finally, miR-92a has been identified as an independent predictor of overall survival in GC patients[45].

In the present study, we found that the expression of four members of the exosomal miR-17-92 cluster-miR-17, miR-18, miR-19a, and miR-92-was significantly upregulated in the serum samples of patients with GC. Furthermore, elevated exosomal miR-17-92 expression was closely associated with tumor size, tumor depth, lymph node metastasis, distant metastasis, and TNM stage. ROC curves are widely used to assess diagnostic performance, and we constructed ROC curves to evaluate the diagnostic effectiveness of exosomal miR-17-92. The ROC analysis showed that serum levels of exosomal miR-17, miR-18, miR-19a, and miR-92 could effectively differentiate between patients with GC and healthy controls. The AUCs for these miRNAs were 0.750, 0.736, 0.700, and 0.689, respectively. The AUC for the combined panel of miR-17, miR-18, miR-19a, and miR-92 was 0.808, indicating superior diagnostic value for GC compared to each individual miRNA or any pair. Moreover, the AUC for a panel combining the two traditional tumor biomarkers, CEA and CA19-9, with the four miR-17-92 cluster members reached 0.881, demonstrating the highest diagnostic efficacy for GC. Consistent with our findings, a previous study reported that the combined detection of serum exosomal miR-92a-3p, CEA, and CA19-9 improves sensitivity for GC diagnosis[36]. Another study reported that a five-miRNA signature (miR-185, miR-20a, miR-210, miR-25, and miR-92b) in the peripheral plasma may serve as a noninvasive biomarker for GC diagnosis[46].

In this study, the combination of traditional serum biomarkers (CEA and CA19-9) with serum exosomal miRNAs (miR-17, miR-18, miR-19a, and miR-92) demonstrated the highest diagnostic efficacy for the early detection of GC. However, our study had several limitations. First, the histological subtypes of GC (such as tubular, papillary, mucinous, and poorly cohesive) may exhibit different tumor biological behaviors; thus, our results may not be generalized to all groups. Specificity is based on healthy controls who have no other cancer types. Second, the combination of multiple miRNAs and tumor markers may have increased the risk of bias. Third, only a limited number of patients with GC and healthy controls were included in this study. A larger cohort is needed to further validate the potential of the exosomal miR-17-92 cluster for GC diagnosis.

CONCLUSION

In summary, the expression of the exosomal miR-17-92 cluster was significantly upregulated in the serum of patients with GC. The elevated expression of exosomal miR-17-92 was closely associated with tumor size, tumor depth, lymph node metastasis, distant metastasis, and TNM stage in these patients. The combined panel of miR-17, miR-18, miR-19a, and miR-92 showed greater clinical diagnostic value for GC than any individual miRNA or any pair of miRNAs. Importantly, the newly developed panel, which includes CEA, CA19-9, and the four miR-17-92 cluster members, demonstrated the highest clinical diagnostic efficacy for GC. Overall, our findings suggest that the circulating exosomal miR-17-92 cluster could serve as a potential noninvasive biomarker, improving diagnostic efficiency for GC.

