BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastrointest Oncol. Feb 15, 2025; 17(2): 96230
Published online Feb 15, 2025. doi: 10.4251/wjgo.v17.i2.96230
LncRNA PCAT6 promotes progression and metastasis of colonic neuroendocrine carcinoma via MAPK pathway
Fei Wang, Hai-Feng Mu, Chun Wang, Yue Tang, Jing Peng, Department of General Surgery, Nanjing Tongren Hospital, Nanjing 211100, Jiangsu Province, China
Ming-Yuan Si, Department of Pathology, Nanjing Tongren Hospital, Nanjing 211100, Jiangsu Province, China
ORCID number: Jing Peng (0000-0003-1583-5011).
Co-first authors: Fei Wang and Hai-Feng Mu.
Author contributions: Wang F and Mu HF conceived and designed the experiments; Wang F, Mu HF, Wang C, Tang Y, Si MY and Peng J carried out the experiments; Wang F, Mu HF and Peng J analyzed the data, drafted the manuscript. All authors agreed to be accountable for all aspects of the work. All authors have read and approved the final manuscript.
Institutional review board statement: Our study was approved by the Ethics Committee of Nanjing Tongren Hospital (2022-03-016). All patients had signed an informed consent before the study.
Institutional animal care and use committee statement: All animal experiments were reviewed and approved by the Ethics Review Committee of Southeast University (20210701004) and were performed in strict accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.
Conflict-of-interest statement: The authors declare that they have no competing interests.
Data sharing statement: The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Corresponding author: Jing Peng, MM, Department of General Surgery, Nanjing Tongren Hospital, No. 2007 Jiyin Avenue, Jiangning District, Nanjing 211100, Jiangsu Province, China. pengjingwxn@163.com
Received: April 30, 2024
Revised: September 18, 2024
Accepted: December 2, 2024
Published online: February 15, 2025
Processing time: 263 Days and 2 Hours

Abstract
BACKGROUND

Colonic neuroendocrine carcinomas (NECs) are highly malignant and invasive with poor prognosis. Long noncoding RNAs (LncRNAs) participate in the tumorigenesis and metastasis of multiple cancers

AIM

To detect the roles and mechanisms of lncRNA prostate cancer associated transcript 6 (PCAT6) in the progression of colonic NEC.

METHODS

Human NEC and adjacent normal samples were collected for immunohistochemistry staining of CgA and real-time quantitative polymerase chain reaction (RT-qPCR) of PCAT6 mRNA level. Subcutaneous xenograft tumor model and lung metastasis model were established in nude mice. The lung tissues were stained by hematoxylin and eosin to assess pulmonary metastasis. The expression of epithelial-mesenchymal transition (EMT)-related markers and pathway-related genes was measured by RT-qPCR and western blotting. CD56 expression was assessed by immunofluorescence staining. The biological functions of PCAT6 were examined by cell counting kit-8, colony formation assays, Transwell assays and wound healing assays. The interaction between PCAT6 and its potential downstream target was verified by luciferase reporter assays.

RESULTS

LncRNA PCAT6 was upregulated in human NEC samples and LCC-18 cells, and its high expression was positively correlated with poor prognosis in patients with colonic NEC. Additionally, the expression of PCAT6 was positively associated with the proliferation, migration, invasion, and EMT of LCC-18 cells. Moreover, PCAT6 facilitated tumor growth, lung metastasis and EMT in xenografts. Mechanistically, PCAT6 promoted the activation of MAPK to enhance the EMT in colonic NEC by targeting miR-326.

CONCLUSION

In conclusion, lncRNA PCAT6 accelerates the process of colonic NEC by activating ERK/p38 MAPK signaling through targeting miR-326. These results might provide useful information for exploring the potential therapeutic targets in colonic NEC.

Key Words: Colonic neuroendocrine carcinoma; lncRNA PCAT6; Metastasis; Epithelial-mesenchymal transition; MAPK; ceRNA

Core Tip: Prostate cancer associated transcript 6 (PCAT6) is highly expressed in neuroendocrine carcinomas (NECs) tissues and cells PCAT6 promotes the proliferation, migration and invasion of NEC cells PCAT6 facilitates tumor growth and lung metastasis in vivo PCAT6 enhances the epithelial-mesenchymal transition (EMT) in NECPCAT6 promotes the activation of MAPK to enhance the EMT in NEC.



INTRODUCTION

Colorectal cancer (CC) is the third most common cancer and the second leading cause of cancer-related deaths worldwide. In 2020, more than 1.9 million individuals were newly diagnosed with CC, and over 930000 CC-related deaths occurred. The global new CC cases and CC-related deaths are predicted to reach 3.2 million and 1.6 million, respectively[1]. Neuroendocrine neoplasms (NENs) are primary epithelial neoplasms showing morphologic and immunophenotypic signs of neuroendocrine differentiation, and distant metastasis is observed in more than 50% of patients when diagnosed with colorectal NENs[2]. According to 2019 World Health Organization classification, neuroendocrine tumors (NETs) and carcinomas (NECs) are two subtypes of NENs[3]. NEC, showing high proliferative and metastatic capacities, is the most aggressive type of malignancy among NENs[4]. The lack of typical symptoms and aggressive behavior are responsible for the poor prognosis in patients who are diagnosed at advanced stages of colonic NEC[5-7]. Surgery, chemotherapy, and radiation are widely accepted therapeutic strategies for colonic NEC[8]. Despite these advancements in colorectal NEC treatment, the 3-year overall survival is only 5% to 27%, and the median survival of patients with metastatic colorectal NEC is less than one year[6,9-11]. Thus, it is urgent to explore sensitive and distinctive biomarkers for early diagnosis of colonic NEC.

Long noncoding RNAs (lncRNAs), a class of noncoding transcripts with more than 200 nucleotides in length, serve as critical regulators of tumor initiation, progression and metastasis[12,13]. Previous studies have reported that dysregulated expression of lncRNAs is frequently relevant to tumorigenesis and metastasis in CC[14,15]. Additionally, dysregulation of lncRNAs has also been found to be associated with the development of NENs. For example, lncRNA HFF1A-AS1 can inhibit the tumorigenesis and metastasis of gastroenteropancreatic NEN[16]. Additionally, lncRNA TPT1-AS1 promotes the survival of neuroendocrine prostate cancer cells by facilitating autophagy[17]. Moreover, lncRNA MEG3 suppresses the growth and metastasis of human pancreatic NETs cells by downregulation of miR-183[18]. However, there is only one published report relating to lncRNA and colorectal NEC, which identified a tumor growth and metastasis enhancing modulator named lncRNA HOXBB-1:2[19]. Therefore, more potentially effective lncRNAs for early diagnosis of colonic NEC need to be explored. Prostate cancer associated transcript 6 (PCAT6) is a newly discovered carcinogenic lncRNA. It was first found to induce keratinocyte proliferation and colony formation of prostate tumor cells[20]. Since its identification, PCAT6 has been suggested to be oncogenic and promote tumor progression in various carcinomas, such as breast cancer[21], prostate cancer[22], and liver cancer[23]. Additionally, PCAT6 can enhance the resistance of CC cells to drug therapy and inhibit colon cancer cell apoptosis[24,25], and its high expression predicts poor clinical outcomes in CC[26]. Moreover, upregulation of lncRNA PCAT6 can promote prostate cancer neuroendocrine differentiation[27]. However, the roles of PCAT6 in the progression of colonic NEC have not been reported.

