BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastrointest Oncol. May 15, 2025; 17(5): 104686
Published online May 15, 2025. doi: 10.4251/wjgo.v17.i5.104686
SPDL1 inhibition enhances colorectal cancer progression via epidermal growth factor receptor/extracellular signal-regulated kinase pathways
Peng Peng, Juan Sun, Meng-Shi Li, Ruo-Xi Cheng, Shi-Quan Liu, Meng-Bin Qin, Jin-Xiu Zhang, Jie-An Huang, Department of Gastroenterology, The Second Affiliated Hospital of Guangxi Medical University, Nanning 530007, Guangxi Zhuang Autonomous Region, China
ORCID number: Peng Peng (0000-0001-8648-1703); Shi-Quan Liu (0000-0002-3552-8732); Meng-Bin Qin (0000-0001-9927-5482); Jie-An Huang (0000-0003-0431-1888).
Co-first authors: Peng Peng and Juan Sun.
Co-corresponding authors: Jin-Xiu Zhang and Jie-An Huang.
Author contributions: Peng P, Sun J, Li MS, Zhang JX, and Huang JA developed the original hypothesis and supervised the experimental design; Peng P, Zhang JX, Li MS, and Qin MB performed the experiments; Sun J, Cheng RX and Liu SQ participated in the clinical specimens collection; Sun J, Zhang JX, Liu SQ and Qin MB analyzed the data and performed statistical analysis; Peng P, Sun J, Zhang JX, and Huang JA wrote and revised the manuscript; All authors read and approved the final manuscript.
Supported by the Natural Science Foundation of Guangxi Province, No. 2019GXNSFAA185030 and No. 2023GXNSFBA026129; the Scientific Research Project of the Second Affiliated Hospital of Guangxi Medical University, No. EFYKY2020013; and the Cultivation Science Foundation of the Second Affiliated Hospital of Guangxi Medical University, No. GJPY2023005 and No. GJPY2023009.
Institutional review board statement: The study was reviewed and approved by the second Affiliated Hospital of Guangxi Medical University Institutional Review Board (No. KY-0231).
Institutional animal care and use committee statement: No animal experiments were performed in this study and therefore no animals were used.
Conflict-of-interest statement: The authors declare that they have no conflict of interest.
Data sharing statement: No additional data are available.
Corresponding author: Jie-An Huang, PhD, Chief Physician, Professor, Department of Gastroenterology, The Second Affiliated Hospital of Guangxi Medical University, No. 166 Daxue East Road, Xixiangtang District, Nanning 530007, Guangxi Zhuang Autonomous Region, China. hjagxmu@163.com
Received: December 31, 2024
Revised: March 11, 2025
Accepted: April 10, 2025
Published online: May 15, 2025
Processing time: 135 Days and 17.8 Hours

Abstract
BACKGROUND

In patients with colorectal cancer (CRC), tumour metastasis is the leading cause of death. The search for key genes involved in metastasis of CRC is imperative for improved prognoses and treatments. SPDL1 has been implicated in the development of CRC, however, its mechanism of action remains unclear.

AIM

To investigate the role and mechanism of action by which SPDL1 inhibits the development and metastasis of CRC.

METHODS

In this study, we examined the relationship between SPDL1 expression and CRC prognosis using immunohistochemistry. Survival analyses were performed using Kaplan-Meier analysis and log-rank test. After knocking down SPDL1 in the HCT116 cancer cell line changes in cell viability, migration, invasion, and gene expression were examined using a cell counting kit 8 assay, Transwell assay, and Western blot. The effect of SPDL1 on the cell cycle was assessed using flow cytometry. RNA sequencing was used to analyse the effect of SPDL1 on gene expression of CRC cells. The mechanism of action of SPDL1 in CRC was further clarified using U0126, an inhibitor of the mitogen-activated protein kinase signaling pathway.

RESULTS

SPDL1 is expressed at low levels in tissues of patients with CRC, and this reduced expression is associated with poor prognosis. Functionally, low expression of SPDL1 in CRC promotes cell proliferation, migration, invasion, and affects the cell cycle. Mechanistically, SPDL1 affects the progression of CRC through its regulation of the process of epithelial-mesenchymal transition (EMT) and of the epidermal growth factor receptor (EGFR)/ extracellular signal-regulated kinase (ERK) signaling pathways.

CONCLUSION

This study showed that the loss of SPDL1 may induce EMT and promote cell migration and invasion in CRC through the EGFR/ERK pathway.

Key Words: Colorectal cancer; SPDL1; Epidermal growth factor receptor; Epithelial-mesenchymal transition; Extracellular signal-regulated kinase; Migration; Invasion

Core Tip: The SPDL1 is a gene involved in cell cycle regulation and influences the development of a variety of tumours, including colorectal cancer (CRC). In this study, we investigated the effect of SPDL1 on CRC. We found that interference with SPDL1 expression promoted CRC proliferation, migration and invasion, suggesting that SPDL1 may have a potential tumour suppressor role in CRC by inducing epithelial-mesenchymal transition and by mechanistically targeting the epidermal growth factor receptor/extracellular signal-regulated kinase pathway.



INTRODUCTION

Colorectal cancer (CRC) is the third most common cancer worldwide, accounting for 10 percent of all incidents of cancer and associated deaths[1]. Improvements in diagnostic testing and therapeutic strategies have enhanced the prognosis of CRC over the past decades[2]. However, the 5-year relative survival rate for patients with distant metastatic disease remains low-only 11.7%[3]. As cancer metastasis is a major cause of death, the identification of novel metastasis-related predictive biomarkers and the clarification of the mechanisms associated with metastasis are crucial for enhancing the prognosis of patients with CRC[4].

The SPDL1 gene encodes spindly (CCDC99), which serves as a critical regulator of the mitotic or spindle assembly checkpoint (SAC). CCDC99 contains a coiled-coil structural domain that plays a role in the formation of the mitotic spindle and the segregation of chromosomes during mitosis or meiosis. CCDC99 also coordinates microtubule attachment by promoting the recruitment of dynamin and plays a role in SAC transduction[5]. The loss of SPDL1 results in the formation of unstable microtubule-kinetochore attachments, which in turn impedes the proper movement of chromosomes and results in the inactivation of the SAC. This can lead to extensive premature mitotic exit through the G2/M phase[6]. Studies have shown that intensity-modulated radiotherapy resulted in the down-regulation of relevant growth factors such as fibroblast growth factor, insulin-like growth factor 1, and platelet-derived growth factor, and resulted in the up-regulation of promoter genes like extracellular signal-regulated kinase (ERK) and mitogen-activated protein kinase (MAPK). Intensity-modulated radiotherapy also resulted in an upregulation of nuclear factor-kappa B signaling and of cell cycle-promoting genes, including SPDL1. Together, these changes in gene expression induce a pro-survival response[7].