References
1.  Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, Jemal A. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74:229-263.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16785]  [Cited by in RCA: 15312]  [Article Influence: 7656.0]  [Reference Citation Analysis (23)]
2.  Johnston FM, Beckman M. Updates on Management of Gastric Cancer. Curr Oncol Rep. 2019;21:67.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 378]  [Cited by in RCA: 344]  [Article Influence: 49.1]  [Reference Citation Analysis (4)]
3.  Van Cutsem E, Sagaert X, Topal B, Haustermans K, Prenen H. Gastric cancer. Lancet. 2016;388:2654-2664.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1498]  [Cited by in RCA: 1490]  [Article Influence: 149.0]  [Reference Citation Analysis (3)]
4.  Lordick F, Carneiro F, Cascinu S, Fleitas T, Haustermans K, Piessen G, Vogel A, Smyth EC; ESMO Guidelines Committee. Gastric cancer: ESMO Clinical Practice Guideline for diagnosis, treatment and follow-up. Ann Oncol. 2022;33:1005-1020.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1159]  [Cited by in RCA: 1028]  [Article Influence: 257.0]  [Reference Citation Analysis (14)]
5.  Emoto S, Ishigami H, Yamashita H, Yamaguchi H, Kaisaki S, Kitayama J. Clinical significance of CA125 and CA72-4 in gastric cancer with peritoneal dissemination. Gastric Cancer. 2012;15:154-161.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 137]  [Cited by in RCA: 127]  [Article Influence: 9.1]  [Reference Citation Analysis (2)]
6.  Li Y, Yang Y, Lu M, Shen L. Predictive value of serum CEA, CA19-9 and CA72.4 in early diagnosis of recurrence after radical resection of gastric cancer. Hepatogastroenterology. 2011;58:2166-2170.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 26]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
7.  Shimada H, Noie T, Ohashi M, Oba K, Takahashi Y. Clinical significance of serum tumor markers for gastric cancer: a systematic review of literature by the Task Force of the Japanese Gastric Cancer Association. Gastric Cancer. 2014;17:26-33.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 435]  [Cited by in RCA: 389]  [Article Influence: 32.4]  [Reference Citation Analysis (3)]
8.  Ebert MS, Sharp PA. Roles for microRNAs in conferring robustness to biological processes. Cell. 2012;149:515-524.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1392]  [Cited by in RCA: 1270]  [Article Influence: 90.7]  [Reference Citation Analysis (4)]
9.  Saliminejad K, Khorram Khorshid HR, Soleymani Fard S, Ghaffari SH. An overview of microRNAs: Biology, functions, therapeutics, and analysis methods. J Cell Physiol. 2019;234:5451-5465.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1730]  [Cited by in RCA: 1500]  [Article Influence: 214.3]  [Reference Citation Analysis (6)]
10.  Cowland JB, Hother C, Grønbaek K. MicroRNAs and cancer. APMIS. 2007;115:1090-1106.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 153]  [Cited by in RCA: 135]  [Article Influence: 7.1]  [Reference Citation Analysis (0)]
11.  Mendell JT, Olson EN. MicroRNAs in stress signaling and human disease. Cell. 2012;148:1172-1187.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1470]  [Cited by in RCA: 1389]  [Article Influence: 99.2]  [Reference Citation Analysis (0)]
12.  Iorio MV, Croce CM. MicroRNA dysregulation in cancer: diagnostics, monitoring and therapeutics. A comprehensive review. EMBO Mol Med. 2017;9:852.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 120]  [Cited by in RCA: 133]  [Article Influence: 14.8]  [Reference Citation Analysis (1)]
13.  Olive V, Li Q, He L. mir-17-92: a polycistronic oncomir with pleiotropic functions. Immunol Rev. 2013;253:158-166.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 128]  [Cited by in RCA: 116]  [Article Influence: 8.9]  [Reference Citation Analysis (0)]
