|
1
|
Romano F, Di Porzio A, Iaccarino N, Riccardi G, Di Lorenzo R, Laneri S, Pagano B, Amato J, Randazzo A. G-quadruplexes in cancer-related gene promoters: from identification to therapeutic targeting. Expert Opin Ther Pat 2023; 33:745-773. [PMID: 37855085 DOI: 10.1080/13543776.2023.2271168] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/26/2023] [Accepted: 10/11/2023] [Indexed: 10/20/2023]
Abstract
INTRODUCTION Guanine-rich DNA sequences can fold into four-stranded noncanonical secondary structures called G-quadruplexes (G4s) which are widely distributed in functional regions of the human genome, such as telomeres and gene promoter regions. Compelling evidence suggests their involvement in key genome functions such as gene expression and genome stability. Notably, the abundance of G4-forming sequences near transcription start sites suggests their potential involvement in regulating oncogenes. AREAS COVERED This review provides an overview of current knowledge on G4s in human oncogene promoters. The most representative G4-binding ligands have also been documented. The objective of this work is to present a comprehensive overview of the most promising targets for the development of novel and highly specific anticancer drugs capable of selectively impacting the expression of individual or a limited number of genes. EXPERT OPINION Modulation of G4 formation by specific ligands has been proposed as a powerful new tool to treat cancer through the control of oncogene expression. Actually, most of G4-binding small molecules seem to simultaneously target a range of gene promoter G4s, potentially influencing several critical driver genes in cancer, thus producing significant therapeutic benefits.
Collapse
Affiliation(s)
- Francesca Romano
- Department of Pharmacy, University of Naples Federico II, Naples, Italy
| | - Anna Di Porzio
- Department of Pharmacy, University of Naples Federico II, Naples, Italy
| | - Nunzia Iaccarino
- Department of Pharmacy, University of Naples Federico II, Naples, Italy
| | | | | | - Sonia Laneri
- Department of Pharmacy, University of Naples Federico II, Naples, Italy
| | - Bruno Pagano
- Department of Pharmacy, University of Naples Federico II, Naples, Italy
| | - Jussara Amato
- Department of Pharmacy, University of Naples Federico II, Naples, Italy
| | - Antonio Randazzo
- Department of Pharmacy, University of Naples Federico II, Naples, Italy
| |
Collapse
|
|
2
|
Han ZQ, Wen LN. Application of G-quadruplex targets in gastrointestinal cancers: Advancements, challenges and prospects. World J Gastrointest Oncol 2023; 15:1149-1173. [PMID: 37546556 PMCID: PMC10401460 DOI: 10.4251/wjgo.v15.i7.1149] [Citation(s) in RCA: 3] [Impact Index Per Article: 1.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 02/11/2023] [Revised: 04/11/2023] [Accepted: 05/08/2023] [Indexed: 07/12/2023] Open
Abstract
Genomic instability and inflammation are considered to be two enabling characteristics that support cancer development and progression. G-quadruplex structure is a key element that contributes to genomic instability and inflammation. G-quadruplexes were once regarded as simply an obstacle that can block the transcription of oncogenes. A ligand targeting G-quadruplexes was found to have anticancer activity, making G-quadruplexes potential anticancer targets. However, further investigation has revealed that G-quadruplexes are widely distributed throughout the human genome and have many functions, such as regulating DNA replication, DNA repair, transcription, translation, epigenetics, and inflammatory response. G-quadruplexes play double regulatory roles in transcription and translation. In this review, we focus on G-quadruplexes as novel targets for the treatment of gastrointestinal cancers. We summarize the application basis of G-quadruplexes in gastrointestinal cancers, including their distribution sites, structural characteristics, and physiological functions. We describe the current status of applications for the treatment of esophageal cancer, pancreatic cancer, hepatocellular carcinoma, gastric cancer, colorectal cancer, and gastrointestinal stromal tumors, as well as the associated challenges. Finally, we review the prospective clinical applications of G-quadruplex targets, providing references for targeted treatment strategies in gastrointestinal cancers.
Collapse
Affiliation(s)
- Zong-Qiang Han
- Department of Laboratory Medicine, Beijing Xiaotangshan Hospital, Beijing 102211, China
| | - Li-Na Wen
- Department of Clinical Nutrition, Beijing Shijitan Hospital, Capital Medical University, Beijing 100038, China
| |
Collapse
|
|
3
|
Sugimoto N, Endoh T, Takahashi S, Tateishi-Karimata H. Chemical Biology of Double Helical and Non-Double Helical Nucleic Acids: “To B or Not To B, That Is the Question”. BULLETIN OF THE CHEMICAL SOCIETY OF JAPAN 2021. [DOI: 10.1246/bcsj.20210131] [Citation(s) in RCA: 9] [Impact Index Per Article: 2.3] [Reference Citation Analysis] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 12/25/2022]
Affiliation(s)
- Naoki Sugimoto
- Frontier Institute for Biomolecular Engineering Research (FIBER), Konan University, 17-1-20 Minatojima-minamimachi, Kobe, Hyogo 650-0047, Japan
- Graduate School of Frontiers of Innovative Research in Science and Technology (FIRST), Konan University, 17-1-20 Minatojima-minamimachi, Kobe, Hyogo 650-0047, Japan
| | - Tamaki Endoh
- Frontier Institute for Biomolecular Engineering Research (FIBER), Konan University, 17-1-20 Minatojima-minamimachi, Kobe, Hyogo 650-0047, Japan
| | - Shuntaro Takahashi
- Frontier Institute for Biomolecular Engineering Research (FIBER), Konan University, 17-1-20 Minatojima-minamimachi, Kobe, Hyogo 650-0047, Japan
| | - Hisae Tateishi-Karimata
- Frontier Institute for Biomolecular Engineering Research (FIBER), Konan University, 17-1-20 Minatojima-minamimachi, Kobe, Hyogo 650-0047, Japan
| |
Collapse
|
|
4
|
D’Aria F, Pagano B, Petraccone L, Giancola C. KRAS Promoter G-Quadruplexes from Sequences of Different Length: A Physicochemical Study. Int J Mol Sci 2021; 22:ijms22010448. [PMID: 33466280 PMCID: PMC7795837 DOI: 10.3390/ijms22010448] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/25/2020] [Revised: 12/23/2020] [Accepted: 12/31/2020] [Indexed: 11/16/2022] Open
Abstract
DNA G-quadruplexes (G4s) form in relevant genomic regions and intervene in several biological processes, including the modulation of oncogenes expression, and are potential anticancer drug targets. The human KRAS proto-oncogene promoter region contains guanine-rich sequences able to fold into G4 structures. Here, by using circular dichroism and differential scanning calorimetry as complementary physicochemical methodologies, we compared the thermodynamic stability of the G4s formed by a shorter and a longer version of the KRAS promoter sequence, namely 5′-AGGGCGGTGTGGGAATAGGGAA-3′ (KRAS 22RT) and 5′-AGGGCGGTGTGGGAAGAGGGAAGAGGGGGAGG-3′ (KRAS 32R). Our results show that the unfolding mechanism of KRAS 32R is more complex than that of KRAS 22RT. The different thermodynamic stability is discussed based on the recently determined NMR structures. The binding properties of TMPyP4 and BRACO-19, two well-known G4-targeting anticancer compounds, to the KRAS G4s were also investigated. The present physicochemical study aims to help in choosing the best G4 target for potential anticancer drugs.
Collapse
Affiliation(s)
- Federica D’Aria
- Department of Pharmacy, University of Naples Federico II, Via D. Montesano 49, 80131 Naples, Italy; (F.D.); (B.P.)
| | - Bruno Pagano
- Department of Pharmacy, University of Naples Federico II, Via D. Montesano 49, 80131 Naples, Italy; (F.D.); (B.P.)
| | - Luigi Petraccone
- Department of Chemical Sciences, University of Naples Federico II, Via Cintia 4, 80126 Naples, Italy;
| | - Concetta Giancola
- Department of Pharmacy, University of Naples Federico II, Via D. Montesano 49, 80131 Naples, Italy; (F.D.); (B.P.)
- Correspondence:
| |
Collapse
|
|
5
|
D'Aria F, D'Amore VM, Di Leva FS, Amato J, Caterino M, Russomanno P, Salerno S, Barresi E, De Leo M, Marini AM, Taliani S, Da Settimo F, Salgado GF, Pompili L, Zizza P, Shirasawa S, Novellino E, Biroccio A, Marinelli L, Giancola C. Targeting the KRAS oncogene: Synthesis, physicochemical and biological evaluation of novel G-Quadruplex DNA binders. Eur J Pharm Sci 2020; 149:105337. [PMID: 32311457 DOI: 10.1016/j.ejps.2020.105337] [Citation(s) in RCA: 8] [Impact Index Per Article: 1.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/10/2020] [Revised: 03/30/2020] [Accepted: 04/01/2020] [Indexed: 02/07/2023]
Abstract
The oncogene KRAS is involved in the pathogenesis of many tumors such as pancreatic, lung and colorectal cancers, thereby representing a relevant target for the treatment of these diseases. The KRAS P1 promoter contains a nuclease hypersensitive, guanine-rich sequence able to fold into a G-quadruplex motif (G4). The stabilization of this G4 structure by small molecules is emerging as a feasible approach to downregulate KRAS expression. Here, a set of novel stabilizing molecules was identified through a virtual screening campaign on the NMR structure of the 22-mer KRAS G4. The most promising hits were then submitted to structure-activity relationships studies which allowed improving their binding affinity and selectivity over double helix DNA and different G4 topologies. The best derivative (19) underwent fluorescence titration experiments and further computational studies to disclose its binding mechanism to KRAS G4. Finally, biological assays showed that this compound is capable to reduce the viability of colorectal cancer cells in which mutated KRAS acts as a driver oncogene. Thus, 19 might represent the prototype of a new class of drugs for the treatment of tumors that, expressing mutated forms of KRAS, are refractory to current therapeutic regimens.