MicroRNAs (miRNAs) are small and single strand RNAs consisting of 22 nucleotides and have been found to play important roles in cell survival, development, and apoptosis[28]. Accumulating evidence has indicated that abnormally expressed miRNAs are involved in the regulation of tumorigenesis[29,30]. Some miRNAs are involved in the neuroendocrine differentiation of cancers, such as miR-17[31], miR-194[32], and miR-421[33]. LncRNAs have been found to interact with miRNAs and hinder miRNA functions in tumors as competing endogenous RNAs (ceRNAs) in CC development[34,35]. Thus, we hypothesized that PCAT6 might function as a ceRNA competitively binding to miRNAs in the development of colonic NEC.

In this study, we aimed to identify the expression of PCAT6 in colonic NEC using the clinical samples and also detect the roles and the underlying mechanisms of PCAT6 in the progression of colonic NEC. By studying the roles and mechanisms of PCAT6, we hope to determine whether PCAT6 can serve as a potential therapeutic target for colonic NEC.

MATERIALS AND METHODS
Patient samples

NEC samples and adjacent normal tissues were collected from 30 patients with colonic NEC who underwent radical operation from November 2015 to November 2022 in Nanjing Tongren Hospital. Colonic NEC was detected by colonoscopy, abdominal and pelvic enhanced computed tomography scans, tissue biopsy, pathological examination, and immunohistochemistry evaluation. Patients who had low-grade tumors (well or moderately differentiated) or had missing follow-up data were excluded from this study. Our study was approved by the Ethics Committee of Nanjing Tongren Hospital (2022-03-016). All patients had signed an informed consent before the study. Data obtained from reviewing the electronic medical records of these cases included age, gender, clinical procedure, and survival outcomes. The relationship between PCAT6 expression and clinicopathologic variables of colonic NEC was analyzed and shown in Table 1.

Table 1 Relationship between prostate cancer associated transcript 6 expression and clinicopathologic variables of colonic neuroendocrine carcinomas.
Clinical features
n
PCAT6 expression
P value
High (16)
Low (14)
Age0.4642
≤ 651578
> 651596
Gender0.7321
Male1697
Female1477
Grade0.5257
I-II231310
III734
TNM
I-II1349*0.0303
III-IV17125
Invasion depth0.8808
T1+T2321
T319109
T4844
Lymphatic metastasis0.0281
Absent15510
Present15114
Distant metastasis
Absent176110.0235
Present13103
Death
Absent144100.0110
Present16124
Immunohistochemical staining

The human specimens were fixed in 10% formaldehyde, embedded in paraffin, and cut into 4-μm sections. After deparaffinization and rehydration, the sections underwent epitope retrieval at 120 °C for 4 minutes in citrate buffer using pressure cooker. After being washed with water, the endogenous peroxidase activity of sections was blocked using 3% hydrogen peroxide. Then, goat serum was used to block nonspecific binding sites. Thereafter, the sections were incubated with an anti-CgA primary antibody (ab283265, 1:5000; Abcam, Shanghai, China) at 4 °C overnight. After washing, the sections were incubated with a secondary goat anti-rabbit IgG antibody (ab150077, 1:2500; Abcam) at 37 °C for 30 minutes. To visualize the antibody reaction, the slides were developed with diaminobenzidine (Yeasen, Shanghai, China). Finally, the sections were observed using a microscope (Olympus, Tokyo, Japan). Immunohistochemical results were evaluated using the immunohistochemistry scoring system as previously described[36]. The immunohistochemical score was calculated by the staining intensity and the percentage of stained cells. The staining intensity was graded as strong (3 points), moderate (2 points), weak (1 point), and negative (0 point). The percentage of positive cells was scored as 4 points (more than 75%), 3 points (50%-75%), 2 points (26%-50%), 1 point (1%-25%), and 0 point (negative). The total score of up to 3 points was considered positive.

Real-time quantitative polymerase chain reaction

Total RNA was isolated from cultured cells or tissues using TRIzol reagent (Sigma-Aldrich, Shanghai, China), and cDNA was synthesized through reverse transcription of 1 μg protein using a PrimeScript RT reagent kit (Takara, Beijing, China). Subsequently, real-time quantitative polymerase chain reaction (RT-qPCR) was conducted following the TaqMan Gene Expression Assays Protocol (Thermo Fisher Scientific). The thermocycling conditions were as follows: Initial denaturation at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and 60 °C for 35 s. Relative mRNA and miRNA levels were quantified using the 2-CT method and normalized to U6 or GAPDH[37]. The primer sequences were listed in Table 2.

Table 2 Sequences of primers used for reverse transcription-quantitative polymerase chain reaction.
Gene (human)
Sequence (5’-3’)
PCAT6 forwardTCCTCATTCGGTCCATCCAACTCC
PCAT6 reverseGAAGCACGAGCAAGGCAGAGAC
CgA forwardCTCCAGGTCCGAGGCTAC
CgA reverseGACAGGCTCTCCAGCTCC
E-cadherin forwardGGAACTATGAAAAGTGGGCTTG
E-cadherin reverseAAATTGCCAGGCTCAATGAC
N-cadherin forwardGGTGGAGGAGAAGAAGACCAG
N-cadherin reverseGGCATCAGGCTCCACAGT
Snail forwardCTTCCAGCAGCCCTACGAC
Snail reverseCGGTGGGGTTGAGGATCT
Vimentin forwardGACGCCATCAACACCGAGTT
Vimentin reverseCTTTGTCGTTGGTTAGCTGGT
miR-4731-5p forwardTGCTGGGGGCCACAT
miR-4731-5p reverseCTCTACAGCTATATTGCCAGCCAC
miR-1306-5p forwardCCACCTCCCCTGCAAA
miR-1306-5p reverseTCCTCCTCTCCTTCCTTCTC
miR-330-5p forwardTCTCTGGGCCTGTGTCTTAG
miR-330-5p reverseCAGTGCGTGTCGTGGAGT
miR-326 forwardACTGTCCTTCCCTCTGGGC
miR-326 reverseAATGGTTGTTCTCCACTCTCTCTC
U6 forwardCTCGCTTCGGCAGCACA
U6 reverseAACGCTTCACGAATTTGCGT
GAPDH forwardCATGAGAAGTATGACAACAGCCT
GAPDH reverseAGTCCTTCCACGATACCAAAGT
Cell culture

The human colonic NEC cell line (LCC-18) and human colonic carcinoma cell lines (LoVo and SW480) were obtained from Enzyme-linked Biotechnology (Shanghai, China). The LCC-18 cells were incubated in RPMI 1640 medium (Sigma-Aldrich) containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin in an incubator with 5% CO2 at 37 °C. The SW480 and LoVo cells were cultured in DMEM medium (Procell, Wuhan, China) supplemented with 10% FBS and 1% penicillin/streptomycin at 37 °C with 5% CO2.

Cell transfection

The PCAT6 overexpression vector (pcDNA3.1-PCAT6) and PCAT6 specific shRNA (sh-PCAT6) and their negative controls were synthesized by Ribobio (Guangzhou, China). MiR-326 mimics and miR-326 inhibitors with their negative controls (NC mimics and NC inhibitors) were obtained from GenePharma (Shanghai, China). The LCC-18 cells were seeded onto 6-well plates (1 × 106 cells/well) overnight. Then, the cells were transfected with pcDNA3.1-PCAT6, sh-PCAT6, miR-326 mimics, or miR-326 inhibitors using Lipofectamine 2000 (Yeasen). Cells transfected with pcDNA3.1 empty vector, sh-NC, NC mimics, and NC inhibitors were used as negative controls. After 6 hours of transfection, the cells were cultured in normal culture medium. Analyses were performed 48 hours later.

Cell counting kit-8 assays

The LCC-18 cells were seeded onto 96-well plates (2 × 104 cells/well) 48 hours after indicated transfections and incubated for 24 hours, 48 hours, 72 hours and 96 hours prior to addition of serum-free DMEM (100 μL) containing 10 μL cell counting kit-8 (CCK-8) solution (Yeasen) to each well. After 2 hours of incubation at 37 °C, the absorbance at 450 nm was read via a spectrophotometer (Molecular Devices, Shanghai, China), and the cell viability curves were plotted according to the results above.