14.  Mogilyansky E, Rigoutsos I. The miR-17/92 cluster: a comprehensive update on its genomics, genetics, functions and increasingly important and numerous roles in health and disease. Cell Death Differ. 2013;20:1603-1614.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 771]  [Cited by in RCA: 717]  [Article Influence: 55.2]  [Reference Citation Analysis (0)]
15.  Tagawa H, Ikeda S, Sawada K. Role of microRNA in the pathogenesis of malignant lymphoma. Cancer Sci. 2013;104:801-809.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 54]  [Cited by in RCA: 54]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
16.  Lin S, Sun JG, Wu JB, Long HX, Zhu CH, Xiang T, Ma H, Zhao ZQ, Yao Q, Zhang AM, Zhu B, Chen ZT. Aberrant microRNAs expression in CD133⁺/CD326⁺ human lung adenocarcinoma initiating cells from A549. Mol Cells. 2012;33:277-283.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 33]  [Cited by in RCA: 37]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
17.  Kowal J, Tkach M, Théry C. Biogenesis and secretion of exosomes. Curr Opin Cell Biol. 2014;29:116-125.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1587]  [Cited by in RCA: 1437]  [Article Influence: 119.8]  [Reference Citation Analysis (4)]
18.  Ohno S, Ishikawa A, Kuroda M. Roles of exosomes and microvesicles in disease pathogenesis. Adv Drug Deliv Rev. 2013;65:398-401.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 128]  [Cited by in RCA: 116]  [Article Influence: 8.9]  [Reference Citation Analysis (1)]
19.  Chi KR. The tumour trail left in blood. Nature. 2016;532:269-271.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 90]  [Cited by in RCA: 74]  [Article Influence: 7.4]  [Reference Citation Analysis (0)]
20.  Batth IS, Mitra A, Manier S, Ghobrial IM, Menter D, Kopetz S, Li S. Circulating tumor markers: harmonizing the yin and yang of CTCs and ctDNA for precision medicine. Ann Oncol. 2017;28:468-477.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 64]  [Cited by in RCA: 54]  [Article Influence: 6.0]  [Reference Citation Analysis (0)]
21.  Siravegna G, Marsoni S, Siena S, Bardelli A. Integrating liquid biopsies into the management of cancer. Nat Rev Clin Oncol. 2017;14:531-548.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1661]  [Cited by in RCA: 1484]  [Article Influence: 164.9]  [Reference Citation Analysis (3)]
22.  Kosaka N, Yoshioka Y, Fujita Y, Ochiya T. Versatile roles of extracellular vesicles in cancer. J Clin Invest. 2016;126:1163-1172.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 294]  [Cited by in RCA: 269]  [Article Influence: 26.9]  [Reference Citation Analysis (1)]
23.  Hu Y, Qi C, Liu X, Zhang C, Gao J, Wu Y, Yang J, Zhao Q, Li J, Wang X, Shen L. Malignant ascites-derived exosomes promote peritoneal tumor cell dissemination and reveal a distinct miRNA signature in advanced gastric cancer. Cancer Lett. 2019;457:142-150.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 68]  [Article Influence: 9.7]  [Reference Citation Analysis (5)]
24.  Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes. Science. 2020;367:eaau6977.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9106]  [Cited by in RCA: 8045]  [Article Influence: 1340.8]  [Reference Citation Analysis (13)]
25.  Rajagopal C, Harikumar KB. The Origin and Functions of Exosomes in Cancer. Front Oncol. 2018;8:66.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 242]  [Cited by in RCA: 223]  [Article Influence: 27.9]  [Reference Citation Analysis (0)]
26.  Salehi M, Sharifi M. Exosomal miRNAs as novel cancer biomarkers: Challenges and opportunities. J Cell Physiol. 2018;233:6370-6380.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 215]  [Cited by in RCA: 200]  [Article Influence: 25.0]  [Reference Citation Analysis (0)]