Collapse
Affiliation(s)
- Federica D'Aria
- Department of Pharmacy, University of Naples Federico II, via D. Montesano 49, 80131 Napoli, Italy
| | - Vincenzo Maria D'Amore
- Department of Pharmacy, University of Naples Federico II, via D. Montesano 49, 80131 Napoli, Italy
| | | | - Jussara Amato
- Department of Pharmacy, University of Naples Federico II, via D. Montesano 49, 80131 Napoli, Italy
| | - Marco Caterino
- Department of Pharmacy, University of Naples Federico II, via D. Montesano 49, 80131 Napoli, Italy
| | - Pasquale Russomanno
- Department of Pharmacy, University of Naples Federico II, via D. Montesano 49, 80131 Napoli, Italy
| | - Silvia Salerno
- Department of Pharmacy, University of Pisa, via Bonanno 6, 56126 Pisa, Italy
| | - Elisabetta Barresi
- Department of Pharmacy, University of Pisa, via Bonanno 6, 56126 Pisa, Italy
| | - Marinella De Leo
- Department of Pharmacy, University of Pisa, via Bonanno 6, 56126 Pisa, Italy
| | - Anna Maria Marini
- Department of Pharmacy, University of Pisa, via Bonanno 6, 56126 Pisa, Italy
| | - Sabrina Taliani
- Department of Pharmacy, University of Pisa, via Bonanno 6, 56126 Pisa, Italy
| | - Federico Da Settimo
- Department of Pharmacy, University of Pisa, via Bonanno 6, 56126 Pisa, Italy
| | - Gilmar F Salgado
- ARNA Laboratory, IECB, University of Bordeaux, Inserm U1212, CNRS UMR 5320, F-33600 Pessac, France
| | - Luca Pompili
- Oncogenomic and Epigenetic Unit, IRCCS - Regina Elena National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy
| | - Pasquale Zizza
- Oncogenomic and Epigenetic Unit, IRCCS - Regina Elena National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy
| | - Senji Shirasawa
- Central Research Institute for Advanced Molecular Medicine, Fukuoka University, Fukuoka, Japan
| | - Ettore Novellino
- Department of Pharmacy, University of Naples Federico II, via D. Montesano 49, 80131 Napoli, Italy
| | - Annamaria Biroccio
- Oncogenomic and Epigenetic Unit, IRCCS - Regina Elena National Cancer Institute, Via Elio Chianesi 53, 00144 Rome, Italy
| | - Luciana Marinelli
- Department of Pharmacy, University of Naples Federico II, via D. Montesano 49, 80131 Napoli, Italy
| | - Concetta Giancola
- Department of Pharmacy, University of Naples Federico II, via D. Montesano 49, 80131 Napoli, Italy.
| |
Collapse
|
|
6
|
Tateishi-Karimata H, Sugimoto N. Chemical biology of non-canonical structures of nucleic acids for therapeutic applications. Chem Commun (Camb) 2020; 56:2379-2390. [PMID: 32022004 DOI: 10.1039/c9cc09771f] [Citation(s) in RCA: 50] [Impact Index Per Article: 10.0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/18/2022]
Abstract
DNA forms not only the canonical duplex structure but also non-canonical structures. Most potential sequences that induce the formation of non-canonical structures are present in disease-related genes. Interestingly, biological reactions are inhibited or dysregulated by non-canonical structure formation in disease-related genes. To control biological reactions, methods for inducing the formation of non-canonical structures have been developed using small molecules and oligonucleotides. In this feature article, we review biological reactions such as replication, transcription, and reverse transcription controlled by non-canonical DNA structures formed by disease-related genes. Furthermore, we discuss recent studies aimed at developing methods for regulating these biological reactions using drugs targeting the DNA structure.
Collapse
Affiliation(s)
- Hisae Tateishi-Karimata
- Frontier Institute for Biomolecular Engineering Research (FIBER), Konan University, 17-1-20 Minatojima-minamimachi, Kobe, 650-0047, Japan.
| | | |
Collapse
|
|
7
|
Asamitsu S, Obata S, Yu Z, Bando T, Sugiyama H. Recent Progress of Targeted G-Quadruplex-Preferred Ligands Toward Cancer Therapy. Molecules 2019; 24:E429. [PMID: 30682877 PMCID: PMC6384606 DOI: 10.3390/molecules24030429] [Citation(s) in RCA: 207] [Impact Index Per Article: 34.5] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/03/2018] [Revised: 01/22/2019] [Accepted: 01/23/2019] [Indexed: 02/07/2023] Open
Abstract
A G-quadruplex (G4) is a well-known nucleic acid secondary structure comprising guanine-rich sequences, and has profound implications for various pharmacological and biological events, including cancers. Therefore, ligands interacting with G4s have attracted great attention as potential anticancer therapies or in molecular probe applications. To date, a large variety of DNA/RNA G4 ligands have been developed by a number of laboratories. As protein-targeting drugs face similar situations, G-quadruplex-interacting drugs displayed low selectivity to the targeted G-quadruplex structure. This low selectivity could cause unexpected effects that are usually reasons to halt the drug development process. In this review, we address the recent research on synthetic G4 DNA-interacting ligands that allow targeting of selected G4s as an approach toward the discovery of highly effective anticancer drugs.
Collapse
Affiliation(s)
- Sefan Asamitsu
- Department of Chemistry, Graduate School of Science Kyoto University, Kitashirakawa-Oiwakecho, Sakyo, Kyoto, 606-8502, Japan.
| | - Shunsuke Obata
- Department of Chemistry, Graduate School of Science Kyoto University, Kitashirakawa-Oiwakecho, Sakyo, Kyoto, 606-8502, Japan.
| | - Zutao Yu
- Department of Chemistry, Graduate School of Science Kyoto University, Kitashirakawa-Oiwakecho, Sakyo, Kyoto, 606-8502, Japan.
| | - Toshikazu Bando
- Department of Chemistry, Graduate School of Science Kyoto University, Kitashirakawa-Oiwakecho, Sakyo, Kyoto, 606-8502, Japan.
| | - Hiroshi Sugiyama
- Department of Chemistry, Graduate School of Science Kyoto University, Kitashirakawa-Oiwakecho, Sakyo, Kyoto, 606-8502, Japan.
- Institute for Integrated Cell-Material Science (WPI-iCeMS) Kyoto University, Yoshida-Ushinomiyacho, Sakyo, Kyoto, 606-8501, Japan.
| |
Collapse
|
|
8
|
Asamitsu S, Bando T, Sugiyama H. Ligand Design to Acquire Specificity to Intended G-Quadruplex Structures. Chemistry 2018; 25:417-430. [PMID: 30051593 DOI: 10.1002/chem.201802691] [Citation(s) in RCA: 111] [Impact Index Per Article: 15.9] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/28/2018] [Revised: 07/14/2018] [Indexed: 12/17/2022]
Abstract
A G-quadruplex is a nucleic acid secondary structure that is adopted by guanine-rich sequences, and is considered to be relevant in various pharmacological and biological contexts. G-Quadruplexes have also attracted great attention in the field of DNA nanotechnology because of their extremely high thermal stability and the availability of many defined structures. To date, a large repertory of DNA/RNA G-quadruplex-interactive ligands has been developed by numerous laboratories. Several relevant reviews have also been published that have helped researchers to grasp the full scope of G-quadruplex research from its outset to the present. This review focuses on the G-quadruplex ligands that allow targeting of specific G-quadruplexes. Moreover, unique ligands, successful methodologies, and future perspectives in relation to specific G-quadruplex recognition are also addressed.