Many studies have shown that SPDL1 is upregulated in triple-negative breast cancer, oral squamous cell carcinoma, and pancreatic ductal adenocarcinoma, and that its overexpression correlates with poor patient prognosis[8-10]. Kodama et al[11] identified SPDL1 as a candidate suppressor gene in CRC, and showed that inhibition of SPDL1 promoted CRC cell invasion and migration. Klimaszewska-Wiśniewska et al[12] showed that altered expression of SPDL1 in CRC tissues predicts patient prognosis, which may be related to microsatellite instability, but due to lack of data, it was not possible to further analyse the role and mechanism of SPDL1 in CRC. The aberrant expression of SPDL1 is linked to genomic instability and facilitates the onset and advancement of various cancers[13]. Many aspects of SPDL1 function and regulation remain unresolved due to the paucity of information on SPDL1 in human cancers. In particular, the role of SPDL1 in CRC must be further elucidated.

In our study, we first performed immunohistochemistry to analyse the expression of SPDL1 in tissues from patients with CRC in order to examine the relationship between expression levels and patient prognosis. HCT116 cells were used to analyse the effect of SPDL1 gene knockdown on cell proliferation, migration, and invasion, and to analyse the effect of knockdown on the cell cycle. To examine the mechanism by which SPDL1 expression influences CRC, the effect of SPDL1 on gene expression in CRC cells was analysed using RNA sequencing and bioinformatics analysis, and verified in vitro. Our results suggest that SPDL1 may act as a tumour suppressor in CRC, and these results may provide a theoretical basis for the application of SPDL1 as a therapeutic target in the treatment of CRC.

MATERIALS AND METHODS
Tissue specimens

Specimens of patients with CRC (129 cases) and normal colorectal mucosal tissues (20 cases) were collected by surgical resection at the Second Affiliated Hospital of Guangxi Medical University from October 2015 to December 2019. None of the patients had received radiation, chemotherapy, or bioimmunotherapy prior to surgery, and the presence of cancer in the tissues was confirmed by pathology after surgery. The study received approval from the Ethics Committee at the Second Affiliated Hospital of Guangxi Medical University (No. KY-0231) and was conducted in alignment with the ethical standards outlined in the Declaration of Helsinki. All participants provided written informed consent prior to their inclusion in the study.

Immunohistochemical staining

Immunohistochemistry was performed as previously described[14]. Tissue sections were incubated with rabbit anti-SPDL1 antibody (1:500, Cat. HPA044700, Sigma Aldrich, St Louis, MO, United States) at 4 °C overnight. Staining was quantified using the Remmele immunoreactive score (IRS), a composite measure based on the percentage of positive cells multiplied by the staining intensity. The scoring for the percentage of positive cells per area was categorized as follows: 0 indicates no positive cells, 1 indicates < 25% positive, 2 indicates 26%-50% positive, 3 indicates 51%-75% positive, and 4 indicates > 75% positive. Staining intensity was measured on a 4-point scale where 0 indicates no staining, 1 indicates pale yellow staining, 2 indicates yellow staining, and 3 indicates brown staining. A signal was considered positive based on the presence of brownish-yellow granules in the cytoplasm. The IRS score was calculated from the average of 5 randomly selected areas in the field of view for each sample. A score of < 1 was negative; a score of 1-4 was weakly positive (1 +); a score of 5-8 was moderately positive (2 +); and a score of 9-12 was strongly positive (3 +).

Cell culture

The human HCT116, RKO, HT-29, SW-620, NCM460 cell lines were obtained from the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Meilunbio, Dalian, Liaoning Province, China) supplemented with 10% fetal bovine serum (FBS) (VivaCell, Shanghai, China), 100 U/mL penicillin (Meilunbio, Dalian, Liaoning Province, China) and 0.1 mg/mL streptomycin (Meilunbio, Dalian, Liaoning Province, China) in a 50 mL/L humidified incubator at 37 °C.

Small interfering RNA and plasmid synthesis and transfection

Small interfering RNA (siRNA) targeting SPDL1 (si-SPDL1) and negative control were purchased from Genechem (Shanghai, China). HCT116 cells were seeded in 6-well plates and transfection was performed when the cell cultures reached 70%-90% confluence. Gene knockdown was performed using LipofectamineTM 3000, according to the manufacturer’s instructions. Briefly, SPDL1 siRNA was diluted to 40 nmol/L in serum-free Opti-MEM medium. Lipofectamine 3000 Transfection Reagent was diluted in Opti-MEM medium and mixed. After 5 minutes, the diluted siRNA and lipofectamine 3000 solutions were mixed and allowed to stand for 15 minutes at room temperature and then added to the cells. Cells were incubated in a 50 mL/L humidified incubator at 37 °C for 48 hours. The effect of siRNA transfection was assessed using quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and Western blotting, after which additional experiments were performed using transfected cells.

qRT-PCR

Total RNA extraction and reverse transcription were performed as previously described[14]. Samples were subjected to quantitative polymerase chain reaction (qPCR) amplification on a StepOnePlus™ RT-PCR system using power SYBR green master mix (Promega). qPCR conditions were set to an initial 95 °C for 2 minutes, followed by 40 cycles of 95 °C for 15 seconds and 60 °C for 1 minute. Primer sequences for each gene were designed in our laboratory and synthesised by Sangon (Shanghai, China). Primer sequences for SPDL1 and homo sapiens β-actin (ACTB) are shown in Table 1. The relative level of mRNA was quantitated using the 2-(Δct sample - Δct control) method and normalized to ACTB levels.

Table 1 Sequences of primers used for real-time polymerase chain reaction.
Gene
Sequence (5’ to 3’)
SPDL1ForwardGCTGCTGAATCAAAGCTTCAAACA
ReverseTTGAGGCAAGTGGCACCGTA
ACTBForwardGTCATTCCAAATATGAGATGCGT
ReverseGCTATCACCTCCCCTGTGTG
Western blotting

To isolate total cellular proteins, cells were lysed with radio immunoprecipitation assay buffer containing 1% phosphatase inhibitor and 1% phenylmethylsulfonyl fluoride, and quantified using the bicinchoninic acid assay protein assay kit. Equal protein aliquots (30-40 μg per lane) were subjected to electrophoresis on 8% or 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels and subsequently transferred to 0.22-μm polyvinylidene difluoride membranes. Protein levels were quantified by normalizing the band density of the target protein against the band density of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein, as previously described[15]. The following antibodies were used for Western blotting: Monoclonal anti-GAPDH (1:10000, Cat. 60004-1-Ig, ProteinTech Group, Wuhan, Hubei Province, China), rabbit polyclonal anti-GAPDH (1:10000, Cat. AC001, Abclonal Technology, Wuhan, Hubei Province, China) anti-SPDL1 (1:1000, Cat. ab99344, Abcam, Cambridge, United Kingdom), polyclonal anti-Snail (1:500, Cat. 13099-1-AP, ProteinTech Group, Wuhan, Hubei Province, China), rabbit monoclonal anti-ERK1/2 (1:1000 Cat. A4782, Abclonal Technology, Wuhan, Hubei Province, China), rabbit monoclonal anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E) XP® (1:1000, Cat. 4370, Cell Signaling Technology, Boston, MA, United States), polyclonal anti-vimentin (1:2000, Cat. 10366-1-AP, ProteinTech Group, Wuhan, Hubei Province, China), rabbit monoclonal anti-E-Cadherin (24E10) (1:2000, Cat. 3195, Cell Signaling Technology, Boston, MA, United States), rabbit polyclonal anti-epidermal growth factor receptor (EGFR) (1:1000, Cat. A11351, Abclonal Technology, Wuhan, Hubei Province, China), anti-mouse IgG (H + L) (DyLight 800 4X PEG Conjugate, 1:10000, Cat. 5257P, Cell Signaling Technology, Boston, MA, United States), anti-rabbit IgG (H + L) (DyLight 800 4X PEG Conjugate, 1:10000, Cat. 5151S, Cell Signaling Technology, Boston, MA, United States).