27.  Hu B, El Hajj N, Sittler S, Lammert N, Barnes R, Meloni-Ehrig A. Gastric cancer: Classification, histology and application of molecular pathology. J Gastrointest Oncol. 2012;3:251-261.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 273]  [Reference Citation Analysis (0)]
28.  Zhang J, Li S, Li L, Li M, Guo C, Yao J, Mi S. Exosome and exosomal microRNA: trafficking, sorting, and function. Genomics Proteomics Bioinformatics. 2015;13:17-24.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1817]  [Cited by in RCA: 1668]  [Article Influence: 151.6]  [Reference Citation Analysis (1)]
29.  Nicolè L, Cappello F, Cappellesso R, VandenBussche CJ, Fassina A. MicroRNA profiling in serous cavity specimens: Diagnostic challenges and new opportunities. Cancer Cytopathol. 2019;127:493-500.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 8]  [Cited by in RCA: 12]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
30.  Tokuhisa M, Ichikawa Y, Kosaka N, Ochiya T, Yashiro M, Hirakawa K, Kosaka T, Makino H, Akiyama H, Kunisaki C, Endo I. Exosomal miRNAs from Peritoneum Lavage Fluid as Potential Prognostic Biomarkers of Peritoneal Metastasis in Gastric Cancer. PLoS One. 2015;10:e0130472.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 159]  [Cited by in RCA: 146]  [Article Influence: 13.3]  [Reference Citation Analysis (3)]
31.  Wang N, Wang L, Yang Y, Gong L, Xiao B, Liu X. A serum exosomal microRNA panel as a potential biomarker test for gastric cancer. Biochem Biophys Res Commun. 2017;493:1322-1328.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 112]  [Cited by in RCA: 108]  [Article Influence: 12.0]  [Reference Citation Analysis (5)]
32.  Shi Y, Wang Z, Zhu X, Chen L, Ma Y, Wang J, Yang X, Liu Z. Exosomal miR-1246 in serum as a potential biomarker for early diagnosis of gastric cancer. Int J Clin Oncol. 2020;25:89-99.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 110]  [Cited by in RCA: 102]  [Article Influence: 17.0]  [Reference Citation Analysis (1)]
33.  Liu Y, Wang M, Deng T, Liu R, Ning T, Bai M, Ying G, Zhang H, Ba Y. Exosomal miR-155 from gastric cancer induces cancer-associated cachexia by suppressing adipogenesis and promoting brown adipose differentiation via C/EPBβ. Cancer Biol Med. 2022;19:1301-1314.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 22]  [Cited by in RCA: 29]  [Article Influence: 7.3]  [Reference Citation Analysis (1)]
34.  Jiao Y, Zhang L, Li J, He Y, Zhang X, Li J. Exosomal miR-122-5p inhibits tumorigenicity of gastric cancer by downregulating GIT1. Int J Biol Markers. 2021;36:36-46.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 29]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
35.  Zheng GD, Xu ZY, Hu C, Lv H, Xie HX, Huang T, Zhang YQ, Chen GP, Fu YF, Cheng XD. Exosomal miR-590-5p in Serum as a Biomarker for the Diagnosis and Prognosis of Gastric Cancer. Front Mol Biosci. 2021;8:636566.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 50]  [Cited by in RCA: 48]  [Article Influence: 9.6]  [Reference Citation Analysis (0)]
36.  Lu X, Lu J, Wang S, Zhang Y, Ding Y, Shen X, Jing R, Ju S, Chen H, Cong H. Circulating serum exosomal miR-92a-3p as a novel biomarker for early diagnosis of gastric cancer. Future Oncol. 2021;17:907-919.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 33]  [Article Influence: 6.6]  [Reference Citation Analysis (1)]
37.  Kumata Y, Iinuma H, Suzuki Y, Tsukahara D, Midorikawa H, Igarashi Y, Soeda N, Kiyokawa T, Horikawa M, Fukushima R. Exosomeencapsulated microRNA23b as a minimally invasive liquid biomarker for the prediction of recurrence and prognosis of gastric cancer patients in each tumor stage. Oncol Rep. 2018;40:319-330.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 36]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