Collapse
Affiliation(s)
- Sefan Asamitsu
- Department of Chemistry, Graduate School of Science, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo, Kyoto, 606-8502, Japan
| | - Toshikazu Bando
- Department of Chemistry, Graduate School of Science, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo, Kyoto, 606-8502, Japan
| | - Hiroshi Sugiyama
- Department of Chemistry, Graduate School of Science, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo, Kyoto, 606-8502, Japan.,Institute for Integrated Cell-Material Science (WPI-iCeMS), Kyoto University, Sakyo, Kyoto, 606-8501, Japan
| |
Collapse
|
|
9
|
Asamitsu S, Obata S, Phan AT, Hashiya K, Bando T, Sugiyama H. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex. Chemistry 2018; 24:4428-4435. [DOI: 10.1002/chem.201705945] [Citation(s) in RCA: 31] [Impact Index Per Article: 4.4] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/15/2017] [Indexed: 12/24/2022]
Affiliation(s)
- Sefan Asamitsu
- Department of Chemistry; Graduate School of Science Kyoto University, Kitashirakawa-Oiwakecho, Sakyo; Kyoto 606-8502 Japan
| | - Shunsuke Obata
- Department of Chemistry; Graduate School of Science Kyoto University, Kitashirakawa-Oiwakecho, Sakyo; Kyoto 606-8502 Japan
| | - Anh Tuân Phan
- School of Physical and Mathematical Sciences; Nanyang Technological University; Singapore 637371 Singapore
| | - Kaori Hashiya
- Department of Chemistry; Graduate School of Science Kyoto University, Kitashirakawa-Oiwakecho, Sakyo; Kyoto 606-8502 Japan
| | - Toshikazu Bando
- Department of Chemistry; Graduate School of Science Kyoto University, Kitashirakawa-Oiwakecho, Sakyo; Kyoto 606-8502 Japan
| | - Hiroshi Sugiyama
- Department of Chemistry; Graduate School of Science Kyoto University, Kitashirakawa-Oiwakecho, Sakyo; Kyoto 606-8502 Japan
- Institute for Integrated Cell-Material Science (WPI-iCeMS); Kyoto University, Sakyo; Kyoto 606-8501 Japan
| |
Collapse
|
|
10
|
Critical role of hnRNP A1 in activating KRAS transcription in pancreatic cancer cells: A molecular mechanism involving G4 DNA. Biochim Biophys Acta Gen Subj 2016; 1861:1389-1398. [PMID: 27888145 DOI: 10.1016/j.bbagen.2016.11.031] [Citation(s) in RCA: 27] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/14/2016] [Revised: 11/17/2016] [Accepted: 11/20/2016] [Indexed: 01/31/2023]
Abstract
KRAS is one of the most mutated genes in human cancer. Its crucial role in the tumourigenesis of pancreatic ductal adenocarcinoma (PDAC) has been widely demonstrated. As this deadly cancer does not sufficiently respond to conventional chemotherapies, it is important to increase our knowledge of pancreatic cancer biology, in particular how oncogenic KRAS is regulated. The promoter of KRAS contains a GA-element composed of runs of guanines that fold into a G4 structure. This unusual DNA conformation is recognized by several nuclear proteins, including MAZ and hnRNP A1. Recent data have revealed that KRAS is interconnected to ILK and hnRNP A1 in a circuitry that enables pancreatic cancer cells to maintain an aggressive phenotype. The present review illustrates recent advances on how KRAS is regulated in pancreatic cancer cells, focusing on the formation of G4 structures in the KRAS promoter and their interaction with hnRNP A1. The newly discovered KRAS-ILK-hnRNP A1 regulatory loop is discussed, emphasizing its potential as a therapeutic target for PDAC-specific molecules. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.
Collapse
|
|
11
|
Scuotto M, Rivieccio E, Varone A, Corda D, Bucci M, Vellecco V, Cirino G, Virgilio A, Esposito V, Galeone A, Borbone N, Varra M, Mayol L. Site specific replacements of a single loop nucleoside with a dibenzyl linker may switch the activity of TBA from anticoagulant to antiproliferative. Nucleic Acids Res 2015; 43:7702-16. [PMID: 26250112 PMCID: PMC4652776 DOI: 10.1093/nar/gkv789] [Citation(s) in RCA: 37] [Impact Index Per Article: 3.7] [Reference Citation Analysis] [Abstract] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/11/2015] [Accepted: 07/23/2015] [Indexed: 12/20/2022] Open
Abstract
Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13.
Collapse
Affiliation(s)
- Maria Scuotto
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| | - Elisa Rivieccio
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| | - Alessia Varone
- Institute of Protein Biochemistry, National Research Council, Via Pietro Castellino 111, 80131 Naples, Italy
| | - Daniela Corda
- Institute of Protein Biochemistry, National Research Council, Via Pietro Castellino 111, 80131 Naples, Italy
| | - Mariarosaria Bucci
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| | - Valentina Vellecco
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| | - Giuseppe Cirino
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| | - Antonella Virgilio
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| | - Veronica Esposito
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| | - Aldo Galeone
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| | - Nicola Borbone
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| | - Michela Varra
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| | - Luciano Mayol
- Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, Naples, Italy
| |
Collapse
|
|
12
|
Miller MC, Ohrenberg CJ, Kuttan A, Trent JO. Separation of Quadruplex Polymorphism in DNA Sequences by Reversed-Phase Chromatography. CURRENT PROTOCOLS IN NUCLEIC ACID CHEMISTRY 2015; 61:17.7.1-17.7.18. [PMID: 26344226 PMCID: PMC4561857 DOI: 10.1002/0471142700.nc1707s61] [Citation(s) in RCA: 5] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 12/28/2022]
Abstract
This unit describes a method for the separation of a mixture of quadruplex conformations formed from the same parent sequence via reversed-phase chromatography (RPC). Polymorphism is inherent to quadruplex formation and even relatively simple quadruplex-forming sequences can fold into a cornucopia of possible conformations and topologies. Isolation of a specific conformation for study can be problematic. This is especially true for conformations of the human telomere sequence d(GGG(TTAGGG)3). High performance liquid chromatography (HPLC), especially reversed-phase chromatography, has been a mainstay of nucleic acid research and purification for many decades. We have successfully applied this method to the problem of separating individual quadruplex species in the ensemble from the same parent sequence.
Collapse
Affiliation(s)
- M. Clarke Miller
- Department of Chemistry and Biochemistry, University of North Georgia, 3820 Mundy Mill Road, Oakwood, Georgia 30566
- James Graham Brown Cancer Center, Clinical Translational Research Building, University of Louisville, 505 South Hancock Street, Louisville, KY 40202
| | - Carl J. Ohrenberg
- Department of Chemistry and Biochemistry, University of North Georgia, 3820 Mundy Mill Road, Oakwood, Georgia 30566
| | - Ashani Kuttan
- James Graham Brown Cancer Center, Clinical Translational Research Building, University of Louisville, 505 South Hancock Street, Louisville, KY 40202
| | - John O. Trent
- James Graham Brown Cancer Center, Clinical Translational Research Building, University of Louisville, 505 South Hancock Street, Louisville, KY 40202
- Department of Medicine, University of Louisville, Clinical Translational Research Building, University of Louisville, 505 South Hancock Street, Louisville, KY 40202
| |
Collapse
|
|
13
|
Métifiot M, Amrane S, Litvak S, Andreola ML. G-quadruplexes in viruses: function and potential therapeutic applications. Nucleic Acids Res 2014; 42:12352-66. [PMID: 25332402 PMCID: PMC4227801 DOI: 10.1093/nar/gku999] [Citation(s) in RCA: 175] [Impact Index Per Article: 15.9] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/02/2014] [Revised: 09/26/2014] [Accepted: 10/06/2014] [Indexed: 12/15/2022] Open
Abstract
G-rich nucleic acids can form non-canonical G-quadruplex structures (G4s) in which four guanines fold in a planar arrangement through Hoogsteen hydrogen bonds. Although many biochemical and structural studies have focused on DNA sequences containing successive, adjacent guanines that spontaneously fold into G4s, evidence for their in vivo relevance has recently begun to accumulate. Complete sequencing of the human genome highlighted the presence of ∼300,000 sequences that can potentially form G4s. Likewise, the presence of putative G4-sequences has been reported in various viruses genomes [e.g., Human immunodeficiency virus (HIV-1), Epstein-Barr virus (EBV), papillomavirus (HPV)]. Many studies have focused on telomeric G4s and how their dynamics are regulated to enable telomere synthesis. Moreover, a role for G4s has been proposed in cellular and viral replication, recombination and gene expression control. In parallel, DNA aptamers that form G4s have been described as inhibitors and diagnostic tools to detect viruses [e.g., hepatitis A virus (HAV), EBV, cauliflower mosaic virus (CaMV), severe acute respiratory syndrome virus (SARS), simian virus 40 (SV40)]. Here, special emphasis will be given to the possible role of these structures in a virus life cycle as well as the use of G4-forming oligonucleotides as potential antiviral agents and innovative tools.