Cell proliferation assay

Cell proliferation and viability were assessed using the cell counting kit 8 (CCK8) (Meilunbio), according to the manufacturer’s instructions. In brief, 3000 cells were loaded into each well of a 96-well plate, and absorbance was measured at 450 nm using a spectrophotometer at 24, 48, 72, 96, and 120 hours.

Invasion and migration assays

To detect changes in cell migration/invasion capacity, Transwell assays were performed using 24-well plug plates containing 8.0 μm polycarbonate filter chambers (Corning Costar, Corning, NY, United States). Briefly, 100 μL of serum-starved cells (containing 6 × 104 cells) was added to the upper chamber, and 600 μL of DMEM containing 20% FBS was added to the lower chamber. Following a 48-hour incubation in a 50 mL/L humidified incubator at 37 °C, the non-migrated cells adhered to the upper chamber surface were carefully removed with a swab. The migrated or invaded cells in the lower chamber were then fixed with 0.4% paraformaldehyde for 30 minutes at room temperature. After fixation, cells were stained with a 0.1% crystal violet solution for 30 minutes, rinsed with tap water, and allowed to dry. Cell photographs were captured from five randomly chosen fields of view using an inverted microscope (Life Technologies, United States) at 200 × magnification. Data quantification was performed using ImageJ software. For the Transwell cell invasion assay, chamber membranes were pre-coated with Matrigel (Corning Costar), and the rest of the assay was performed as described above.

Flow cytometry

HCT116 cells in the logarithmic growth phase were seeded into 24-well plates at a concentration of 1 × 106 cells/mL in a volume of 1 mL. Following experimental treatments, cells were digested with trypsin and centrifuged. For flow cytometry, cells were resuspended in phosphate-buffered saline (PBS), fixed in 75% ethanol, and incubated at 4 °C for 5 hours. Subsequently, cells were centrifuged at 1500 rpm for 5 minutes at 37 °C and incubated in 100 μL PBS containing 100 μg/mL RNase A (Sigma Aldrich) for 30 minutes at 4 °C in darkness. Cells were then stained with propidium iodide for 30 minutes at room temperature in darkness. Flow cytometry was performed following standard procedures, typically analyzing between 20000 and 30000 cells, with results processed using FlowJo 7.6 software.

RNA sequencing

RNA sequencing was conducted on HCT116 cells prior to and following siRNA knockdown of SPDL1 (n = 3 per group, 6 samples in total: Control-1, control-2, control-3; SiSPDL1-1, siSPDL1-2, siSPDL1-3). Total RNA was extracted using Trizol (Invitrogen, United States), according to the manufacturer’s instructions. Library preparation and sequencing were carried out at Shenzhen BGI Genomics Co. Data mining analysis was performed using the Dr. Tom multi-omics data mining system (https://biosys.bgi.com), which included differential gene expression analysis, Gene Ontology (GO) functional enrichment analysis, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis.

Statistical analysis

All data are presented as the mean ± SD and were statistically analyzed using GraphPad Prism 9.0 (GraphPad Software, Inc., La Jolla, CA, United States) or SPSS 26.0 software package (SPSS, Chicago, IL, United States). A χ2 test was used to analyse count data. A Kaplan-Meier test was conducted to evaluate survival outcomes. In the event that the samples exhibited a normal distribution, a t-test was used to compare the difference between two groups, whereas an analysis of variance was used to evaluate differences between multiple groups. In the event that the samples did not exhibit a normal distribution, non-parametric tests for multiple samples were conducted. A P value of < 0.05 was considered statistically significant.

RESULTS
SPDL1 is expressed at lower levels in CRC tissues and its reduced expression is associated with poor prognosis in patients with CRC

In order to evaluate any differences in SPDL1 expression between CRC tissues and normal colorectal tissues, immunohistochemical staining for SPDL1 was performed in 129 specimens of CRC patients and 20 normal colorectal tissues. Immunohistochemical results showed that SPDL1 was mainly expressed in cytoplasm, with a positive expression rate of 52.7% (68/129) in CRC tissue and 75% (15/20) in normal colorectal tissue, indicating that the positive expression of SPDL1 in CRC tissues was significantly lower than that of normal colorectal tissues (Figure 1A and B, P < 0.05). In addition, we also analysed the relationship between the expression of SPDL1 in CRC and the clinicopathological features of CRC. Our results showed that the expression of SPDL1 was significantly correlated with the degree of differentiation, tumor node metastasis (TNM) stage, and lymph node metastasis (Table 2, P < 0.05), whereas it was not correlated with the age, gender, tumour size, depth of invasion, and distant metastasis (Table 2, P > 0.05). An analysis of the results suggested that positive expression of SPDL1 in highly differentiated, moderately differentiated, and poorly differentiated CRC tissues was 80%, 52.7%, and 22.2%, respectively. This indicates that the lower the differentiation of CRC tissues, the lower the positive rate of SPDL1 expression. The positive rates of stage I, II, III, and IV were 62.5%, 65.2%, 41.3%, and 30.8%, respectively, indicating that the higher the TNM stage, the lower the levels of SPDL1 expression. The positive rates of SPDL1 expression with and without lymph node metastasis were 38.9% and 62.7%, respectively, which suggests that CRC tissues with lymph node metastasis have lower levels of SPDL1 (Table 2). We further analysed the relationship between the expression level of SPDL1 and patient prognosis in all 129 CRC specimens, and the results showed that the overall survival of patients with lower SPDL1 expression was reduced compared to patients with higher SPDL1 expression (Figure 1C, P < 0.05). These results suggest that SPDL1 is expressed at lower levels in CRC and that lower expression is associated with poor patient prognosis. Thus, SPDL1 may play a cancer-suppressive role in CRC.