Colony formation assays

The cells (2 × 103) mixed with RPMI-1640 medium containing 0.35% low-melting agarose and 20% FBS were layered on top of the base layer of 0.7% low-melting agarose. These cells were then seeded into 12-well plates, and after 3 weeks of incubation, colonies were visualized by 0.4% crystal violet and imaged using a digital camera (Nikon, Tokyo, Japan). The number of colonies (comprising over 50 cells) was scanned and counted using ImageJ software.

Transwell assays

The LCC-18 cells (1× 105 cells/well) were incubated in 24-well transwell chambers containing an 8 μm size porous membrane (Corning Incorporated, Corning, NY, United States). The upper chambers were coated with Matrigel (Corning Incorporated), and the lower chambers were filled with culture medium containing 10% FBS. After 24 hours of incubation, the non-invading cells were carefully wiped using a cotton swab, and the invaded cells into the lower surface were fixed with paraformaldehyde and stained with crystal violet. The invaded cells were imaged and counted via an inverted microscope (Olympus).

Wound healing assays

The LCC-18 cells were incubated in 6-well plates (2 × 105 cells/well) for 12 hours. When cells grew to 100% confluence, a 10 μL pipette tip was used to scrape cell monolayers. Then, the cells were washed twice using phosphate buffered saline (PBS; Solarbio, Beijing, China) to remove floating cells and cultured in serum-free medium at 37 °C. The images of cells were taken at 0 hours and 24 hours using an inverted microscope (Olympus).

Xenograft model

All animal experiments were reviewed and approved by the Ethics Review Committee of Southeast University (No. 20210701004) and were performed in strict accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

BALB/c nude mice (male, 4 weeks of age; Cyagen (Suzhou, China) were raised under pathogen-free conditions. LCC-18 cells stably expressing sh-PCAT6 and sh-NC (5 × 106 cells in 0.1 mL PBS) were subcutaneously injected into the right dorsal flanks of nude mouse, respectively. Tumor volume was measured weekly for 4 weeks. On day 28 post-operation, mice were sacrificed, and tumor tissues were harvested and weighed followed by further analyses via western blotting and immunofluorescence.

To establish a lung metastasis model, transfected LCC-18 cells were injected into the tail vein of each mouse. After 60 days of tumor development, the lung tissues were collected and stained with hematoxylin and eosin (Sigma-Aldrich). Pulmonary metastases were counted.

Immunofluorescence staining

The tumor tissues were fixed overnight with 4% paraformaldehyde, embedded in paraffin, and cut into 5-μm sections. The sections were then serially deparaffinized, rehydrated, and subjected to high-pressure antigen retrieval processes. After washing and blocking, the sections were incubated with an anti-CD56 primary antibody (SAB5700847, 1:150; Sigma-Aldrich) at 4 °C overnight, followed by incubation with the secondary antibody for 1 hour at 37 °C. Nuclei were stained with DAPI (Sigma-Aldrich). Images were captured using a fluorescence microscope (Olympus). The fluorescence intensity was calculated using the Image Pro Plus software.

Subcellular fractionation

Nuclear and cytoplasmic RNA fractionations were performed using the PARIS kit (Thermo Fisher Scientific) following the manufacturer’s instructions. Then, RNA samples were extracted and quantified by RT-qPCR analysis. U6 was applied as a nuclear control, and GAPDH was applied as a cytoplasmic control.

Luciferase reporter assays

The wild type (WT) sequences of PCAT6 3’ untranslated region (UTR) containing binding sites of miR-326 were cloned into the pmirGLO vector (YouBio, Hunan, China) to form the luciferase reporter vector (PCAT6-WT). The mutant (MUT)-PCAT6 3’UTR was obtained by mutating the seed sites. LCC-18 cells were seeded into 24-well plates (1× 104 cells/well). When the cell density reached 80%, miR-326 mimics or NC mimics as well as reporter gene plasmids were co-transfected into LCC-18 cells using Lipofectamine 2000 at 37 °C for 48 hours. The relative luciferase activities were detected using the Dual-Luciferase Reporter assay kit (Beyotime) according to the manufacturer’s instructions. Luciferase activity was measured and normalized to Renilla luciferase activity.

Western blotting

Total protein was isolated from cultured cells or tumor tissues using RIPA buffer (Sigma-Aldrich), and the BCA Protein Assay Kit (Innochem, Beijing, China) was utilized to measure protein concentration. Thereafter, proteins (40 μg) were separated by SDS-PAGE and blotted on a PVDF membrane. After blocking with 5% skimmed milk for 2 h, the membrane was incubated overnight with primary antibodies against E-cadherin (ab212059, 1:1000; Abcam), N-cadherin (ab76011, 1:5000; Abcam), Snail (#3879, 1:1000; Cell Signaling Technology), vimentin (ab92547, 1:2500; Abcam), GAPDH (ab8245, 1:5000; Abcam), p38 (ab182453, 1:1000; Abcam), p-p38 (ab195049, 1:1000; Abcam), ERK (ab184699, 1:10000; Abcam) and p-ERK (ab201015, 1:1000; Abcam) at 4 °C, and incubated with secondary antibodies for 2 hours at room temperature. After washing, the bands were visualized by enhanced chemiluminescence reagent (Beyotime, Shanghai, China), and the intensity of blot was quantified by Image Lab 3.0 software (Bio-Rad, Hercules, CA, United States).

Statistical analysis

Statistical analysis was analyzed using GraphPad Prism 8 (GraphPad Software, San Diego, CA, United States). Data were described as the mean ± SD. One-way analysis of variance followed by Tukey’s post hoc analysis and Student’s t test were used for comparison analyses. P < 0.05 was considered statistically significant.

RESULTS
Upregulation of PCAT6 in NEC

The CgA expression in 30 clinical NEC samples was examined by immunohistochemistry, and we found that 18 cases (60%) were positive for CgA staining, whereas only 7 cases (23.3%) in the adjacent normal tissues were positive for CgA staining, indicating the upregulation of CgA in NEC samples (Figure 1A). Then, RT-qPCR analyses revealed a higher PCAT6 mRNA level in NEC samples than in adjacent normal samples (Figure 1B). The relationship between PCAT6 expression and clinicopathologic characteristics of colonic NEC was analyzed and shown in Table 1. It was discovered that high expression of PCAT6 was positively related to advanced TNM stage, increased lymphatic metastasis and distant metastasis, and more death, whereas there was no significant difference in age, gender, and pathological grade between high and low PCAT6 expression groups. Moreover, Pearson’s analysis revealed a positive relation between CgA and PCAT6 expression (Figure 1C). Finally, the level of lncRNA PCAT6 was evaluated in colonic NEC cells (LCC18) and colonic carcinoma cells (SW480 and LoVo). The PCAT6 Level was significantly upregulated in LCC-18 cells compared with that in SW480 and LoVo cells (Figure 1D). Collectively, these results suggest that lncRNA PCAT6 is upregulated in colonic NEC tissues and cell lines and correlated with poor prognosis in patients with colonic NEC.