Collapse
Affiliation(s)
- Mathieu Métifiot
- CNRS UMR-5234, Université de Bordeaux, 146 Rue Léo Saignat, 33076 Bordeaux, France
| | - Samir Amrane
- INSERM, U869, IECB, ARNA laboratory, Université de Bordeaux, 2 Rue Robert Escarpit 33600 Pessac, France
| | - Simon Litvak
- CNRS UMR-5234, Université de Bordeaux, 146 Rue Léo Saignat, 33076 Bordeaux, France
| | - Marie-Line Andreola
- CNRS UMR-5234, Université de Bordeaux, 146 Rue Léo Saignat, 33076 Bordeaux, France
| |
Collapse
|
|
14
|
Mironov GG, Okhonin V, Khan N, Clouthier CM, Berezovski MV. Conformational Dynamics of DNA G-Quadruplex in Solution Studied by Kinetic Capillary Electrophoresis Coupled On-line with Mass Spectrometry. ChemistryOpen 2014; 3:58-64. [PMID: 24808992 PMCID: PMC4000168 DOI: 10.1002/open.201400002] [Citation(s) in RCA: 10] [Impact Index Per Article: 0.9] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/29/2014] [Indexed: 12/03/2022] Open
Abstract
G-quadruplex-forming DNA/RNA sequences play an important role in the regulation of biological functions and development of new anticancer and anti-aging drugs. In this work, we couple on-line kinetic capillary electrophoresis with mass spectrometry (KCE-MS) to study conformational dynamics of DNA G-quadruplexes in solution. We show that peaks shift and its widening in KCE can be used for measuring rate and equilibrium constants for DNA–metal affinity interactions and G-quadruplex formation; and ion mobility mass spectrometry (IM-MS) provides information about relative sizes, absolute molecular masses and stoichiometry of DNA complexes. KCE-MS separates a thrombin-binding aptamer d[GGTTGGTGTGGTTGG] from mutated sequences based on affinity to potassium, and reveals the apparent equilibrium folding constant (KF≈150 μm), folding rate constant (kon≈1.70×103 s−1 m−1), unfolding rate constant (koff≈0.25 s−1), half-life time of the G-quadruplex (t1/2≈2.8 s), and relaxation time (τ≈3.9 ms at physiological 150 mm [K+]). In addition, KCE-MS screens for a GQ-stabilizing/-destabilizing effect of DNA binding dyes and an anticancer drug, cisplatin.
Collapse
Affiliation(s)
- Gleb G Mironov
- Department of Chemistry, University of Ottawa 10 Marie Curie, Ottawa K1N 6N5 (Canada)
| | - Victor Okhonin
- Department of Chemistry, University of Ottawa 10 Marie Curie, Ottawa K1N 6N5 (Canada)
| | - Nasrin Khan
- Department of Chemistry, University of Ottawa 10 Marie Curie, Ottawa K1N 6N5 (Canada)
| | | | - Maxim V Berezovski
- Department of Chemistry, University of Ottawa 10 Marie Curie, Ottawa K1N 6N5 (Canada)
| |
Collapse
|
|
15
|
Cogoi S, Zorzet S, Rapozzi V, Géci I, Pedersen EB, Xodo LE. MAZ-binding G4-decoy with locked nucleic acid and twisted intercalating nucleic acid modifications suppresses KRAS in pancreatic cancer cells and delays tumor growth in mice. Nucleic Acids Res 2013; 41:4049-64. [PMID: 23471001 PMCID: PMC3627599 DOI: 10.1093/nar/gkt127] [Citation(s) in RCA: 79] [Impact Index Per Article: 6.6] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/30/2022] Open
Abstract
KRAS mutations are primary genetic lesions leading to pancreatic cancer. The promoter of human KRAS contains a nuclease-hypersensitive element (NHE) that can fold in G4-DNA structures binding to nuclear proteins, including MAZ (myc-associated zinc-finger). Here, we report that MAZ activates KRAS transcription. To knockdown oncogenic KRAS in pancreatic cancer cells, we designed oligonucleotides that mimic one of the G-quadruplexes formed by NHE (G4-decoys). To increase their nuclease resistance, two locked nucleic acid (LNA) modifications were introduced at the 3'-end, whereas to enhance the folding and stability, two polycyclic aromatic hydrocarbon units (TINA or AMANY) were inserted internally, to cap the quadruplex. The most active G4-decoy (2998), which had two para-TINAs, strongly suppressed KRAS expression in Panc-1 cells. It also repressed their metabolic activity (IC50 = 520 nM), and it inhibited cell growth and colony formation by activating apoptosis. We finally injected 2998 and control oligonucleotides 5153, 5154 (2 nmol/mouse) intratumorally in SCID mice bearing a Panc-1 xenograft. After three treatments, 2998 reduced tumor xenograft growth by 64% compared with control and increased the Kaplan-Meier median survival time by 70%. Together, our data show that MAZ-specific G4-decoys mimicking a KRAS quadruplex are promising for pancreatic cancer therapy.
Collapse
Affiliation(s)
- Susanna Cogoi
- Department of Medical and Biological Sciences, School of Medicine, P.le Kolbe 4, 33100 Udine, Italy
| | | | | | | | | | | |
Collapse
|
|
16
|
Lai YT, DeStefano JJ. DNA aptamers to human immunodeficiency virus reverse transcriptase selected by a primer-free SELEX method: characterization and comparison with other aptamers. Nucleic Acid Ther 2012; 22:162-76. [PMID: 22554064 PMCID: PMC3423876 DOI: 10.1089/nat.2011.0327] [Citation(s) in RCA: 24] [Impact Index Per Article: 1.8] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/14/2011] [Accepted: 03/24/2012] [Indexed: 12/17/2022] Open
Abstract
A 30-nucleotide DNA aptamer (5'-AGGAAGGCTTTAGGTCTGAGATCTCGGAAT-3', denoted PF1) selected for high affinity to human immunodeficiency virus reverse transcriptase (HIV RT) using a primer-free SELEX (systematic evolution of ligands by exponential enrichment) method was characterized to determine features promoting tight binding. PF1's equilibrium dissociation constant for RT was ∼80 nM, over 10-fold lower than a random 30-mer. Changing the 2 terminal diguanosine repeats (underlined above) to diadenosine or dithymidine modestly decreased binding. Any changes to the 2 central diguanosines dramatically decreased binding. Binding was highly sensitive to length, with any truncations that deleted part of the 4 diguanosine motifs resulting in a 6-fold or more decrease in affinity. Even a construct with all the diguanosine motifs but lacking the 5' terminal A and 3 nucleotides at the 3' end showed ∼3-fold binding decrease. Changes to the nucleotides between the diguanosines, even those that did not alter PF1's low secondary structure (free energy of folding ΔG=-0.61 kcal/mol), dramatically decreased binding, suggesting sequence specificity. Despite the diguanosine motifs, circular dichroism (CD) spectra indicated that PF1 did not form a G-quartet. PF1 inhibited HIV RT synthesis with a half-maximal inhibitory value (IC(50)) of ∼60 nM. Larger, more structured RT DNA aptamers based on the HIV polypurine tract and those that formed G-quartets (denoted S4 and R1T) were more potent inhibitors, with IC(50) values of ∼4 and ∼1 nM, respectively. An RNA pseudoknot aptamer (denoted 1.1) showed an IC(50) near 4 nM. Competition binding assays with PF1 and several previously characterized RT aptamers indicated that they all bound at or near the primer-template pocket. These other more structured and typically larger aptamers bound more tightly than PF1 to RT based on filter binding assays. Results indicate that PF1 represents a new class of RT aptamers that are relatively small and have very low secondary structure, attributes that could be advantageous for further development as HIV inhibitors.
Collapse
Affiliation(s)
- Yi-Tak Lai
- Department of Cell Biology and Molecular Genetics, University of Maryland College Park, College Park, Maryland 20742, USA
| | | |
Collapse
|
|
17
|
Cheng YC, Chen TA, Chen CY, Liang CM, Liang SM. 3'poly-G-tailed ODNs inhibit F-spondin to induce cell death and neurite retraction in rat embryonic neurons. Mol Neurobiol 2012; 45:536-49. [PMID: 22592270 DOI: 10.1007/s12035-012-8275-8] [Citation(s) in RCA: 3] [Impact Index Per Article: 0.2] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/26/2012] [Accepted: 05/01/2012] [Indexed: 10/28/2022]
Abstract
The effects and mechanism of action of oligodeoxyribonucleotides containing CpG motif (CpG-ODNs) on neuron cells are largely unexamined. Here, we found that CpG-A ODNs but not other types of CpG-ODNs induced neurite retraction and cell apoptosis of rat embryonic neurons in a TLR9-independent manner. These effects of CpG-A ODNs were primarily due to the poly-guanosine at the 3' terminus (3'G-ODNs). Pull-down analysis showed that 3'G-ODNs associated with transcription factor Y-BOX1 (YB-1) to facilitate the translocation of YB-1 into the nucleus via the nuclear localizing sequence of YB-1. YB-1 then interacted with the promoter of F-spondin directly at -45 and -1,375 sites as demonstrated by chromatin immunoprecipitation (ChIP) analysis. Binding of YB-1 to F-spondin promoter resulted in downregulation of F-spondin expression. Overexpression of F-spondin rescued the cell death and neurite retraction induced by 3'G-ODNs in embryonic neuron cells. Taken together, these findings suggest that 3'G-ODNs enhance nucleus YB-1 to inhibit F-spondin leading to cell death and neurite retraction of embryonic neuron cells.