Figure 1
Figure 1 SPDL1 is expressed at lower levels in colorectal cancer tissues, and its lower expression is associated with poor patient. A: SPDL1 expression in colorectal cancer (CRC) vs normal colorectal mucosa (N) (400 ×); B: Percentage of SPDL1 expression in CRC tissues and N; C: Comparison of overall survival in patients with CRC with high or low SPDL1 expression. CRC: Colorectal cancer; N: Normal colorectal mucosa.
Table 2 Relationship between the expression of SPDL1 and clinicopathological features of colorectal cancer, n (%).
Clinicopathological characteristicSPDL1
P value
+
-
Sex0.169
Male48 (57.1)36 (42.9)
Female20 (44.4)25 (55.6)
Age (years)0.517
≤ 6028 (50.9)27 (49.1)
> 6040 (54.1)34 (45.9)
Tumor size0.708
< 5 cm47 (51.6)44 (48.4)
≥ 5 cm21 (55.3)17 (44.7)
Tumor differentiation0.034
Well8 (80.0)2 (20.0)
Moderate58 (52.7)52 (47.3)
Poor2 (22.2)7 (77.8)
Tumor-node-metastasis stage0.033
I15 (62.5)9 (37.5)
II30 (65.2)16 (34.8)
III19 (41.3)27 (59.7)
IV4 (30.8)9 (69.2)
Depth of infiltration0.975
T1 + T218 (52.9)16 (47.1)
T3 + T450 (52.6)45 (47.4)
Lymph node metastasis0.02
N047 (62.7)28 (37.3)
N112 (44.4)15 (55.6)
N29 (33.3)18 (66.7)
Distant metastasis0.095
M064 (55.2)52 (44.8)
M14 (30.8)9 (69.2)
Low expression of SPDL1 promotes proliferation, migration, and invasion of CRC cells

To explore the potential role of SPDL1 in CRC development, we measured the expression levels of SPDL1 in a non-cancerous colonic epithelial cell line (NCM460 cells) and several CRC cell lines (RKO cells, SW-620 cells, HCT116 cells, HT-29 cells) by Western blotting. Our results showed that the expression of SPDL1 in the above cancer cell lines was lower than the expression in NCM460 cells (Figure 2A, P < 0.05). We next constructed an HCT116 cell line using siRNA that expressed low levels of SPDL1 (Figure 2B, P < 0.05) and performed the CCK8 and Transwell assays to analyse the effect of lower SPDL1 expression on the proliferation, invasion, and metastasis of CRC cells. The results showed that reduced expression of SPDL1 enhanced the proliferation, migration, and invasion of CRC cells (Figure 2C and D, P < 0.05), further suggesting that SPDL1 plays a cancer-suppressive role in CRC.

Figure 2
Figure 2 Small interfering RNA knockdown of SPDL1 promotes proliferation, migration and invasion of colorectal cancer cells. A: Western blot showing the expression of SPDL1 protein in a non-cancerous colonic epithelial cell line and colorectal cancer cell lines; B: Quantitative reverse transcription-polymerase chain reaction showing siRNA knockdown of the SPDL1 gene; C: Cell counting kit-8 assay; D: Transwell assay. Data are presented as the mean ± SD from three independent experiments. aP < 0.05. bP < 0.01. dP < 0.0001. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; Con: Control; NC: Negative control; si-SPDL1: Small interfering RNA targeting SPDL1; OD: Optical density.
Effect of reduced SPDL1 expression on the cell cycle in CRC cells

SPDL1 is an important regulator of the mitotic checkpoint, affecting cell division and the cell cycle. In order to investigate whether it exerts an oncogenic effect in CRC cells by affecting the cell cycle, we analysed the effect of SPDL1 on the cell cycle of CRC using flow cytometry for propidium iodide. Propidium iodide stains DNA, and the proportions of DNA present can be used to categorize cells in each phase of the cell cycle. The results showed that compared with the control group, the number of cells in S-phase was significantly decreased in the si-SPDL1 group (Figure 3, P < 0.05). There was no significant difference in the number of cells in the G0/G1 phase or the G2/M phase (Figure 3, P > 0.05). This suggests that reduced expression of SPDL1 in HCT116 cells may lead to S-phase inhibition, which exerts a cancer-suppressive effect by altering S-phase DNA synthesis.

Figure 3
Figure 3 Effect of reduced SPDL1 expression on the cell cycle of colorectal cancer cells as measured by flow cytometry. The data are presented as the mean ± SD from three independent experiments. aP < 0.05. Con: Control; si-SPDL1: Small interfering RNA targeting SPDL1.
SPDL1 affects the expression of proteins related to epithelial-mesenchymal transition and the EGFR/ERK signaling pathway

To further validate the role of SPDL1 in CRC, we performed RNA sequencing and further analyses on HCT116 cells expressing low levels of SPDL1 (Figure 4). Firstly, differential gene expression analysis was performed with |Log2(fold change)| ≥ 0, Q value ≤ 0.05, which showed 247 up genes and 342 down genes (Figure 4A). Next, GO enrichment analysis was performed on the differentially expressed genes to describe their functional top 20, with the results showing that the involved biological processes were mainly enriched in ‘cell cycle’, the cellular components were mainly enriched in ‘chromosome region’ and ‘cytoplasm’, and molecular function was mainly enriched in “protein binding” (Figure 4B-D). The analysis of KEGG enrichment of the differentially expressed genes showed that top 20 genes were enriched, of which the differentially expressed genes were mainly enriched in ‘MAPK signaling pathway’ and ‘cell cycle signaling pathway’ (Figure 4E, H and I). We further analysed the expression of EGFR (the upstream gene of the MAPK pathway), and protein kinase A (PKA) (the Raf-regulated gene) in the si-SPDL1 group and the control group according to the gene expression of the sequencing data. The results showed that the expression of EGFR and PKA in the si-SPDL1 group was significantly higher than that in the control group (Figure 4F and G, P < 0.05). Therefore, we speculated that the role of SPDL1 in CRC may be related to the EGFR/MAPK signaling pathway. Some studies have shown that the MAPK signaling pathway promotes epithelial-mesenchymal transition (EMT), that cytoskeletal re-organization is a key component of EMT, and that SPDL1 depletion can lead to cytoskeletal changes. Therefore, we speculated that SPDL1 may affect EMT by regulating the MAPK signaling pathway, thereby affecting the invasion and migration of CRC cells. To verify our hypothesis, we measured the expression of EGFR, ERK, phospho-ERK (p-ERK), and EMT-related proteins (snail, vimentin, E-cadherin) in control and si-SPDL1 HCT116 cells by Western blot (Figure 5A-E). The results showed that in si-SPDL1 cells, the expression of EGFR, p-ERK, snail, and vimentin proteins was increased (P < 0.05), ERK expression was unchanged (P > 0.05), and E-cadherin was decreased (P < 0.05) after interfering with SPDL1 expression. This suggests that reduced expression of SPDL1 may activate the EGFR/ERK signaling pathway and promote EMT.