Figure 1
Figure 1 Prostate cancer associated transcript 6 is highly expressed in neuroendocrine carcinomas tissues and cells. A: Immunohistochemistry staining results of CgA in tumor and adjacent nontumor samples collected from patients with neuroendocrine carcinomas (NEC); B: The prostate cancer associated transcript 6 (PCAT6) level in NEC tumor and adjacent nontumor samples was measured by real-time quantitative polymerase chain reaction (RT-qPCR); C: The correlation between CgA and PCAT6 levels in NEC tumor samples was determined via Pearson analysis; D: The PCAT6 level in SW480, LoVo and LCC-18 cells was assessed by RT-qPCR. aP < 0.001. NEC: Neuroendocrine carcinomas; PCAT6: Prostate cancer associated transcript 6.
PCAT6 promotes the proliferation, migration, and invasion of colonic NEC cells

To detect the biological roles of lncRNA PCAT6 in colonic NEC cells which had high PCAT6 expression, we effectively transfected pcDNA3.1-PCAT6 and sh-PCAT6 into LCC-18 cells. The overexpression and knockdown efficiencies were determined by RT-qPCR (Figure 2A). Then, the results of CCK-8 assays, colony formation assays, Transwell assays and wound healing assays demonstrated that upregulation of lncRNA PCAT6 amplified the proliferative, migrative and invasive capabilities of LCC-18 cells, while PCAT6 downregulation restrained LCC-18 cell proliferation, migration, and invasion (Figure 2B-E). Taken together, these results show that lncRNA PCAT6 strengthens the proliferative, invasive and migrative capabilities of colonic NEC cells.

Figure 2
Figure 2 Prostate cancer associated transcript 6 promotes the proliferation, migration, and invasion of neuroendocrine carcinomas cells. A: The transfection efficiency was verified by real-time quantitative polymerase chain reaction; B: CCK-8 assays of cell viability; C: Colony formation ability of LCC-18 cells transfected with prostate cancer associated transcript 6 (PCAT6) overexpression vector or PCAT6 shRNA; D: Transwell assays of cell invasion; E: Wound healing assays of cell migration. aP < 0.01, bP < 0.001 vs vector group; cP < 0.01, dP < 0.001 vs sh-NC group. PCAT6: Prostate cancer associated transcript 6.
PCAT6 facilitates tumor growth and lung metastasis

In vivo, PCAT6 overexpression facilitated tumor growth, which was limited by PCAT6 knockdown (Figure 3A-C). CD56 serves as a neuroendocrine marker[38]. Immunofluorescence staining of CD56 revealed that PCAT6 knockdown remarkably downregulated CD56 expression in NEC tumor samples (Figure 3D and E). Hematoxylin and eosin staining showed that PCAT6 downregulation reduced metastatic lesions and pulmonary metastatic nodules in lung tissues (Figure 3F and G). Taken together, lncRNA PCAT6 promotes tumor growth and lung metastasis.

Figure 3
Figure 3 Prostate cancer associated transcript 6 facilitates tumor growth and metastasis in vivo. A: Photographs of the excised tumors after 28 days of treatment; B: Tumor volume; C: Tumor weight; D and E: Immunofluorescence staining of CD56; F and G: Hematoxylin-eosin staining of lung metastasis. aP < 0.05, bP < 0.01, cP < 0.001. PCAT6: Prostate cancer associated transcript 6.
PCAT6 enhances epithelial-mesenchymal transition in colonic NEC cells and xenografts

Epithelial-mesenchymal transition (EMT) is associated with an invasive or metastatic phenotype of CC[39,40]. We investigated whether PCAT6 was involved in EMT. As shown by western blotting and RT-qPCR, LCC-18 cells overexpressing PCAT6 exhibited markedly lower E-cadherin expression and higher N-cadherin, Snail and vimentin expression than those transfected with empty vector, while PCAT6 downregulation led to a significantly increased E-cadherin expression and decreased N-cadherin, Snail, and vimentin expression (Figure 4A and B). Concomitantly, PCAT6 knockdown also increased E-cadherin expression while decreasing vimentin and Snail expression in xenografts (Figure 4C). To analyze the potential mechanism underlying the effect of PCAT6 on colonic NEC cells, the expression of MAPK pathway-related proteins was detected using western blotting. The results showed that overexpression of PCAT6 remarkably increased the ratios of p-p38/p38 and p-ERK/ERK in LCC-18 cells, while PCAT6 knockdown had the opposite effect (Figure 4D). Then, we found that both U0126 (an ERK inhibitor) and SB202190 (a p38 inhibitor) reversed the enhancing effect of PCAT6 upregulation on EMT (Figure 4E and F). These results suggest that lncRNA PCAT6 promotes EMT in colonic NEC by activating the ERK/p38 MAPK pathway.

Figure 4
Figure 4 Prostate cancer associated transcript 6 enhances the epithelial-mesenchymal transition in neuroendocrine carcinomas. A and B: The protein and mRNA levels of E-cadherin, N-cadherin, Snail and GAPDH in LCC-18 cells were measured by western blotting and real-time quantitative polymerase chain reaction; C: The protein levels of vimentin, Snail and E-cadherin in neuroendocrine carcinomas tumor samples; D: The protein levels of p38, p-p38, ERK, and p-ERK in LCC-18 cells were evaluated by western blotting; E: The protein levels of p-ERK, E-cadherin, and vimentin in LCC-18 cells treated with or without U0126 (an ERK inhibitor) were measured by western blotting; F: The protein levels of p-p38, E-cadherin, and vimentin in LCC-18 cells treated with or without SB202190 (a p38 inhibitor) were detected by western blotting. aP < 0.001 vs vector group or PCAT6 group; bP < 0.001 vs sh-NC group. PCAT6: Prostate cancer associated transcript 6.
PCAT6 directly binds to miR-326

To study the mechanism of PCAT6 in colonic NEC cells, we first examined the subcellular distribution of PCAT6 in LCC-18 cells. The results showed that PCAT6 was mainly located in the cytoplasm of LCC-18 cells, which implied that PCAT6 might serve as a miRNA sponge (Figure 5A). Through using the StarBase database (http://starbase.sysu.edu.cn/), we found that a total of 4 miRNAs were predicted to be the downstream miRNA targets of lncRNA PCAT6. RT-qPCR results demonstrated that expression of miR-326 was significantly upregulated in LCC-18 cells transfected with sh-PCAT6 (Figure 5B and C). Then, LCC-18 cells were co-transfected with miR-326 mimics or NC mimics and luciferase reporter plasmids and then subjected to luciferase reporter assays. The results revealed that the luciferase activity of PCAT6-WT was markedly suppressed by miR-326 overexpression. However, no change was observed in PCAT6-MUT group (Figure 5D and E). Moreover, RT-qPCR results demonstrated that miR-326 expression was significantly downregulated in colonic NEC tissues compared to normal tissues, and its expression was negatively correlated with PCAT6 expression (Figure 5F and G). These results indicate that PCAT6 could suppress miR-326 expression by direct interaction.

Figure 5
Figure 5 MiR-326 is a target of prostate cancer associated transcript 6. A: Subcellular distribution of prostate cancer associated transcript 6 (PCAT6) in LCC-18 cells; B: The candidate downstream miRNAs of PCAT6 were predicted by the TargetScan database; C: The miRNA levels of these candidate miRNAs in LCC-18 cells transfected with sh-NC or sh-PCAT6 were measured by real-time quantitative polymerase chain reaction (RT-qPCR); D: The overexpression efficiency of miR-326 mimics in LCC-18 cells was detected by RT-qPCR; E: The interaction between miR-326 and PCAT6 was determined by luciferase reporter assays; F: The level of miR-326 in tumor and adjacent nontumor samples collected from patients with NEC was assessed by RT-qPCR; G: The correlation between PCAT6 expression and miR-326 expression was determined by Pearson’s analysis. aP < 0.001. PCAT6: Prostate cancer associated transcript 6.
PCAT6 promotes the proliferation, migration, invasion, and EMT of colonic NEC cells by targeting miR-326

After confirming that miR-326 was a direct target of PCAT6, we further investigated the functions and mechanisms of PCAT6/miR-326 interaction in colonic NEC cell malignancies. We first verified the knockdown efficiency of miR-326 inhibitor on miR-326 expression in LCC-18 cells using RT-qPCR (Figure 6A). Then, the results of functional assays revealed that the effects of PCAT6 knockdown on increasing the viability, colony formation ability, invasion, and migration of LCC-18 cells were greatly abolished by miR-326 knockdown (Figure 6B-E). Besides, western blotting and RT-qPCR results demonstrated that miR-326 downregulation reversed the effect of PCAT6 knockdown on increasing E-cadherin expression and decreasing N-cadherin, Snail, and vimentin expression (Figure 6F and G). Moreover, it was found that PCAT6 knockdown significantly increased the ratios of p-p38/p38 and p-ERK/ERK in LCC-18 cells, whereas transfection with the miR-326 inhibitor reversed these trends (Figure 6H). These results show that PCAT6 enhances the proliferation, migration, invasion, and EMT of colonic NEC cells and activates the ERK/p38 MAPK pathway by targeting miR-326.