Collapse
Affiliation(s)
- Yung-Chih Cheng
- Institute of Biochemical Sciences, National Taiwan University, Taipei, Taiwan
| | | | | | | | | |
Collapse
|
|
18
|
Yuan G, Zhang Q, Zhou J, Li H. Mass spectrometry of G-quadruplex DNA: formation, recognition, property, conversion, and conformation. MASS SPECTROMETRY REVIEWS 2011; 30:1121-1142. [PMID: 21520218 DOI: 10.1002/mas.20315] [Citation(s) in RCA: 44] [Impact Index Per Article: 3.1] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Subscribe] [Scholar Register] [Received: 04/02/2010] [Revised: 06/09/2010] [Accepted: 06/09/2010] [Indexed: 05/30/2023]
Abstract
G-quadruplexes are special secondary structures formed from G-rich sequences of DNA, and have proven to play important roles in a number of biological systems, including the regulation of gene transcription and translation. The highly distinctive nature of G-quadruplex structures and their functions suggest that G-quadruplexes can act as novel targets for drug development. As a highly sensitive analytical tool, mass spectrometry has been widely used for the analysis of G-quadruplex structures. Electrospray-ionization mass spectrometry, in particular, has found captivating applications to probe interactions between small molecules and G-quadruplex DNA. In this review, we will discuss: (1) mass spectrometry probing of the formation, binding affinity, and stoichiometry between G-quadruplexes and small molecules; (2) stabilization and collision-dissociation behavior of G-quadruplex DNA; (3) the exploration of the equilibrium transfer between a G-quadruplex and duplex DNA; and (4) the ESI-MS analysis of the conversion of intramolecular and intermolecular G-quadruplexes. Finally, we will also introduce the application of new techniques in the analysis of G-quadruplex conformation, such as ion-mobility and infrared multiphoton-dissociation mass spectrometry. We believe that, with the new technical developments, mass spectrometry will play an unparalleled role in the analysis of the G-quadruplex structures.
Collapse
Affiliation(s)
- Gu Yuan
- Beijing National Laboratory for Molecular Sciences, Key Department of Chemical Biology, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871, China.
| | | | | | | |
Collapse
|
|
19
|
Miller MC, Trent JO. Resolution of quadruplex polymorphism by size-exclusion chromatography. ACTA ACUST UNITED AC 2011; Chapter 17:Unit17.3. [PMID: 21638270 DOI: 10.1002/0471142700.nc1703s45] [Citation(s) in RCA: 8] [Impact Index Per Article: 0.6] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/30/2022]
Abstract
This unit describes a method for separation of quadruplex species formed from the same sequence via size-exclusion chromatography (SEC). Polymorphism is inherent to quadruplex formation, and even relatively simple quadruplex-forming sequences, such as the human telomere sequence d(GGG(TTAGGG)(3)), can form a myriad of possible configurations. HPLC, especially using reversed-phase and anion-exchange methods, has been a mainstay of nucleic acids research and purification for many decades. These methods have been applied for separation of individual quadruplex species formed in a mixture from the same parent sequence.
Collapse
Affiliation(s)
- M Clarke Miller
- James Graham Brown Cancer Center, University of Louisville, Louisville, Kentucky, USA
| | | |
Collapse
|
|
20
|
Miller MC, Le HT, Dean WL, Holt PA, Chaires JB, Trent JO. Polymorphism and resolution of oncogene promoter quadruplex-forming sequences. Org Biomol Chem 2011; 9:7633-7. [PMID: 21938285 DOI: 10.1039/c1ob05891f] [Citation(s) in RCA: 31] [Impact Index Per Article: 2.2] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/03/2023]
Abstract
We report the separation of several quadruplex species formed by ten promoter sequences by Size Exclusion Chromatography (SEC). Modification at the 5' or 3' ends or in loop regions of quadruplex forming sequences has become the standard technique for dealing with quadruplex polymorphism. However, conformations produced employing this method or by other means of artificially shifting the equilibrium may not represent the species that are present in vivo. This method enables an unperturbed view of the structural polymorphism inherent to quadruplex formation. Separation via SEC facilitates studies on quadruplex structure and biophysical properties without the need for sequence modification.
Collapse
Affiliation(s)
- M Clarke Miller
- Department of Medicine, University of Louisville, Louisville, KY 40202, USA
| | | | | | | | | | | |
Collapse
|
|
21
|
Abstract
DNA G-quadruplexes are DNA secondary structures formed in specific G-rich sequences. DNA sequences that can form G-quadruplexes have been found in regions with biological significance, such as human telomeres and oncogene-promoter regions. DNA G-quadruplexes have recently emerged as a new class of novel molecular targets for anticancer drugs. Recent progress on structural studies of the biologically relevant G-quadruplexes formed in human telomeres and in the promoter regions of human oncogenes will be discussed, as well as recent advances in the design and development of G-quadruplex-interactive drugs. DNA G-quadruplexes can readily form in solution under physiological conditions and are globularly folded nucleic acid structures. The molecular structures of intramolecular G-quadruplexes appear to differ from one another and, therefore, in principle may be differentially regulated and targeted by different proteins and drugs.
Collapse
|
|
22
|
Xu GF, Zhang KH. Application of nucleic acid aptamers for digestive disease research. Shijie Huaren Xiaohua Zazhi 2010; 18:3220-3225. [DOI: 10.11569/wcjd.v18.i30.3220] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 02/06/2023] Open
Abstract
Nucleic acid aptamers, selected from a synthesized library of random single-stranded oligonucleotides by systematic evolution of ligands by exponential enrichment (SELEX), are oligonucleotide ligands binding to target molecules with high specificity and affinity. Nucleic acid aptamers have similar functions to antibodies, but possess the advantages of wider range of targets, better stability, easier modification and synthesis, showing promising prospects for diagnosis and treatment of diseases. In terms of digestive diseases, nucleic acid aptamers have been applied in the research of tumor markers, anti-tumor therapy, hepatitis virus C and liver imaging.
Collapse
|
|
23
|
Dailey MM, Miller MC, Bates PJ, Lane AN, Trent JO. Resolution and characterization of the structural polymorphism of a single quadruplex-forming sequence. Nucleic Acids Res 2010; 38:4877-88. [PMID: 20348136 PMCID: PMC2919704 DOI: 10.1093/nar/gkq166] [Citation(s) in RCA: 133] [Impact Index Per Article: 8.9] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/14/2023] Open
Abstract
The remarkable structural polymorphism of quadruplex-forming sequences has been a considerable impediment in the elucidation of quadruplex folds. Sequence modifications have commonly been used to perturb and purportedly select a particular form out of the ensemble of folds for nuclear magnetic resonance (NMR) or X-ray crystallographic analysis. Here we report a simple chromatographic technique that separates the individual folds without need for sequence modification. The sequence d(GGTGGTGGTGGTTGTGGTGGTGGTGG) forms a compact quadruplex according to a variety of common biophysical techniques. However, NMR and chromatography showed that this oligonucleotide produces at least eight monomeric quadruplex species that interconvert very slowly at room temperature. We have used a combination of spectroscopic, hydrodynamic and thermodynamic techniques to evaluate the physicochemical properties of the mixture and the individual species. These species have almost identical thermodynamic, hydrodynamic and electrophoretic properties, but significantly different NMR and circular dichroism (CD) spectra, as well as kinetic stability. These results demonstrate that simple standard low-resolution techniques cannot always be used for quadruplex fold determination or quality control purposes, and that simple thermodynamic analysis does not directly provide interpretable thermodynamic parameters.
Collapse
Affiliation(s)
- Magdalena M Dailey
- Department of Chemistry, University of Louisville, Louisville, KY 40202, USA
| | | | | | | | | |
Collapse
|
|
24
|
Jenjaroenpun P, Kuznetsov VA. TTS mapping: integrative WEB tool for analysis of triplex formation target DNA sequences, G-quadruplets and non-protein coding regulatory DNA elements in the human genome. BMC Genomics 2009; 10 Suppl 3:S9. [PMID: 19958507 PMCID: PMC2788396 DOI: 10.1186/1471-2164-10-s3-s9] [Citation(s) in RCA: 30] [Impact Index Per Article: 1.9] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 02/07/2023] Open
Abstract
Background DNA triplexes can naturally occur, co-localize and interact with many other regulatory DNA elements (e.g. G-quadruplex (G4) DNA motifs), specific DNA-binding proteins (e.g. transcription factors (TFs)), and micro-RNA (miRNA) precursors. Specific genome localizations of triplex target DNA sites (TTSs) may cause abnormalities in a double-helix DNA structure and can be directly involved in some human diseases. However, genome localization of specific TTSs, their interconnection with regulatory DNA elements and physiological roles in a cell are poor defined. Therefore, it is important to identify comprehensive and reliable catalogue of specific potential TTSs (pTTSs) and their co-localization patterns with other regulatory DNA elements in the human genome. Results "TTS mapping" database is a web-based search engine developed here, which is aimed to find and annotate pTTSs within a region of interest of the human genome. The engine provides descriptive statistics of pTTSs in a given region and its sequence context. Different annotation tracks of TTS-overlapping gene region(s), G4 motifs, CpG Island, miRNA precursors, miRNA targets, transcription factor binding sites (TFBSs), Single Nucleotide Polymorphisms (SNPs), small nucleolar RNAs (snoRNA), and repeat elements are also mapped based onto a sequence location provided by UCSC genome browser, G4 database http://www.quadruplex.org and several other datasets. The results pages provide links to UCSC genome browser annotation tracks and relative DBs. BLASTN program was included to check the uniqueness of a given pTTS in the human genome. Recombination- and mutation-prone genes (e.g. EVI-1, MYC) were found to be significantly enriched by TTSs and multiple co-occurring with our regulatory DNA elements. TTS mapping reveals that a high-complementary and evolutionarily conserved polypurine and polypyrimidine DNA sequence pair linked by a non-conserved short DNA sequence can form miR-483 transcribed from intron 2 of IGF2 gene and bound double-strand nucleic acid TTSs forming natural triplex structures. Conclusion TTS mapping provides comprehensive visual and analytical tools to help users to find pTTSs, G-quadruplets and other regulatory DNA elements in various genome regions. TTS Mapping not only provides sequence visualization and statistical information, but also integrates knowledge about co-localization TTS with various DNA elements and facilitates that data analysis. In particular, TTS Mapping reveals complex structural-functional regulatory module of gene IGF2 including TF MZF1 binding site and ncRNA precursor mir-483 formed by the high-complementary and evolutionarily conserved polypurine- and polypyrimidine-rich DNA pair. Such ncRNAs capable of forming helical triplex structures with a polypurine strand of a nucleic acid duplexes (DNA or RNA) via Hoogsteen or reverse Hoogsteen hydrogen bonds. Our web tool could be used to discover biologically meaningful genome modules and to optimize experimental design of anti-gene treatment.