Figure 4
Figure 4 Transcriptomics analysis. A: Differential gene expression volcano map; B-D: Gene Ontology enrichment analysis; E: Kyoto Encyclopedia of Genes and Genomes enrichment analyses; F: Average expression of epidermal growth factor receptor; G: Average expression of protein kinase A; H: Mitogen-activated protein kinase signaling pathway-heatmap; I: Cell cycle signaling pathway-heatmap. aP < 0.05. si-SPDL1: Small interfering RNA targeting SPDL1; DEGS: Differentially expressed genes; GO: Gene Ontology; MCM: Minichromosome maintenance complex; CHOP: C/EBP homologous protein; ATP: Adenosine triphosphate; KEGG: Kyoto Encyclopedia of Genes and Genomes; MAPK: Mitogen-activated protein kinase; EGFR: Epidermal growth factor receptor; PKA: Protein kinase A; TPM: Transcripts per million.
Figure 5
Figure 5 SPDL1 affects the expression of proteins related to epithelial-mesenchymal transition, epidermal growth factor receptor/extracellular signal-regulated kinase signaling pathway. A: Representative Western blot images after SPDL1 knocked down in HCT116 cells; B-E: Quantification of Western blot data in (A); F: Representative Western blot images. Cells were treated with U0126 and analyzed by Western blot; G-L: Quantification of Western blot data in (F). Data are presented as the mean ± SD from three independent experiments. aP < 0.05. bP < 0.01. dP < 0.0001. ns: Not significant; ERK: Extracellular signal-regulated kinase; p-ERK: Phospho-extracellular signal-regulated kinase; EGFR: Epidermal growth factor receptor; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; Con: Control; NC: Negative control; si-SPDL1: Small interfering RNA targeting SPDL1.
SPDL1 affects invasion and metastasis of HCT116 cells by mediating the EMT, EGFR/ERK signaling pathways

To further investigate the mechanism of action by which SPDL1 affects CRC, we used the MAPK inhibitor U0126, a highly selective inhibitor of mitogen-activated protein kinase (MEK) 1 and MEK2, which can inhibit MAPK activation by inhibiting the kinase activity of MAP kinase. After treatment, changes in proliferative, invasiveness, and metastatic ability of cells were examined, as were changes in ERK, p-ERK, and EMT-related proteins (snail, vimentin, E-cadherin). The results showed that treatment with U0126 reversed the increase in cell proliferation, invasion, and metastasis of HCT116 after SPDL1 knockdown (Figure 6). The results also showed that the increased expression of p-ERK, snail, vimentin, and E-cadherin that occurred after SPDL1 knockdown could be reversed by treatment with U0126 (Figure 5F-L). These results suggest that reduced SPDL1 expression promotes activation the MAPK signaling pathway, leading to increased invasiveness and migration of CRC cells, and that this may be achieved by mediating the EGFR/ERK signaling pathway to regulate the EMT pathway.

Figure 6
Figure 6 SPDL1 inhibits the malignant biological behaviour of HCT116 cells. A: Cell counting kit-8 assay; B and C: Transwell migration assay (magnification, 100 ×). The data are presented as the mean ± SD from three independent experiments. aP < 0.05. 1P vs negative control group. 2P vs negative control + U0126 group. Con: Control; NC: Negative control; si-SPDL1: Small interfering RNA targeting SPDL1; OD: Optical density.
DISCUSSION

The development of CRC is a complex process that involves a multitude of molecular interactions and is regulated by key genes. Tumour metastasis is the major cause of death in CRC patients, therefore there is an urgent clinical need to study the molecular mechanisms involved in metastasis in CRC invasion and to search for relevant, novel gene targets.

SPDL1 contains a coiled-coil structural domain that plays a key role in mitosis; this protein regulates chromosome alignment and microtubule attachment at the mid-phase mitotic site. It also regulates the SAC and facilitates the removal of the kinetochore outer component and of SAC proteins by re-recruiting microtubule kinesin to the mitotic site. Along with the formation of stabilised microtubule attachments, these processes allow the cell to move from mid-phase to late phase and complete mitosis[16]. SPDL1 shows variable expression levels in different tumours, it is highly expressed in pancreatic cancer tissues and its expression significantly correlates with tumour stage and survival[8]. Similarly, in oral squamous cell carcinoma, SPDL1 expression is higher than normal, and inhibition of SPDL1 can be cytotoxic and increase the sensitivity of cisplatin chemotherapy[9]. It has also been shown that lower SPDL1 expression is significantly associated with poorer CRC patient survival[11]. Other studies have found that SPDL1 is an independent predictor of prognosis in patients with CRC, with higher expression being correlated with a more favourable prognosis[12]. In our study, we found that SPDL1 expression in tissue samples from patients with CRC was lower than that of normal colorectal mucosa, and SPDL1 was mainly expressed in the cytoplasm and cell membrane. The expression of SPDL1 in several CRC cell lines (RKO cells, SW-620 cells, HCT116 cells, HT-29 cells) was lower than that of the NCM460 cell line. Clinicopathological analysis further revealed that SPDL1 expression had no significant correlation with age, gender, tumour size, infiltration depth, and distant metastasis, but was significantly negatively correlated with the degree of differentiation, TNM stage, and lymph node metastasis, indicating that SPDL1 expression was correlated with the degree of malignancy and progression of CRC. Survival analyses showed that CRC patients with lower SPDL1 expression had a lower survival rate. The above evidence suggests that SPDL1 expression has heterogeneous manifestations in different tumours and may be a prognostic marker for CRC, thus we further investigated its role and mechanism in CRC.

Acquisition of motility and invasive phenotypes are important features of malignant tumours. Tumour cells must acquire an invasive phenotype in order to escape the primary tumour and enter the vascular lymphatic system, survive the circulation, infiltrate, and settle in distant organs[17]. Proteins encoded by SPDL1 play a role in coordinating microtubule attachment by promoting kinesin recruitment and mitotic checkpoint signaling. Although microtubules do not generate force per se, they are essential for the polarization and regulation of migration rates in many cell types, and there are many feedback points of interaction between microtubules, local adhesion, and actin networks[18-20]. It has been shown that SPDL1 binds to the cell cortex and microtubule tips and co-localizes with dynamin/dynamic actin at the front of migrating U2OS human chondrosarcoma cells and primary fibroblasts to participate in cell migration together. Interestingly, U2OS cells where SPDL1 was knocked down migrated slower than controls in two-dimensional stromal environments. Re-expression of SPDL1 rescued migration, suggesting that SPDL1 plays different roles in the migration of different tumour cells[21,22]. In our study, we found that the invasive and migratory abilities of CRC cells were enhanced after SPDL1 expression was reduced, demonstrating that low expression of SPDL1 may affect the malignant biological behaviour of CRC.