38.  Wang J, Yan F, Zhao Q, Zhan F, Wang R, Wang L, Zhang Y, Huang X. Circulating exosomal miR-125a-3p as a novel biomarker for early-stage colon cancer. Sci Rep. 2017;7:4150.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 160]  [Cited by in RCA: 151]  [Article Influence: 16.8]  [Reference Citation Analysis (4)]
39.  Huang X, Yuan T, Liang M, Du M, Xia S, Dittmar R, Wang D, See W, Costello BA, Quevedo F, Tan W, Nandy D, Bevan GH, Longenbach S, Sun Z, Lu Y, Wang T, Thibodeau SN, Boardman L, Kohli M, Wang L. Exosomal miR-1290 and miR-375 as prognostic markers in castration-resistant prostate cancer. Eur Urol. 2015;67:33-41.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 558]  [Cited by in RCA: 523]  [Article Influence: 47.5]  [Reference Citation Analysis (1)]
40.  Olive V, Bennett MJ, Walker JC, Ma C, Jiang I, Cordon-Cardo C, Li QJ, Lowe SW, Hannon GJ, He L. miR-19 is a key oncogenic component of mir-17-92. Genes Dev. 2009;23:2839-2849.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 513]  [Cited by in RCA: 504]  [Article Influence: 29.6]  [Reference Citation Analysis (0)]
41.  Hsu TI, Hsu CH, Lee KH, Lin JT, Chen CS, Chang KC, Su CY, Hsiao M, Lu PJ. MicroRNA-18a is elevated in prostate cancer and promotes tumorigenesis through suppressing STK4 in vitro and in vivo. Oncogenesis. 2014;3:e99.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 96]  [Cited by in RCA: 95]  [Article Influence: 7.9]  [Reference Citation Analysis (1)]
42.  Tsujiura M, Komatsu S, Ichikawa D, Shiozaki A, Konishi H, Takeshita H, Moriumura R, Nagata H, Kawaguchi T, Hirajima S, Arita T, Fujiwara H, Okamoto K, Otsuji E. Circulating miR-18a in plasma contributes to cancer detection and monitoring in patients with gastric cancer. Gastric Cancer. 2015;18:271-279.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 62]  [Cited by in RCA: 74]  [Article Influence: 6.7]  [Reference Citation Analysis (0)]
43.  Wang M, Gu H, Wang S, Qian H, Zhu W, Zhang L, Zhao C, Tao Y, Xu W. Circulating miR-17-5p and miR-20a: molecular markers for gastric cancer. Mol Med Rep. 2012;5:1514-1520.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 20]  [Cited by in RCA: 72]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
44.  Wu Q, Yang Z, An Y, Hu H, Yin J, Zhang P, Nie Y, Wu K, Shi Y, Fan D. MiR-19a/b modulate the metastasis of gastric cancer cells by targeting the tumour suppressor MXD1. Cell Death Dis. 2014;5:e1144.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 92]  [Cited by in RCA: 104]  [Article Influence: 8.7]  [Reference Citation Analysis (0)]
45.  Wu Q, Yang Z, Wang F, Hu S, Yang L, Shi Y, Fan D. MiR-19b/20a/92a regulates the self-renewal and proliferation of gastric cancer stem cells. J Cell Sci. 2013;126:4220-4229.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 78]  [Cited by in RCA: 98]  [Article Influence: 7.5]  [Reference Citation Analysis (2)]
46.  Zhou X, Zhu W, Li H, Wen W, Cheng W, Wang F, Wu Y, Qi L, Fan Y, Chen Y, Ding Y, Xu J, Qian J, Huang Z, Wang T, Zhu D, Shu Y, Liu P. Diagnostic value of a plasma microRNA signature in gastric cancer: a microRNA expression analysis. Sci Rep. 2015;5:11251.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 110]  [Cited by in RCA: 110]  [Article Influence: 10.0]  [Reference Citation Analysis (4)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Oncology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade B, Grade B, Grade B, Grade D

Novelty: Grade B, Grade B, Grade B, Grade C

Creativity or Innovation: Grade B, Grade B, Grade B, Grade C

Scientific Significance: Grade B, Grade B, Grade B, Grade C

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work noncommercially, and license their derivative works on different terms, provided the original work is properly cited and the use is noncommercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Tsukanov VV; Ulasoglu C S-Editor: Li L L-Editor: A P-Editor: Zhao S

Write to the Help Desk