Collapse
Affiliation(s)
- Piroon Jenjaroenpun
- Department of Genome and Gene Expression Data Analysis, Bioinformatics Institute, 30 Biopolis str #07-01, Singapore.
| | | |
Collapse
|
|
25
|
Zheng KW, Chen Z, Hao YH, Tan Z. Molecular crowding creates an essential environment for the formation of stable G-quadruplexes in long double-stranded DNA. Nucleic Acids Res 2009; 38:327-38. [PMID: 19858105 PMCID: PMC2800236 DOI: 10.1093/nar/gkp898] [Citation(s) in RCA: 112] [Impact Index Per Article: 7.0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/13/2023] Open
Abstract
Large numbers of guanine-rich sequences with potential to form G-quadruplexes have been identified in genomes of various organisms. Such sequences are constrained at both ends by long DNA duplex with a complementary strand in close proximity to compete for duplex formation. G-quadruplex/duplex competition in long double-stranded DNA has rarely been studied. In this work, we used DMS footprinting and gel electrophoresis to study G-quadruplex formation in long double-stranded DNA derived from human genome under both dilute and molecular crowding condition created by PEG. G-quadruplex formation was observed in the process of RNA transcription and after heat denaturation/renaturation under molecular crowding condition. Our results showed that the heat denaturation/renaturation treatment followed by gel electrophoresis could provide a simple method to quantitatively access the ability of G-quadruplex formation in long double-stranded DNA. The effect of K+ and PEG concentration was investigated and we found that stable G-quadruplexes could only form under the crowding condition with PEG at concentrations near the physiological concentration of biomass in living cells. This observation reveals a physical basis for the formation of stable G-quadruplexes in genome and supports its presence under the in vivo molecular crowding condition.
Collapse
Affiliation(s)
- Ke-wei Zheng
- Laboratory of Biochemistry and Biophysics, College of Life Sciences, Wuhan University, Wuhan, PR China
| | | | | | | |
Collapse
|
|
26
|
Bates PJ, Laber DA, Miller DM, Thomas SD, Trent JO. Discovery and development of the G-rich oligonucleotide AS1411 as a novel treatment for cancer. Exp Mol Pathol 2009; 86:151-64. [PMID: 19454272 PMCID: PMC2716701 DOI: 10.1016/j.yexmp.2009.01.004] [Citation(s) in RCA: 613] [Impact Index Per Article: 38.3] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 11/26/2008] [Indexed: 02/07/2023]
Abstract
Certain guanine-rich (G-rich) DNA and RNA molecules can associate intermolecularly or intramolecularly to form four stranded or "quadruplex" structures, which have unusual biophysical and biological properties. Several synthetic G-rich quadruplex-forming oligodeoxynucleotides have recently been investigated as therapeutic agents for various human diseases. We refer to these biologically active G-rich oligonucleotides as aptamers because their activities arise from binding to protein targets via shape-specific recognition (analogous to antibody-antigen binding). As therapeutic agents, the G-rich aptamers may have some advantages over monoclonal antibodies and other oligonucleotide-based approaches. For example, quadruplex oligonucleotides are non-immunogenic, heat stable and they have increased resistance to serum nucleases and enhanced cellular uptake compared to unstructured sequences. In this review, we describe the characteristics and activities of G-rich oligonucleotides. We also give a personal perspective on the discovery and development of AS1411, an antiproliferative G-rich phosphodiester oligonucleotide that is currently being tested as an anticancer agent in Phase II clinical trials. This molecule functions as an aptamer to nucleolin, a multifunctional protein that is highly expressed by cancer cells, both intracellularly and on the cell surface. Thus, the serendipitous discovery of the G-rich oligonucleotides also led to the identification of nucleolin as a new molecular target for cancer therapy.
Collapse
Affiliation(s)
- Paula J Bates
- James Graham Brown Cancer Center, Department of Medicine, University of Louisville, Louisville, Kentucky 40202, USA.
| | | | | | | | | |
Collapse
|
|
27
|
Huppert JL, Bugaut A, Kumari S, Balasubramanian S. G-quadruplexes: the beginning and end of UTRs. Nucleic Acids Res 2008; 36:6260-8. [PMID: 18832370 PMCID: PMC2577360 DOI: 10.1093/nar/gkn511] [Citation(s) in RCA: 323] [Impact Index Per Article: 19.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 04/18/2008] [Revised: 07/20/2008] [Accepted: 07/25/2008] [Indexed: 01/17/2023] Open
Abstract
Molecular mechanisms that regulate gene expression can occur either before or after transcription. The information for post-transcriptional regulation can lie within the sequence or structure of the RNA transcript and it has been proposed that G-quadruplex nucleic acid sequence motifs may regulate translation as well as transcription. Here, we have explored the incidence of G-quadruplex motifs in and around the untranslated regions (UTRs) of mRNA. We observed a significant strand asymmetry, consistent with a general depletion of G-quadruplex-forming RNA. We also observed a positional bias in two distinct regions, each suggestive of a specific function. We observed an excess of G-quadruplex motifs towards the 5'-ends of 5'-UTRs, supportive of a hypothesis linking 5'-UTR RNA G-quadruplexes to translational control. We then analysed the vicinity of 3'-UTRs and observed an over-representation of G-quadruplex motifs immediately after the 3'-end of genes, especially in those cases where another gene is in close proximity, suggesting that G-quadruplexes may be involved in the termination of gene transcription.
Collapse
Affiliation(s)
- Julian Leon Huppert
- Cavendish Laboratory, University of Cambridge, JJ Thompson Ave, Cambridge CB3 0HE and University Chemical Laboratory, University of Cambridge, Lensfield Road, Cambridge CB2 1EW, UK
| | - Anthony Bugaut
- Cavendish Laboratory, University of Cambridge, JJ Thompson Ave, Cambridge CB3 0HE and University Chemical Laboratory, University of Cambridge, Lensfield Road, Cambridge CB2 1EW, UK
| | - Sunita Kumari
- Cavendish Laboratory, University of Cambridge, JJ Thompson Ave, Cambridge CB3 0HE and University Chemical Laboratory, University of Cambridge, Lensfield Road, Cambridge CB2 1EW, UK
| | - Shankar Balasubramanian
- Cavendish Laboratory, University of Cambridge, JJ Thompson Ave, Cambridge CB3 0HE and University Chemical Laboratory, University of Cambridge, Lensfield Road, Cambridge CB2 1EW, UK
| |
Collapse
|
|
28
|
Redman JE, Granadino-Roldán JM, Schouten JA, Ladame S, Reszka AP, Neidle S, Balasubramanian S. Recognition and discrimination of DNA quadruplexes by acridine-peptide conjugates. Org Biomol Chem 2008; 7:76-84. [PMID: 19081949 DOI: 10.1039/b814682a] [Citation(s) in RCA: 44] [Impact Index Per Article: 2.6] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/08/2023]
Abstract
We have explored a series of trisubstituted acridine-peptide conjugates for their ability to recognize and discriminate between DNA quadruplexes derived from the human telomere, and the c-kit and N-ras proto-oncogenes. Quadruplex affinity was measured as the peptide sequences were varied, together with their substitution position on the acridine, and the identity of the C-terminus (acid or amide). Surface plasmon resonance measurements revealed that all compounds bound to the human telomeric quadruplex with sub-micromolar affinity. Docking calculations from molecular modelling studies were used to model the effects of substituent orientation and peptide sequence. Modelling and experiment were in agreement that placement of the peptide over the face of the acridine is detrimental to binding affinity. The highest degrees of selectivity were observed towards the N-ras quadruplex by compounds capable of forming simultaneous contacts with their acridine and peptide moieties. The ligands that bound best displayed quadruplex affinities in the 1-5 nM range and at least 10-fold discrimination between the quadruplexes studied.