Tumour cells suffer from dysregulation in proliferation and cell differentiation, and are characterised by infiltration and metastasis. We found that the proliferative ability of CRC cells was enhanced with reduced expression of SPDL1, indicating that SPDL1 was involved in regulating the proliferation of CRC cells. Flow cytometry showed that S phase inhibition occurred after SPDL1 expression was reduced, while the number of cells in G2/M phase increased, suggesting that SPDL1 affects DNA synthesis. As downregulation of SPDL1 can cause a delay in pro-phase and the mid-phase of mitotic M phase, there was, as expected, a concomitant increase in the proportion of cells in G2/M phase cells. This is in line with previous studies. As for why there is an increase in proliferation, it has been shown that cells in which SPDL1 is knocked down can eventually overcome mid-mitotic arrest which instead promotes an increase in the mitotic index, with Rod and mitotic arrest deficient 2 remaining on mid-phase aligned chromosomes, explaining the high mitotic index and increase in the number of mid-phase divisions that occurs after SPDL1 depletion[5]. We analyzed the si-SPDL1 group vs the control group using RNA sequencing, followed by GO/KEGG enrichment analysis of the differential genes, and the results indicated that SPDL1 plays a role in mitotic spindle formation and chromosome segregation, which affects the progression of the cell cycle, and may be associated with the MAPK signaling pathway. MAPKs represent a group of evolutionarily conserved serine-threonine kinases, classified into four subfamilies: ERK, p38 MAPKs, c-Jun N-terminal kinases, and ERK5, which correspond to the four major MAPK pathways. The MAPK signaling pathway is recognized as a pivotal component of the eukaryotic cell signaling network, serving as a crucial signaling mechanism for various cellular processes under both physiological and pathological conditions, including proliferation, differentiation, apoptosis, and stress response[23,24]. Activation of the MAPK pathway has been implicated in a variety of human tumours, including lung cancer[25], ovarian cancer[26], stomach cancer[27], and breast cancer[28]. Mutations, upregulation, and hyperactivation of the MAPK/ERK signaling pathway are frequently observed in CRC[29-31]. The use of specific pharmacological inhibitors targeting the MAPK/ERK pathway has been shown to inhibit CRC development[32]. In line with this, our RNA sequencing results suggested that lower SPDL1 expression was associated with increased activation of the MAPK pathway. One of the major downstream effectors of EGFR is the MAPK pathway[33]. Paracrine or microenvironmental stimulation of EGFR may provide the necessary amplification of the oncogenic MAPK signaling pathway to promote tumour growth[34]. We found that inhibiting SPDL1 expression promoted the proliferation, invasion, and migration of HCT116 CRC cells, however, this effect could be blocked using the MAPK inhibitor, U0126. Inhibition of SPDL1 also increased EGFR expression and promoted ERK phosphorylation, and both effects could be inhibited by U0126. These suggest that interfering with SPDL1 expression can cause aberrant activation of the EGFR/ERK pathway which may promote proliferation, migration, and invasion of cancer cells.

Tumour metastasis is an invasive multistep cascade of cellular biological processes, where each step requires a combination of genetic and epigenetic alterations within the tumour cells as well as non-tumour stromal cells[35]. EMT is involved in a variety of biological behaviours in various cancers, including tumourigenesis, malignant progression, tumour stem cell differentiation, tumour cell migration, intravascular infiltration into the bloodstream, metastasis, and treatment resistance[36]. EMT typically presents with a loss of epithelial cell markers (such as cytokeratins and E-cadherin) and an enhanced expression of mesenchymal cell markers (such as N-cadherin, vimentin and fibronectin)[37,38]. EMT manifests progressively and is characterized by various cell states expressing differing levels of epithelial and mesenchymal markers, demonstrating intermediate morphological, transcriptional, and epigenetic features that lie between epithelial and mesenchymal cell types[39,40]. Some transcription factors like snail and twist inhibit E-cadherin and induce EMT[41], where snail1 expression results in a stem cell-like phenotype and spindle shape, often accompanied by loss of E-calmodulin[42]. In CRC, snail has been shown to promote EMT, and these transformed mesenchymal tumour cells secrete CXCL2 to promote macrophage infiltration and tumour cell migration[43]. Reorganization of the cytoskeleton is an important part of EMT, and reduced SPDL1 expression appears to alter the cytoskeleton. Our results showed that there was an increased expression of snail and other mesenchymal markers, along with a decreased expression of epithelial markers after SPDL1 knockdown, suggesting that SPDL1 may be associated with EMT. It has been demonstrated that when epithelial cells sense signals that form the stromal microenvironment, multiple signaling pathways are activated to induce EMT, the MAPK signaling pathway is one of these important pathways. Activation of MAPK signaling and its upstream kinases is often associated with the initiation of EMT[44]. Upon activation of ERK1 and ERK2, the MAPK pathway can enhance EMT by upregulating the expression of EMT transcription factors, alongside modulating cell motility and invasive capabilities[45]. Research has demonstrated that activation of the ERK/MAPK signaling pathway is influenced by growth factors and mutations in genes encoding RAS or RAF in CRC cells. These mutations play a significant role in promoting EMT associated with tumor progression[46]. Increased expression of the CRC-associated protein PLAC8 leading to EMT in CRC cells was shown to be dependent on ERK2 phosphorylation[47]. Similarly, our study showed that inhibition of SPDL1 expression increased snail and vimentin expression whereas E-cadherin expression decreased, this effect could be inhibited using U0126. Thus, we speculate that low SPDL1 expression increases EGFR expression, followed by further activation of the MAPK signaling cascade, which activates ERK1/2, induces snail expression, and promotes EMT, thus promoting the invasive and migratory ability of CRC cells.

CONCLUSION

In conclusion, our study found that SPDL1 is expressed at lower levels in patients with CRC, which correlates with increased lymph node metastasis, degree of differentiation, and poor prognoses. Lower expression levels of SPDL1 promote the proliferation, invasion, and migration of CRC, which may be due to the inhibitory effects of SPDL1 on the activation of EMT via the EGFR/ERK signaling pathway (Figure 7). However, this study has some limitations. For example, this study only considered data obtained from clinical samples and from cancer cell lines, no in vivo experiments were performed to further validate our findings. In the future, it will be necessary to increase the sample size to analyze the role and mechanism of SPDL1 in CRC and to further validate these findings through in vivo experiments in animals and in conjunction with clinical trials to obtain stronger evidence for its future application in the clinical treatment of patients with CRC.