Figure 6
Figure 6 Prostate cancer associated transcript 6 promotes the proliferation, migration, invasion, and epithelial-mesenchymal transition of colonic neuroendocrine carcinomas cells by targeting miR-326. A: The knockdown efficiency of miR-326 inhibitor in LCC-18 cells was confirmed by RT-qPCR; B: CCK-8 assays of cell viability; C: Colony formation assays of cell proliferation; C: Transwell assays of cell invasion; E: Wound healing assays of cell migration; F: The protein levels of E-cadherin, N-cadherin, Snail, and vimentin were measured by western blotting; G: The mRNA levels of E-cadherin, N-cadherin, Snail, and vimentin were assessed by RT-qPCR; H: The protein levels of p38, p-p38, ERK, and p-ERK were measured by western blotting. aP < 0.05, bP < 0.01, cP < 0.001 vs NC inhibitor, sh-NC, or vector group; dP < 0.01, eP < 0.001 vs sh-PCAT6 group. PCAT6: Prostate cancer associated transcript 6.
DISCUSSION

Colorectal NECs are highly malignant with high liver metastasis and poor prognosis[41,42]. It is urgent to explore potential diagnostic and prognostic targets of NECs. LncRNAs might play critical roles to regulate cancer neuroendocrine differentiation[43,44]. The oncogenic effect of lncRNA PCAT6 has been revealed in diverse cancers[23,45,46]. LncRNA PCAT6 can also inhibit colon cancer cell apoptosis and enhance CC cell chemoresistance[24,25] and promote prostate cancer neuroendocrine differentiation[27]. In this study, we investigated the roles and mechanisms of lncRNA PCAT6 in colonic NEC. Our findings revealed that lncRNA PCAT6 was upregulated in colonic NEC tissues and cells, and its expression was positively associated with poor prognosis in patients with colonic NEC and the proliferation, migration, invasion, and EMT of colonic NEC cells. Additionally, PCAT6 was found to exert oncogenic functions in colonic NEC through activating the ERK/p38 MAPK pathway by targeting miR-326.

It has been reported that PCAT6 is a prognostic biomarker in various cancers, and its upregulation is significantly associated with poor prognosis in patients with CC[47], prostate cancer[22], and bladder cancer[46]. Additionally, PCAT6 is found to be upregulated in neuroendocrine prostate cancer tissues and neuroendocrine-like cells[27]. CgA, the main component of secretory granules of neuroendocrine cells, is found to be an independent risk factor that affects metastasis and prognosis of colorectal NENs[48,49]. In this study, we collected NEC and normal adjacent samples from patients diagnosed with colonic NEC and found that colonic NEC samples exhibited upregulated CgA and PCAT6 expression compared with normal tissues and there was a positive correlation between CgA expression and PCAT6 expression in colonic NEC tissues. We also found that high PCAT6 expression predicted poor prognosis in patients with colonic NEC, which suggests that PCAT6 might be a potential therapeutic target for colonic NEC.

EMT is a cellular process during which epithelial cells acquire mesenchymal phenotypes and behaviors following the downregulation of epithelial features. Tumor cells undergoing EMT acquire migrative and invasive capabilities to other organs, which is a critical step of metastasis[50]. EMT is associated with an invasive or metastatic phenotype of several tumors, including CC[39,40]. Recent studies have suggested that EMT genes can induce neuroendocrine trans-differentiation and subsequently tumor progression[51-53]. Snail is known as a master transcription factor that regulates EMT by downregulating E-cadherin. EMT is also associated with acquisition of mesenchymal markers such as vimentin and N-cadherin[54]. LncRNA PCAT6 has been found to promote EMT of CC cells[55], lung adenocarcinoma cells[56], non-small cell lung cancer cells[57], and gastric cancer cells[56]. Besides, PCAT6 can promote the proliferation, migration, and invasion of laryngeal squamous cell carcinoma cells[58], lung adenocarcinoma cells[56], and bladder cancer cells[59]. In the current study, we found that PCAT6 upregulation markedly decreased E-cadherin while increasing N-cadherin, Snail, and vimentin expression levels in LCC-18 cells, while PCAT6 knockdown had the opposite effect, indicating that PCAT6 promoted EMT in colonic NEC cells. Additionally, PCAT6 knockdown suppressed the proliferation, migration, and invasion of colonic NEC cells. Moreover, in vivo analysis revealed that PCAT6 knockdown prevented tumor growth, lung metastasis and EMT and downregulated CD56 expression. Collectively, this study reveals that PCAT6 can promote progression and metastasis of colonic NEC by enhancing EMT. Accumulating evidence has revealed that MAPK activation can facilitate the metastasis of colorectal NENs[60,61]. Inhibition of MAPK pathway restrains the progression of EMT in CCs[62,63]. This study revealed that lncRNA PCAT6 inhibited p38 and ERK phosphorylation in LCC-18 cells, and inhibitors of p38 and MAPK reversed the enhancing effect of PCAT6 overexpression on EMT event.

Accumulating evidence has shown that lncRNAs can function as ceRNAs for specific miRNAs and eliminate their effects in many cancers[64]. In this study, we found that lncRNA PCAT6 directly bound to miR-326 and negatively regulated its expression. MiR-326 is found lowly expressed in CC tumor tissues, and its upregulation can significantly inhibit the viability, invasion, and migration and promote the apoptosis of CC cells[65]. MiR-326 is also found to act as a cancer suppressor in endometrial cancer[66], breast cancer[67], and ovarian cancer[68]. In the current study, we found that miR-326 was significantly downregulated in human colonic NEC tissues, and its knockdown reversed the effect of PCAT6 knockdown on suppressing cell proliferation, migration, invasion, EMT, and ERK/p38 MAPK signaling.

This research is subject to several limitations. First, the retrospective analysis in this study was performed on small sample size, and more samples are required to validate our findings. Second, this study focused on the mechanisms of the lncRNA functioning as a sponge for miRNA, but whether PCAT6 is associated with a protein coding gene has not been investigated. These limitations are required to be addressed in the future.

CONCLUSION

In conclusion, this study demonstrates that lncRNA PCAT6 promotes colonic NEC progression and metastasis by promoting NEC cell malignancies and EMT through activating p38 and ERK MAPK pathways and targeting miR-326. This study might add evidence to lncRNA PCAT6 as a novel biomarker in the management of colonic NEC.

ACKNOWLEDGEMENTS

The authors appreciate the help of Nanjing Tongren Hospital.