Collapse
Affiliation(s)
- James E Redman
- University Chemical Laboratory, University of Cambridge, Lensfield Road, Cambridge, CB2 1EW, UK
| | | | | | | | | | | | | |
Collapse
|
|
29
|
Chen SH, Suzuki CK, Wu SH. Thermodynamic characterization of specific interactions between the human Lon protease and G-quartet DNA. Nucleic Acids Res 2008; 36:1273-87. [PMID: 18174225 PMCID: PMC2275097 DOI: 10.1093/nar/gkm1140] [Citation(s) in RCA: 41] [Impact Index Per Article: 2.4] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/15/2022] Open
Abstract
Lon is an ATP-powered protease that binds DNA. However, the function of DNA binding by Lon remains elusive. Studies suggest that human Lon (hLon) binds preferentially to a G-rich single-stranded DNA (ssDNA) sequence overlapping the light strand promoter of mitochondrial DNA. This sequence is contained within a 24-base oligonucleotide referred to as LSPas. Here, we use biochemical and biophysical approaches to elucidate the structural properties of ssDNAs bound by hLon, as well as the thermodynamics of DNA binding by hLon. Electrophoretic mobility shift assay and circular dichroism show that ssDNAs with a propensity for forming parallel G-quartets are specifically bound by hLon. Isothermal titration calorimetry demonstrates that hLon binding to LSPas is primarily driven by enthalpy change associated with a significant reduction in heat capacity. Differential scanning calorimetry pinpoints an excess heat capacity upon hLon binding to LSPas. By contrast, hLon binding to an 8-base G-rich core sequence is entropically driven with a relatively negligible change in heat capacity. A considerable enhancement of thermal stability accompanies hLon binding to LSPas as compared to the G-rich core. Taken together, these data support the notion that hLon binds G-quartets through rigid-body binding and that binding to LSPas is coupled with structural adaptation.
Collapse
Affiliation(s)
- Si-Han Chen
- Institute of Biological Chemistry, Academia Sinica, Taipei 115, Taiwan
| | | | | |
Collapse
|
|
30
|
Li G, Huang J, Zhang M, Zhou Y, Zhang D, Wu Z, Wang S, Weng X, Zhou X, Yang G. Bis(benzimidazole)pyridine derivative as a new class of G-quadruplex inducing and stabilizing ligand. Chem Commun (Camb) 2008:4564-6. [DOI: 10.1039/b807916a] [Citation(s) in RCA: 43] [Impact Index Per Article: 2.5] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 02/06/2023]
|
|
31
|
Huppert JL. Four-stranded DNA: cancer, gene regulation and drug development. PHILOSOPHICAL TRANSACTIONS. SERIES A, MATHEMATICAL, PHYSICAL, AND ENGINEERING SCIENCES 2007; 365:2969-84. [PMID: 17855220 DOI: 10.1098/rsta.2007.0011] [Citation(s) in RCA: 56] [Impact Index Per Article: 3.1] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 05/17/2023]
Abstract
DNA can form many structures other than the famous double helix. In particular, guanine-rich DNA of particular sequences can form four-stranded structures, called G-quadruplexes. This article describes the structural form of these sequences, techniques for predicting which sequences can fold up in this manner and efforts towards stability prediction. It then discusses the biological significance of these structures, focusing on their importance in telomeric regions at the end of chromosomes, and their existence in gene promoters and mRNA, where they may be involved with regulating transcription and translation, respectively. Ligands that are capable of selectively binding to these structures are introduced and described, as are DNA aptamers that form G-quadruplex structures; both of these classes of compound have been investigated as anticancer agents in clinical trials. The growing use of G-quadruplexes in the nanotechnology field is also outlined. The article concludes with an analysis of future directions the field may take, with some proposals for further important studies.
Collapse
Affiliation(s)
- Julian Leon Huppert
- Cavendish Laboratory, Department of Physics, University of Cambridge, J. J. Thomson Avenue, Cambridge CB3 0HE, UK.
| |
Collapse
|
|
32
|
McManus SA, Li Y. A deoxyribozyme with a novel guanine quartet-helix pseudoknot structure. J Mol Biol 2007; 375:960-8. [PMID: 18054790 DOI: 10.1016/j.jmb.2007.10.080] [Citation(s) in RCA: 17] [Impact Index Per Article: 0.9] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/23/2007] [Revised: 10/17/2007] [Accepted: 10/29/2007] [Indexed: 11/24/2022]
Abstract
Here we report a deoxyribozyme with a unique structure that contains a two-tiered guanine quadruplex interlinked to a Watson-Crick duplex. Through in vitro selection, sequence mutation, and methylation interference, we show the presence of both the two-tiered guanine-quadruplex and two helical regions contained in the active structure of this self-phosphorylating deoxyribozyme. Interestingly, one GG element of the quadruplex is part of a hairpin loop within one of the identified helical regions. Circular dichroism analysis showed that antiparallel quadruplex formation was dependent on this helix. To our knowledge, this is the first report of a pseudoknot nucleic acid structure that involves a guanine quadruplex. Our findings indicate that guanine quadruplexes can be part of complex structural arrangements, increasing the likelihood of finding more complex guanine quadruplex arrangements in biological systems.
Collapse
Affiliation(s)
- Simon A McManus
- Department of Biochemistry and Biomedical Sciences, McMaster University, 1200 Main Street West, Hamilton, Canada
| | | |
Collapse
|
|
33
|
Tian YH, Xiong CL, Wan H, Huang DH, Guan HT, Ding XF, Shang XJ. Inhibition of the urokinase-type plasminogen activator by triplex-forming oligonucleotides in rat Sertoli cells: a new contraceptive alternative? Oligonucleotides 2007; 17:174-88. [PMID: 17638522 DOI: 10.1089/oli.2006.0068] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.1] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/20/2023]
Abstract
Urokinase-type plasminogen activator (uPA), expressed in Sertoli cells in the testis, is closely related with tight junctions of blood-testis barrier (BTB), and it has been considered as a potential contraceptive target. In the present study, the antigene effects of triplex-forming oligodeoxynucleotides (TFO) targeting uPA in rat Sertoli cells were investigated in vitro. The stable triplexes, formed by uPA specific TFOs under physiological conditions, were tested by means of electrophoretic mobility shift assays (EMSA). Although tPA, another form of plasminogen activators (PAs), partially compensated the lose of PAs activities, uPA mRNA and protein were significantly reduced as demonstrated by real-time reverse transcription PCR and a chromogenic assay, after the treatment of Sertoli cells with uPA specific TFOs at a concentration of 330 nM. The capacity of TFOs resistance to nuclease degradation was enhanced by the phosphorothioated on the backbone of the oligonucleotides. Our results indicated that the TFOs can downregulate uPA expression and uPA might be an alternative contraceptive target.
Collapse
Affiliation(s)
- Yong-Hong Tian
- Center of Reproductive Medicine, Institute of Family Planning Research, Tongji Medical College, Huazhong Science and Technology University, Wuhan, Hubei Province, 430030, People's Republic of China
| | | | | | | | | | | | | |
Collapse
|
|
34
|
Green JJ, Ladame S, Ying L, Klenerman D, Balasubramanian S. Investigating a quadruplex-ligand interaction by unfolding kinetics. J Am Chem Soc 2007; 128:9809-12. [PMID: 16866537 PMCID: PMC2196206 DOI: 10.1021/ja0615425] [Citation(s) in RCA: 25] [Impact Index Per Article: 1.4] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/27/2023]
Abstract
We have investigated the interaction of the intramolecular human telomeric DNA G-quadruplex with a hemicyanine-peptide ligand, by studying the rate of quadruplex opening with a complementary DNA oligonucleotide. By employing a minimal kinetic model, the relationship between the observed rate of quadruplex opening and the ligand concentration has enabled estimation of the dissociation constant. A van't Hoff analysis revealed the enthalpy and entropy changes of binding to be -77 +/- 22 kJ mol(-1) and -163 +/- 75 J mol(-1) K(-1), respectively. Arrhenius analyses of the rate constants of opening free and bound quadruplex gave activation energies of 118 +/- 2 and 98 +/- 10 kJ mol(-1), respectively. These results indicate that the presence of the ligand has only a small effect on the activation energy, suggesting that the unbinding of the ligand occurs after the transition state for quadruplex unfolding.
Collapse
|
|
35
|
Goodchild A, King A, Gozar MM, Passioura T, Tucker C, Rivory L. Cytotoxic G-rich oligodeoxynucleotides: putative protein targets and required sequence motif. Nucleic Acids Res 2007; 35:4562-72. [PMID: 17586818 PMCID: PMC1935016 DOI: 10.1093/nar/gkm465] [Citation(s) in RCA: 18] [Impact Index Per Article: 1.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/19/2007] [Revised: 05/27/2007] [Accepted: 05/28/2007] [Indexed: 11/19/2022] Open
Abstract
It has recently been shown that certain oligodeoxynucleotides (ODNs) designed as catalytic DNA molecules (DNAzymes) exhibit potent cytotoxicity independent of RNA-cleavage activity in a number of cell lines. These cytotoxic ODNs all featured a 5' G-rich sequence and induced cell death by a TLR9-independent mechanism. In this study, we examined the sequence and length dependence of ODNs for cytotoxicity. A G-rich sequence at the 5' terminus of the molecule was necessary for cytotoxicity and the potency of ODNs with active 5' sequences was length dependent. Cytotoxicity appeared to be generally independent of 3' sequence composition, although 3' sequences totally lacking G-nucleotides were mostly inactive. Nucleolin, elongation factor 1-alpha (eEF1A) and vimentin were identified as binding to a cytotoxic ODN (Dz13) using protein pull-down assays and LC-MS/MS. Although these proteins have previously been described to bind G-rich ODNs, the binding of eEF1A correlated with cytotoxicity, whereas binding of nucleolin and vimentin did not. Quiescent non-proliferating cells were resistant to cytotoxicity, indicating cytotoxicity may be cell cycle dependent. Although the exact mechanism of cytotoxicity remains unknown, marked potency of the longer (> or =25 nt) ODNs in particular, indicates the potential of these molecules for treatment of diseases associated with abnormal cell proliferation.