Figure 7
Figure 7 Proposed pathway by which reduced SPDL1 expression leads to epithelial-mesenchymal transition and promotes cell migration and invasion in colorectal cancer. EGF: Epidermal growth factor; EGFR: Epidermal growth factor receptor; MEK: Mitogen-activated protein kinase; ERK: Extracellular signal-regulated kinase; EMT: Epithelial-mesenchymal transition.
References
1.  Dekker E, Tanis PJ, Vleugels JLA, Kasi PM, Wallace MB. Colorectal cancer. Lancet. 2019;394:1467-1480.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4063]  [Cited by in RCA: 3555]  [Article Influence: 507.9]  [Reference Citation Analysis (11)]
2.  Siegel RL, Miller KD, Goding Sauer A, Fedewa SA, Butterly LF, Anderson JC, Cercek A, Smith RA, Jemal A. Colorectal cancer statistics, 2020. CA Cancer J Clin. 2020;70:145-164.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3420]  [Cited by in RCA: 3360]  [Article Influence: 560.0]  [Reference Citation Analysis (5)]
3.  Brenner H, Kloor M, Pox CP. Colorectal cancer. Lancet. 2014;383:1490-1502.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2436]  [Cited by in RCA: 2344]  [Article Influence: 195.3]  [Reference Citation Analysis (8)]
4.  Andre N, Schmiegel W. Chemoradiotherapy for colorectal cancer. Gut. 2005;54:1194-1202.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 66]  [Cited by in RCA: 68]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
5.  Griffis ER, Stuurman N, Vale RD. Spindly, a novel protein essential for silencing the spindle assembly checkpoint, recruits dynein to the kinetochore. J Cell Biol. 2007;177:1005-1015.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 177]  [Cited by in RCA: 176]  [Article Influence: 9.3]  [Reference Citation Analysis (0)]
6.  Gassmann R, Holland AJ, Varma D, Wan X, Civril F, Cleveland DW, Oegema K, Salmon ED, Desai A. Removal of Spindly from microtubule-attached kinetochores controls spindle checkpoint silencing in human cells. Genes Dev. 2010;24:957-971.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 156]  [Cited by in RCA: 161]  [Article Influence: 10.1]  [Reference Citation Analysis (1)]
7.  El-Saghire H, Vandevoorde C, Ost P, Monsieurs P, Michaux A, De Meerleer G, Baatout S, Thierens H. Intensity modulated radiotherapy induces pro-inflammatory and pro-survival responses in prostate cancer patients. Int J Oncol. 2014;44:1073-1083.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 17]  [Cited by in RCA: 23]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
8.  Tian X, Wang N. Upregulation of ASPM, BUB1B and SPDL1 in tumor tissues predicts poor survival in patients with pancreatic ductal adenocarcinoma. Oncol Lett. 2020;19:3307-3315.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5]  [Cited by in RCA: 12]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
9.  Silva PMA, Delgado ML, Ribeiro N, Florindo C, Tavares ÁA, Ribeiro D, Lopes C, do Amaral B, Bousbaa H, Monteiro LS. Spindly and Bub3 expression in oral cancer: Prognostic and therapeutic implications. Oral Dis. 2019;25:1291-1301.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 23]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
10.  Yang XY, Zheng XX, Zhai XJ, Tang T, Yu SC. Spindle apparatus coiled-coil protein 1 (SPDL1) serves as a novel prognostic biomarker in triple-negative breast cancer. Proteomics Clin Appl. 2024;18:e202300002.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 6]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
11.  Kodama T, Marian TA, Lee H, Kodama M, Li J, Parmacek MS, Jenkins NA, Copeland NG, Wei Z. MRTFB suppresses colorectal cancer development through regulating SPDL1 and MCAM. Proc Natl Acad Sci U S A. 2019;116:23625-23635.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 28]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
12.  Klimaszewska-Wiśniewska A, Buchholz K, Durślewicz J, Villodre ES, Gagat M, Grzanka D. SPDL1 Is an Independent Predictor of Patient Outcome in Colorectal Cancer. Int J Mol Sci. 2022;23.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
13.  Feng Y, Tang D, Wang J. Emerging role and function of SPDL1 in human health and diseases. Open Med (Wars). 2024;19:20240922.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
14.  Sun J, Zhang JX, Li MS, Qin MB, Cheng RX, Wu QR, Chen QL, Yang D, Liao C, Liu SQ, Huang JA. Loss of monopolar spindle-binding protein 3B expression promotes colorectal cancer invasiveness by activation of target of rapamycin kinase/autophagy signaling. World J Gastroenterol. 2024;30:3229-3246.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Reference Citation Analysis (0)]
15.  Zhang JX, Qin MB, Ye Z, Peng P, Li SM, Song Q, Lin L, Liu SQ, Xie LH, Zhu Y, Huang JA. Association of tricellulin expression with poor colorectal cancer prognosis and metastasis. Oncol Rep. 2020;44:2174-2184.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
16.  Gama JB, Pereira C, Simões PA, Celestino R, Reis RM, Barbosa DJ, Pires HR, Carvalho C, Amorim J, Carvalho AX, Cheerambathur DK, Gassmann R. Molecular mechanism of dynein recruitment to kinetochores by the Rod-Zw10-Zwilch complex and Spindly. J Cell Biol. 2017;216:943-960.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 96]  [Cited by in RCA: 109]  [Article Influence: 12.1]  [Reference Citation Analysis (0)]
17.  Chaffer CL, Weinberg RA. A perspective on cancer cell metastasis. Science. 2011;331:1559-1564.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4042]  [Cited by in RCA: 3671]  [Article Influence: 244.7]  [Reference Citation Analysis (3)]
18.  Kaverina I, Straube A. Regulation of cell migration by dynamic microtubules. Semin Cell Dev Biol. 2011;22:968-974.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 188]  [Cited by in RCA: 200]  [Article Influence: 13.3]  [Reference Citation Analysis (0)]
19.  Stehbens S, Wittmann T. Targeting and transport: how microtubules control focal adhesion dynamics. J Cell Biol. 2012;198:481-489.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 180]  [Cited by in RCA: 179]  [Article Influence: 12.8]  [Reference Citation Analysis (0)]
20.  Akhshi TK, Wernike D, Piekny A. Microtubules and actin crosstalk in cell migration and division. Cytoskeleton (Hoboken). 2014;71:1-23.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 105]  [Cited by in RCA: 125]  [Article Influence: 9.6]  [Reference Citation Analysis (0)]
21.  Conte C, Baird MA, Davidson MW, Griffis ER. Spindly is required for rapid migration of human cells. Biol Open. 2018;7.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 13]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
22.  Conte C, Griffis ER, Hickson I, Perez-Oliva AB. USP45 and Spindly are part of the same complex implicated in cell migration. Sci Rep. 2018;8:14375.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5]  [Cited by in RCA: 15]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
23.  Arthur JS, Ley SC. Mitogen-activated protein kinases in innate immunity. Nat Rev Immunol. 2013;13:679-692.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1599]  [Cited by in RCA: 1458]  [Article Influence: 112.2]  [Reference Citation Analysis (3)]
24.  Kim EK, Choi EJ. Compromised MAPK signaling in human diseases: an update. Arch Toxicol. 2015;89:867-882.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 532]  [Cited by in RCA: 819]  [Article Influence: 74.5]  [Reference Citation Analysis (0)]
25.  Tang Q, Wu J, Zheng F, Hann SS, Chen Y. Emodin Increases Expression of Insulin-Like Growth Factor Binding Protein 1 through Activation of MEK/ERK/AMPKα and Interaction of PPARγ and Sp1 in Lung Cancer. Cell Physiol Biochem. 2017;41:339-357.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 28]  [Cited by in RCA: 49]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