References
1.  World Health Organization  Colorectal cancer. World Health Organization, 2023. Available from: https://www.who.int/news-room/fact-sheets/detail/colorectal-cancer#:~:text=Key%20facts%201%20Colorectal%20cancer%20is%20the%20third,occurring%20in%20people%20aged%2050%20and%20above.%20%E6%9B%B4%E5%A4%9A%E9%A1%B9%E7%9B%AE.  [PubMed]  [DOI]
2.  Koenig A, Krug S, Mueller D, Barth PJ, Koenig U, Scharf M, Ellenrieder V, Michl P, Moll R, Homayunfar K, Kann PH, Stroebel P, Gress TM, Rinke A. Clinicopathological hallmarks and biomarkers of colorectal neuroendocrine neoplasms. PLoS One. 2017;12:e0188876.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 27]  [Cited by in RCA: 23]  [Article Influence: 2.6]  [Reference Citation Analysis (3)]
3.  Nagtegaal ID, Odze RD, Klimstra D, Paradis V, Rugge M, Schirmacher P, Washington KM, Carneiro F, Cree IA; WHO Classification of Tumours Editorial Board. The 2019 WHO classification of tumours of the digestive system. Histopathology. 2020;76:182-188.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3203]  [Cited by in RCA: 2929]  [Article Influence: 488.2]  [Reference Citation Analysis (9)]
4.  Wang Z, Shi S, Ren H, Liu Q. Tumor Differentiation is the Dominant Prognostic Factor for Patients with Colorectal Neuroendocrine Neoplasms with Distant Metastasis. Int J Endocrinol. 2022;2022:1720624.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 3]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
5.  Aytac E, Ozdemir Y, Ozuner G. Long term outcomes of neuroendocrine carcinomas (high-grade neuroendocrine tumors) of the colon, rectum, and anal canal. J Visc Surg. 2014;151:3-7.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 26]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
6.  Fields AC, Lu P, Vierra BM, Hu F, Irani J, Bleday R, Goldberg JE, Nash GM, Melnitchouk N. Survival in Patients with High-Grade Colorectal Neuroendocrine Carcinomas: The Role of Surgery and Chemotherapy. Ann Surg Oncol. 2019;26:1127-1133.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 45]  [Cited by in RCA: 38]  [Article Influence: 5.4]  [Reference Citation Analysis (2)]
7.  Smith JD, Reidy DL, Goodman KA, Shia J, Nash GM. A retrospective review of 126 high-grade neuroendocrine carcinomas of the colon and rectum. Ann Surg Oncol. 2014;21:2956-2962.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 132]  [Cited by in RCA: 107]  [Article Influence: 8.9]  [Reference Citation Analysis (6)]
8.  Antelo G, Hierro C, Fernández JP, Baena E, Bugés C, Layos L, Manzano JL, Caro M, Mesia R. Rectal neuroendocrine carcinoma: case report of a rare entity and perspective review of promising agents. Drugs Context. 2020;9.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 8]  [Article Influence: 1.3]  [Reference Citation Analysis (1)]
9.  Bertani E, Ravizza D, Milione M, Massironi S, Grana CM, Zerini D, Piccioli AN, Spinoglio G, Fazio N. Neuroendocrine neoplasms of rectum: A management update. Cancer Treat Rev. 2018;66:45-55.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 61]  [Cited by in RCA: 61]  [Article Influence: 7.6]  [Reference Citation Analysis (4)]
10.  Paspala A, Machairas N, Prodromidou A, Spartalis E, Ioannidis A, Kostakis ID, Papaconstantinou D, Nikiteas N. Management of MANEC of the colon and rectum: A comprehensive review of the literature. Mol Clin Oncol. 2018;9:219-222.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 18]  [Article Influence: 2.3]  [Reference Citation Analysis (1)]
11.  Zhang Y, Xie J, Wang J, Yang D, Jiang Z, Han G, Fu Q, Zhang Y. Clinicopathological and Prognostic Analysis of Neuroendocrine Carcinoma of the Colorectum. Adv Clin Exp Med. 2016;25:719-724.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 6]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
12.  Schmitt AM, Chang HY. Long Noncoding RNAs in Cancer Pathways. Cancer Cell. 2016;29:452-463.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2466]  [Cited by in RCA: 2489]  [Article Influence: 248.9]  [Reference Citation Analysis (7)]
13.  Luo X, Qiu Y, Jiang Y, Chen F, Jiang L, Zhou Y, Dan H, Zeng X, Lei YL, Chen Q. Long non-coding RNA implicated in the invasion and metastasis of head and neck cancer: possible function and mechanisms. Mol Cancer. 2018;17:14.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 63]  [Cited by in RCA: 65]  [Article Influence: 8.1]  [Reference Citation Analysis (0)]
14.  Lin X, Zhuang S, Chen X, Du J, Zhong L, Ding J, Wang L, Yi J, Hu G, Tang G, Luo X, Liu W, Ye F. lncRNA ITGB8-AS1 functions as a ceRNA to promote colorectal cancer growth and migration through integrin-mediated focal adhesion signaling. Mol Ther. 2022;30:688-702.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 147]  [Cited by in RCA: 126]  [Article Influence: 31.5]  [Reference Citation Analysis (1)]
15.  Shen MY, Zhou GR, -Y Zhang Z. LncRNA MIR4435-2HG contributes into colorectal cancer development and predicts poor prognosis. Eur Rev Med Pharmacol Sci. 2020;24:1771-1777.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 10]  [Reference Citation Analysis (0)]
16.  Xue J, Bai J, Long Q, Wei Y, Pan J, Li X, Tang Q. TCF-3-mediated transcription of lncRNA HNF1A-AS1 targeting oncostatin M expression inhibits epithelial-mesenchymal transition via TGFβ signaling in gastroenteropancreatic neuroendocrine neoplasms. Aging (Albany NY). 2021;13:14065-14077.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 8]  [Cited by in RCA: 10]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
17.  Chen PA, Chang PC, Yeh WW, Hu TY, Hong YC, Wang YC, Huang WJ, Lin TP. The lncRNA TPT1-AS1 promotes the survival of neuroendocrine prostate cancer cells by facilitating autophagy. Am J Cancer Res. 2024;14:2103-2123.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 5]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
18.  Zhang YY, Feng HM. MEG3 Suppresses Human Pancreatic Neuroendocrine Tumor Cells Growth and Metastasis by Down-Regulation of Mir-183. Cell Physiol Biochem. 2017;44:345-356.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 48]  [Cited by in RCA: 50]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
19.  Li X, Lan Q, Lai W, Wu H, Xu H, Fang K, Chu Z, Zeng Y. Exosome-derived lnc-HOXB8-1:2 induces tumor-associated macrophage infiltration to promote neuroendocrine differentiated colorectal cancer progression by sponging hsa-miR-6825-5p. BMC Cancer. 2022;22:928.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 25]  [Article Influence: 6.3]  [Reference Citation Analysis (6)]
20.  Du Z, Fei T, Verhaak RG, Su Z, Zhang Y, Brown M, Chen Y, Liu XS. Integrative genomic analyses reveal clinically relevant long noncoding RNAs in human cancer. Nat Struct Mol Biol. 2013;20:908-913.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 450]  [Cited by in RCA: 445]  [Article Influence: 34.2]  [Reference Citation Analysis (1)]
21.  Dong F, Ruan S, Wang J, Xia Y, Le K, Xiao X, Hu T, Wang Q. M2 macrophage-induced lncRNA PCAT6 facilitates tumorigenesis and angiogenesis of triple-negative breast cancer through modulation of VEGFR2. Cell Death Dis. 2020;11:728.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 112]  [Cited by in RCA: 107]  [Article Influence: 17.8]  [Reference Citation Analysis (0)]
22.  Lang C, Yin C, Lin K, Li Y, Yang Q, Wu Z, Du H, Ren D, Dai Y, Peng X. m(6) A modification of lncRNA PCAT6 promotes bone metastasis in prostate cancer through IGF2BP2-mediated IGF1R mRNA stabilization. Clin Transl Med. 2021;11:e426.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 133]  [Cited by in RCA: 126]  [Article Influence: 25.2]  [Reference Citation Analysis (4)]
23.  Luo J, Zheng J, Hao W, Zeng H, Zhang Z, Shao G. lncRNA PCAT6 facilitates cell proliferation and invasion via regulating the miR-326/hnRNPA2B1 axis in liver cancer. Oncol Lett. 2021;21:471.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 19]  [Cited by in RCA: 18]  [Article Influence: 3.6]  [Reference Citation Analysis (5)]
24.  Wu H, Zou Q, He H, Liang Y, Lei M, Zhou Q, Fan D, Shen L. Long non-coding RNA PCAT6 targets miR-204 to modulate the chemoresistance of colorectal cancer cells to 5-fluorouracil-based treatment through HMGA2 signaling. Cancer Med. 2019;8:2484-2495.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 48]  [Cited by in RCA: 55]  [Article Influence: 7.9]  [Reference Citation Analysis (0)]
25.  Huang W, Su G, Huang X, Zou A, Wu J, Yang Y, Zhu Y, Liang S, Li D, Ma F, Guo L. Long noncoding RNA PCAT6 inhibits colon cancer cell apoptosis by regulating anti-apoptotic protein ARC expression via EZH2. Cell Cycle. 2019;18:69-83.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 47]  [Cited by in RCA: 54]  [Article Influence: 7.7]  [Reference Citation Analysis (0)]
26.  Ghafouri-Fard S, Khoshbakht T, Taheri M, Ebrahimzadeh K. A review on the role of PCAT6 lncRNA in tumorigenesis. Biomed Pharmacother. 2021;142:112010.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 11]  [Article Influence: 2.2]  [Reference Citation Analysis (3)]
27.  Liu B, Jiang HY, Yuan T, Luo J, Zhou WD, Jiang QQ, Wu D. Enzalutamide-Induced Upregulation of PCAT6 Promotes Prostate Cancer Neuroendocrine Differentiation by Regulating miR-326/HNRNPA2B1 Axis. Front Oncol. 2021;11:650054.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 16]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
28.  Ebrahimi S, Hashemy SI. MicroRNA-mediated redox regulation modulates therapy resistance in cancer cells: clinical perspectives. Cell Oncol (Dordr). 2019;42:131-141.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 33]  [Cited by in RCA: 32]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
29.  Hussen BM, Hidayat HJ, Salihi A, Sabir DK, Taheri M, Ghafouri-Fard S. MicroRNA: A signature for cancer progression. Biomed Pharmacother. 2021;138:111528.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 339]  [Cited by in RCA: 277]  [Article Influence: 55.4]  [Reference Citation Analysis (0)]
30.  Rupaimoole R, Slack FJ. MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov. 2017;16:203-222.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3945]  [Cited by in RCA: 3683]  [Article Influence: 409.2]  [Reference Citation Analysis (4)]
31.  Dankert JT, Wiesehöfer M, Czyrnik ED, Singer BB, von Ostau N, Wennemuth G. The deregulation of miR-17/CCND1 axis during neuroendocrine transdifferentiation of LNCaP prostate cancer cells. PLoS One. 2018;13:e0200472.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 29]  [Cited by in RCA: 29]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
32.  Fernandes RC, Toubia J, Townley S, Hanson AR, Dredge BK, Pillman KA, Bert AG, Winter JM, Iggo R, Das R, Obinata D; MURAL investigators, Sandhu S, Risbridger GP, Taylor RA, Lawrence MG, Butler LM, Zoubeidi A, Gregory PA, Tilley WD, Hickey TE, Goodall GJ, Selth LA. Post-transcriptional Gene Regulation by MicroRNA-194 Promotes Neuroendocrine Transdifferentiation in Prostate Cancer. Cell Rep. 2021;34:108585.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 48]  [Cited by in RCA: 44]  [Article Influence: 8.8]  [Reference Citation Analysis (0)]
33.  Yin Y, Xu L, Chang Y, Zeng T, Chen X, Wang A, Groth J, Foo WC, Liang C, Hu H, Huang J. N-Myc promotes therapeutic resistance development of neuroendocrine prostate cancer by differentially regulating miR-421/ATM pathway. Mol Cancer. 2019;18:11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 88]  [Cited by in RCA: 90]  [Article Influence: 12.9]  [Reference Citation Analysis (0)]
34.  Bai J, Xu J, Zhao J, Zhang R. LncRNA NBR2 suppresses migration and invasion of colorectal cancer cells by downregulating miRNA-21. Hum Cell. 2020;33:98-103.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 23]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
35.  Zhang TT, Chen HP, Yu SY, Zhao SP. LncRNA HOXC-AS3 overexpression inhibits TGF-β2-induced colorectal cancer cell migration and invasion by sponging miR-1269. Hum Exp Toxicol. 2022;41:9603271221093630.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 10]  [Article Influence: 2.5]  [Reference Citation Analysis (1)]
36.  Fan M, Yan H, Gou M, Qian N, Dai G. Divergent expression of DCLK1 in gastrointestinal neuroendocrine tumors and primary hepatic, gallbladder, and pancreatic neuroendocrine tumors. Int J Clin Exp Pathol. 2020;13:2249-2258.  [PubMed]  [DOI]
37.  Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-408.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 158539]  [Cited by in RCA: 139955]  [Article Influence: 5598.2]  [Reference Citation Analysis (9)]
38.  Rindi G, Wiedenmann B. Neuroendocrine neoplasms of the gut and pancreas: new insights. Nat Rev Endocrinol. 2011;8:54-64.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 154]  [Cited by in RCA: 139]  [Article Influence: 9.3]  [Reference Citation Analysis (3)]
39.  Shin AE, Giancotti FG, Rustgi AK. Metastatic colorectal cancer: mechanisms and emerging therapeutics. Trends Pharmacol Sci. 2023;44:222-236.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 522]  [Cited by in RCA: 499]  [Article Influence: 166.3]  [Reference Citation Analysis (3)]
40.  Tan Z, Sun W, Li Y, Jiao X, Zhu M, Zhang J, Qing C, Jia Y. Current Progress of EMT: A New Direction of Targeted Therapy for Colorectal Cancer with Invasion and Metastasis. Biomolecules. 2022;12.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 38]  [Cited by in RCA: 39]  [Article Influence: 9.8]  [Reference Citation Analysis (1)]
41.  Pavel M, Baudin E, Couvelard A, Krenning E, Öberg K, Steinmüller T, Anlauf M, Wiedenmann B, Salazar R; Barcelona Consensus Conference participants. ENETS Consensus Guidelines for the management of patients with liver and other distant metastases from neuroendocrine neoplasms of foregut, midgut, hindgut, and unknown primary. Neuroendocrinology. 2012;95:157-176.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 713]  [Cited by in RCA: 602]  [Article Influence: 43.0]  [Reference Citation Analysis (8)]
42.  Shinji S, Naito Z, Ishiwata T, Tanaka N, Furukawa K, Suzuki H, Seya T, Kan H, Tsuruta H, Matsumoto S, Matsuda A, Teranishi N, Ohaki Y, Tajiri T. Neuroendocrine cell differentiation of poorly differentiated colorectal adenocarcinoma correlates with liver metastasis. Int J Oncol. 2006;29:357-364.  [PubMed]  [DOI]
43.  Luo J, Wang K, Yeh S, Sun Y, Liang L, Xiao Y, Xu W, Niu Y, Cheng L, Maity SN, Jiang R, Chang C. LncRNA-p21 alters the antiandrogen enzalutamide-induced prostate cancer neuroendocrine differentiation via modulating the EZH2/STAT3 signaling. Nat Commun. 2019;10:2571.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 150]  [Cited by in RCA: 145]  [Article Influence: 20.7]  [Reference Citation Analysis (4)]
44.  Chang CH, Cheng TY, Yeh WW, Luo YL, Campbell M, Kuo TC, Shen TW, Hong YC, Tsai CH, Peng YC, Pan CC, Yang MH, Shih JC, Kung HJ, Huang WJ, Chang PC, Lin TP. REST-repressed lncRNA LINC01801 induces neuroendocrine differentiation in prostate cancer via transcriptional activation of autophagy. Am J Cancer Res. 2023;13:3983-4002.  [PubMed]  [DOI]