26.  Bhartiya D, Singh J. FSH-FSHR3-stem cells in ovary surface epithelium: basis for adult ovarian biology, failure, aging, and cancer. Reproduction. 2015;149:R35-R48.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 59]  [Article Influence: 4.9]  [Reference Citation Analysis (0)]
27.  Choi NR, Choi WG, Zhu A, Park J, Kim YT, Hong J, Kim BJ. Exploring the Therapeutic Effects of Atractylodes macrocephala Koidz against Human Gastric Cancer. Nutrients. 2024;16.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 14]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
28.  Chen X, Zhu J, Li X, Chen J, Zhou Z, Fan X, Liang R, Liu H, Zhu D. ARHGAP6 Suppresses Breast Cancer Tumor Growth by Promoting Ferroptosis via RhoA-ROCK1-p38 MAPK Signaling. Front Biosci (Landmark Ed). 2024;29:6.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 10]  [Reference Citation Analysis (1)]
29.  Fang JY, Richardson BC. The MAPK signalling pathways and colorectal cancer. Lancet Oncol. 2005;6:322-327.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 999]  [Cited by in RCA: 915]  [Article Influence: 43.6]  [Reference Citation Analysis (3)]
30.  Wu Y, Fang Y, Li Y, Au R, Cheng C, Li W, Xu F, Cui Y, Zhu L, Shen H. A network pharmacology approach and experimental validation to investigate the anticancer mechanism of Qi-Qin-Hu-Chang formula against colitis-associated colorectal cancer through induction of apoptosis via JNK/p38 MAPK signaling pathway. J Ethnopharmacol. 2024;319:117323.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 36]  [Article Influence: 18.0]  [Reference Citation Analysis (0)]
31.  Chen Q, Li Y, Lu T, Luo J, Yang L, Zhou Z, Tian Z, Tan S, Liu Q. miR-373 promotes invasion and metastasis of colorectal cancer cells via activating ERK/MAPK pathway. Sci Rep. 2024;14:124.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 14]  [Reference Citation Analysis (0)]
32.  Pashirzad M, Khorasanian R, Fard MM, Arjmand MH, Langari H, Khazaei M, Soleimanpour S, Rezayi M, Ferns GA, Hassanian SM, Avan A. The Therapeutic Potential of MAPK/ERK Inhibitors in the Treatment of Colorectal Cancer. Curr Cancer Drug Targets. 2021;21:932-943.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 42]  [Article Influence: 8.4]  [Reference Citation Analysis (3)]
33.  Bertran-Alamillo J, Cattan V, Schoumacher M, Codony-Servat J, Giménez-Capitán A, Cantero F, Burbridge M, Rodríguez S, Teixidó C, Roman R, Castellví J, García-Román S, Codony-Servat C, Viteri S, Cardona AF, Karachaliou N, Rosell R, Molina-Vila MA. AURKB as a target in non-small cell lung cancer with acquired resistance to anti-EGFR therapy. Nat Commun. 2019;10:1812.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 56]  [Cited by in RCA: 99]  [Article Influence: 14.1]  [Reference Citation Analysis (0)]
34.  Ponsioen B, Post JB, Buissant des Amorie JR, Laskaris D, van Ineveld RL, Kersten S, Bertotti A, Sassi F, Sipieter F, Cappe B, Mertens S, Verlaan-Klink I, Boj SF, Vries RGJ, Rehmann H, Vandenabeele P, Riquet FB, Trusolino L, Bos JL, Snippert HJG. Quantifying single-cell ERK dynamics in colorectal cancer organoids reveals EGFR as an amplifier of oncogenic MAPK pathway signalling. Nat Cell Biol. 2021;23:377-390.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 35]  [Cited by in RCA: 113]  [Article Influence: 22.6]  [Reference Citation Analysis (1)]
35.  Valastyan S, Weinberg RA. Tumor metastasis: molecular insights and evolving paradigms. Cell. 2011;147:275-292.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3275]  [Cited by in RCA: 3053]  [Article Influence: 203.5]  [Reference Citation Analysis (5)]
36.  Lu J, Kornmann M, Traub B. Role of Epithelial to Mesenchymal Transition in Colorectal Cancer. Int J Mol Sci. 2023;24.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 114]  [Cited by in RCA: 100]  [Article Influence: 33.3]  [Reference Citation Analysis (0)]
37.  Fontana R, Mestre-Farrera A, Yang J. Update on Epithelial-Mesenchymal Plasticity in Cancer Progression. Annu Rev Pathol. 2024;19:133-156.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 155]  [Cited by in RCA: 134]  [Article Influence: 67.0]  [Reference Citation Analysis (0)]
38.  Xue W, Yang L, Chen C, Ashrafizadeh M, Tian Y, Sun R. Wnt/β-catenin-driven EMT regulation in human cancers. Cell Mol Life Sci. 2024;81:79.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 259]  [Cited by in RCA: 240]  [Article Influence: 120.0]  [Reference Citation Analysis (0)]
39.  Hong T, Watanabe K, Ta CH, Villarreal-Ponce A, Nie Q, Dai X. An Ovol2-Zeb1 Mutual Inhibitory Circuit Governs Bidirectional and Multi-step Transition between Epithelial and Mesenchymal States. PLoS Comput Biol. 2015;11:e1004569.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 203]  [Cited by in RCA: 211]  [Article Influence: 19.2]  [Reference Citation Analysis (0)]
40.  Jolly MK, Tripathi SC, Jia D, Mooney SM, Celiktas M, Hanash SM, Mani SA, Pienta KJ, Ben-Jacob E, Levine H. Stability of the hybrid epithelial/mesenchymal phenotype. Oncotarget. 2016;7:27067-27084.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 282]  [Cited by in RCA: 329]  [Article Influence: 36.6]  [Reference Citation Analysis (0)]
41.  Barrallo-Gimeno A, Nieto MA. The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development. 2005;132:3151-3161.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1000]  [Cited by in RCA: 1066]  [Article Influence: 50.8]  [Reference Citation Analysis (5)]
42.  Fan F, Samuel S, Evans KW, Lu J, Xia L, Zhou Y, Sceusi E, Tozzi F, Ye XC, Mani SA, Ellis LM. Overexpression of snail induces epithelial-mesenchymal transition and a cancer stem cell-like phenotype in human colorectal cancer cells. Cancer Med. 2012;1:5-16.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 160]  [Cited by in RCA: 191]  [Article Influence: 13.6]  [Reference Citation Analysis (0)]
43.  Bao Z, Zeng W, Zhang D, Wang L, Deng X, Lai J, Li J, Gong J, Xiang G. SNAIL Induces EMT and Lung Metastasis of Tumours Secreting CXCL2 to Promote the Invasion of M2-Type Immunosuppressed Macrophages in Colorectal Cancer. Int J Biol Sci. 2022;18:2867-2881.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 89]  [Cited by in RCA: 91]  [Article Influence: 22.8]  [Reference Citation Analysis (0)]
44.  Derynck R, Muthusamy BP, Saeteurn KY. Signaling pathway cooperation in TGF-β-induced epithelial-mesenchymal transition. Curr Opin Cell Biol. 2014;31:56-66.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 242]  [Cited by in RCA: 321]  [Article Influence: 26.8]  [Reference Citation Analysis (2)]
45.  Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 2014;15:178-196.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6736]  [Cited by in RCA: 6524]  [Article Influence: 543.7]  [Reference Citation Analysis (5)]
46.  Makrodouli E, Oikonomou E, Koc M, Andera L, Sasazuki T, Shirasawa S, Pintzas A. BRAF and RAS oncogenes regulate Rho GTPase pathways to mediate migration and invasion properties in human colon cancer cells: a comparative study. Mol Cancer. 2011;10:118.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 92]  [Cited by in RCA: 114]  [Article Influence: 7.6]  [Reference Citation Analysis (4)]
47.  Li C, Ma H, Wang Y, Cao Z, Graves-Deal R, Powell AE, Starchenko A, Ayers GD, Washington MK, Kamath V, Desai K, Gerdes MJ, Solnica-Krezel L, Coffey RJ. Excess PLAC8 promotes an unconventional ERK2-dependent EMT in colon cancer. J Clin Invest. 2014;124:2172-2187.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 86]  [Cited by in RCA: 104]  [Article Influence: 8.7]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade A, Grade B

Novelty: Grade A, Grade B

Creativity or Innovation: Grade A, Grade B

Scientific Significance: Grade A, Grade B

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Khazem FR; Liu DF S-Editor: Fan M L-Editor: A P-Editor: Zhao YQ

Write to the Help Desk