45.  Zhu Q, Wang S, Shi Y. LncRNA PCAT6 activated by SP1 facilitates the progression of breast cancer by the miR-326/LRRC8E axis. Anticancer Drugs. 2022;33:178-190.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 8]  [Cited by in RCA: 8]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
46.  Zhang D, Du D, Yi S, Li X. LncRNA PCAT6: A potential biomarker for diagnosis and prognosis of bladder cancer. Ann Diagn Pathol. 2020;49:151642.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 26]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
47.  Han L, Li Z, Zhang P, Sheng M, Wang W, Sun Y, Sun D. LncRNA PCAT6 is a predictor of poor prognosis of colorectal cancer. J Gastrointest Oncol. 2024;15:190-202.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 6]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
48.  Laguerre F, Anouar Y, Montero-Hadjadje M. Chromogranin A in the early steps of the neurosecretory pathway. IUBMB Life. 2020;72:524-532.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 19]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
49.  Wu Z, Wang Z, Zheng Z, Bi J, Wang X, Feng Q. Risk Factors for Lymph Node Metastasis and Survival Outcomes in Colorectal Neuroendocrine Tumors. Cancer Manag Res. 2020;12:7151-7164.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 16]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
50.  Kang Y, Massagué J. Epithelial-mesenchymal transitions: twist in development and metastasis. Cell. 2004;118:277-279.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1224]  [Cited by in RCA: 1184]  [Article Influence: 53.8]  [Reference Citation Analysis (1)]
51.  McKeithen D, Graham T, Chung LW, Odero-Marah V. Snail transcription factor regulates neuroendocrine differentiation in LNCaP prostate cancer cells. Prostate. 2010;70:982-992.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 87]  [Cited by in RCA: 83]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
52.  Conteduca V, Aieta M, Amadori D, De Giorgi U. Neuroendocrine differentiation in prostate cancer: current and emerging therapy strategies. Crit Rev Oncol Hematol. 2014;92:11-24.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 57]  [Cited by in RCA: 76]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
53.  Esposito S, Russo MV, Airoldi I, Tupone MG, Sorrentino C, Barbarito G, Di Meo S, Di Carlo E. SNAI2/Slug gene is silenced in prostate cancer and regulates neuroendocrine differentiation, metastasis-suppressor and pluripotency gene expression. Oncotarget. 2015;6:17121-17134.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 45]  [Cited by in RCA: 42]  [Article Influence: 3.8]  [Reference Citation Analysis (1)]
54.  Odero-Marah V, Hawsawi O, Henderson V, Sweeney J. Epithelial-Mesenchymal Transition (EMT) and Prostate Cancer. Adv Exp Med Biol. 2018;1095:101-110.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 153]  [Cited by in RCA: 151]  [Article Influence: 18.9]  [Reference Citation Analysis (0)]
55.  Sun X, Yuan Y, Li S, Gan L, Xu M, Li Q, Liu M, Hu K, Nan K, Zhang J, Dong Y, Lin Y, Zhang X, Hou P, Liu T. Prostate cancer-associated transcript 6 (PCAT6) promotes epithelial-mesenchymal transition and stemness and worsens prognosis in patients with colorectal cancer. Acta Biochim Biophys Sin (Shanghai). 2024;56:866-878.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 2]  [Reference Citation Analysis (0)]
56.  Yang C, Huang H, Li Y, Zhuo T, Zhu L, Luo C, Wu Y, Qin S. LncRNA PCAT6 promotes proliferation, migration, invasion, and epithelial-mesenchymal transition of lung adenocarcinoma cell by targeting miR-545-3p. Mol Biol Rep. 2023;50:3557-3568.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 8]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
57.  Chen Y, Hong C, Qu J, Chen J, Qin Z. Knockdown of lncRNA PCAT6 suppresses the growth of non-small cell lung cancer cells by inhibiting macrophages M2 polarization via miR-326/KLF1 axis. Bioengineered. 2022;13:12834-12846.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 40]  [Cited by in RCA: 40]  [Article Influence: 10.0]  [Reference Citation Analysis (4)]
58.  Bai J, Yao F, Fu Y, Kang N, Wen G. LncRNA PCAT6 promotes the occurrence of laryngeal squamous cell carcinoma via modulation of the miR-4731-5p/NOTCH3 axis. J Radiat Res. 2024;65:474-481.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 2]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
59.  Zhang Y, Chen L, Luo G. Long non-coding RNA PCAT6 regulates bladder cancer progression via the microRNA-143-3p/PDIA6 axis. Exp Ther Med. 2021;22:947.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 15]  [Cited by in RCA: 14]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
60.  Duan X, Zhao M, Yin X, Mi L, Shi J, Li N, Han X, Han G, Wang J, Hou J, Yin F. Molecular typing and mutational characterization of rectal neuroendocrine neoplasms. Cancer Med. 2023;12:16207-16220.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 9]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
61.  Dizdar L, Werner TA, Drusenheimer JC, Möhlendick B, Raba K, Boeck I, Anlauf M, Schott M, Göring W, Esposito I, Stoecklein NH, Knoefel WT, Krieg A. BRAF(V600E) mutation: A promising target in colorectal neuroendocrine carcinoma. Int J Cancer. 2019;144:1379-1390.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 36]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
62.  Wang B, Zhang L, Zhao L, Zhou R, Ding Y, Li G, Zhao L. LASP2 suppresses colorectal cancer progression through JNK/p38 MAPK pathway meditated epithelial-mesenchymal transition. Cell Commun Signal. 2017;15:21.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 35]  [Cited by in RCA: 38]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
63.  Ou S, Liao Y, Shi J, Tang J, Ye Y, Wu F, Wang W, Fei J, Xie F, Bai L. S100A16 suppresses the proliferation, migration and invasion of colorectal cancer cells in part via the JNK/p38 MAPK pathway. Mol Med Rep. 2021;23.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 26]  [Cited by in RCA: 23]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
64.  Yang C, Wu D, Gao L, Liu X, Jin Y, Wang D, Wang T, Li X. Competing endogenous RNA networks in human cancer: hypothesis, validation, and perspectives. Oncotarget. 2016;7:13479-13490.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 169]  [Cited by in RCA: 175]  [Article Influence: 17.5]  [Reference Citation Analysis (0)]
65.  Bao Z, Gao S, Tang Q, Zhang B, Shi W, Tian Q. A novel role of miR-326 in colorectal carcinoma by regulating E2F1 expression. J BUON. 2021;26:528-535.  [PubMed]  [DOI]
66.  Cai L, Chen JJ, Deng FM, Wang L, Chen Y. MiR-326 regulates the proliferation and apoptosis of endometrial cancer by targeting Bcl-2. J Obstet Gynaecol Res. 2021;47:621-630.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 15]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
67.  Yang L, Chen Y. Circ_0008717 Sponges miR-326 to Elevate GATA6 Expression to Promote Breast Cancer Tumorigenicity. Biochem Genet. 2023;61:578-596.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 8]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
68.  Gao A, Hu Y, Zhu W. CDCA5 is negatively regulated by miR-326 and boosts ovarian cancer progression. J BUON. 2021;26:544-552.  [PubMed]  [DOI]
Footnotes

Open-Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Oncology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade C

Novelty: Grade B

Creativity or Innovation: Grade B

Scientific Significance: Grade B

P-Reviewer: Zhang YQ S-Editor: Liu H L-Editor: A P-Editor: Wang WB

Write to the Help Desk