Collapse
Affiliation(s)
- Amber Goodchild
- Johnson & Johnson Research Pty Ltd, Eveleigh, NSW, 1430, Australia.
| | | | | | | | | | | |
Collapse
|
|
36
|
Rivory L, Tucker C, King A, Lai A, Goodchild A, Witherington C, Gozar MM, Birkett DJ. The DNAzymes Rs6, Dz13, and DzF have potent biologic effects independent of catalytic activity. Oligonucleotides 2007; 16:297-312. [PMID: 17155906 DOI: 10.1089/oli.2006.16.297] [Citation(s) in RCA: 16] [Impact Index Per Article: 0.9] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/13/2022]
Abstract
DNAzymes are catalytic DNA molecules capable of cleaving RNA substrates and therefore constitute a possible gene-suppression technology. We examined whether the previously reported potency of a DNAzyme targeting c-jun (Dz13) could be improved with judicious use of sequence and chemical modifications. Catalytic activity was measured to establish correlations between catalytic activity and biological potency. Surprisingly, Dz13 had significant cytotoxic activity against cells of rodent origin (IC(50) = 20-50 nM) despite having greatly reduced catalytic activity against a rodent target substrate (<25%), the latter being the result of a mismatch to the rodent c-jun sequence. In contrast, a modified Dz13 matching the rodent c-jun sequence (DT1501b) had no activity at similar concentrations against human or rodent cells despite being able to efficiently cleave the rodent c-jun sequence. Overall, catalytic activity against synthetic substrates did not correlate with cytotoxic activity and catalytically inactive mutants had in some cases equal or superior potency in cell cytotoxicity assays. Further examination of other previously published DNAzymes (Rs6 and DzF) revealed other occurrences of this anomalous behaviour. The active sequences all have G-rich 5 termini, suggesting that G-quadruplex formation might be involved. Consistent with this, deaza-guanosine substitutions abrogated cytotoxicity of Dz13. However, Dz13 did not show evidence of quadruplex formation as determined by circular dichroism studies and native electrophoresis. These data reveal that the biologic activity of several published DNAzymes is not mediated through the catalytic degradation of target mRNA.
Collapse
Affiliation(s)
- Laurent Rivory
- Johnson & Johnson Research Pty, Ltd., Eveleigh, NSW, 1430, Australia.
| | | | | | | | | | | | | | | |
Collapse
|
|
37
|
Fernando H, Reszka AP, Huppert J, Ladame S, Rankin S, Venkitaraman AR, Neidle S, Balasubramanian S. A conserved quadruplex motif located in a transcription activation site of the human c-kit oncogene. Biochemistry 2006; 45:7854-60. [PMID: 16784237 PMCID: PMC2195898 DOI: 10.1021/bi0601510] [Citation(s) in RCA: 340] [Impact Index Per Article: 17.9] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/23/2023]
Abstract
The c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its therapeutic inhibition by small molecules such as imatinib is clinically validated. We identified a putative quadruplex forming 21-nucleotide sequence upstream of the c-kit transcription initiation site (c-kit21), on the G-rich strand, which occupies a site required for core promoter activity. Here, we show by nuclear magnetic resonance (NMR), circular dichroism (CD), and ultraviolet (UV) spectroscopic methods that c-kit21 forms quadruplexes under physiological conditions. Mutational analysis of c-kit21 has provided insights into its structural polymorphism. In particular, one mutated form appears to form a single quadruplex species that adopts a parallel conformation. The quadruplex-forming sequence shows a high level of sequence conservation across human, mouse, rat, and chimpanzee. The small variation in sequence between the quadruplex in human/chimpanzee as compared to the rat/mouse was examined more closely by biophysical methods. Despite a variation in the sequence and length of loop 2, the quadruplexes showed both comparable CD spectra, indicative of parallel quadruplexes, and also similar thermal-stability profiles, suggesting conservation of biophysical characteristics. Collectively, the evidence suggests that this quadruplex is a serious target for a detailed functional investigation at the cell-biology level.
Collapse
Affiliation(s)
- Himesh Fernando
- Department of Chemistry, University of Cambridge, Lensfield Road, Cambridge, CB2 1EW, United Kingdom
| | - Anthony P. Reszka
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, United Kingdom
| | - Julian Huppert
- Department of Chemistry, University of Cambridge, Lensfield Road, Cambridge, CB2 1EW, United Kingdom
| | - Sylvain Ladame
- Department of Chemistry, University of Cambridge, Lensfield Road, Cambridge, CB2 1EW, United Kingdom
| | - Sarah Rankin
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, United Kingdom
| | - Ashok R. Venkitaraman
- MRC Cancer Cell Unit, Hutchison/MRC Research Centre, University of Cambridge, Hills Road, Cambridge CB2 2XZ, United Kingdom
| | - Stephen Neidle
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, United Kingdom
| | - Shankar Balasubramanian
- Department of Chemistry, University of Cambridge, Lensfield Road, Cambridge, CB2 1EW, United Kingdom
- To whom correspondence should be addressed. E-mail:
| |
Collapse
|
|
38
|
Ambrus A, Chen D, Dai J, Bialis T, Jones RA, Yang D. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res 2006; 34:2723-35. [PMID: 16714449 PMCID: PMC1464114 DOI: 10.1093/nar/gkl348] [Citation(s) in RCA: 913] [Impact Index Per Article: 48.1] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/16/2006] [Revised: 04/04/2006] [Accepted: 04/19/2006] [Indexed: 11/23/2022] Open
Abstract
Human telomeric DNA consists of tandem repeats of the sequence d(TTAGGG). The formation and stabilization of DNA G-quadruplexes in the human telomeric sequence have been shown to inhibit the activity of telomerase, thus the telomeric DNA G-quadruplex has been considered as an attractive target for cancer therapeutic intervention. However, knowledge of the intact human telomeric G-quadruplex structure(s) formed under physiological conditions is a prerequisite for structure-based rational drug design. Here we report the folding structure of the human telomeric sequence in K+ solution determined by NMR. Our results demonstrate a novel, unprecedented intramolecular G-quadruplex folding topology with hybrid-type mixed parallel/antiparallel G-strands. This telomeric G-quadruplex structure contains three G-tetrads with mixed G-arrangements, which are connected consecutively with a double-chain-reversal side loop and two lateral loops, each consisting of three nucleotides TTA. This intramolecular hybrid-type telomeric G-quadruplex structure formed in K+ solution is distinct from those reported on the 22 nt Tel22 in Na+ solution and in crystalline state in the presence of K+, and appears to be the predominant conformation for the extended 26 nt telomeric sequence Tel26 in the presence of K+, regardless of the presence or absence of Na+. Furthermore, the addition of K+ readily converts the Na+-form conformation to the K+-form hybrid-type G-quadruplex. Our results explain all the reported experimental data on the human telomeric G-quadruplexes formed in the presence of K+, and provide important insights for understanding the polymorphism and interconversion of various G-quadruplex structures formed within the human telomeric sequence, as well as the effects of sequence and cations. This hybrid-type G-quadruplex topology suggests a straightforward pathway for the secondary structure formation with effective packing within the extended human telomeric DNA. The hybrid-type telomeric G-quadruplex is most likely to be of pharmacological relevance, and the distinct folding topology of this G-quadruplex suggests that it can be specifically targeted by G-quadruplex interactive small molecule drugs.
Collapse
Affiliation(s)
- Attila Ambrus
- College of Pharmacy, The University of Arizona1703 E. Mabel St, Tucson, AZ 85721, USA
| | - Ding Chen
- College of Pharmacy, The University of Arizona1703 E. Mabel St, Tucson, AZ 85721, USA
| | - Jixun Dai
- College of Pharmacy, The University of Arizona1703 E. Mabel St, Tucson, AZ 85721, USA
| | - Tiffanie Bialis
- Arizona Cancer Center1515 N. Campbell Avenue, Tucson, AZ 85724, USA
| | - Roger A. Jones
- Department of Chemistry and Chemical Biology, Rutgers University610 Taylor Road, Piscataway, NJ 08854, USA
| | - Danzhou Yang
- College of Pharmacy, The University of Arizona1703 E. Mabel St, Tucson, AZ 85721, USA
- Arizona Cancer Center1515 N. Campbell Avenue, Tucson, AZ 85724, USA
| |
Collapse
|
|
39
|
Cogoi S, Xodo LE. G-quadruplex formation within the promoter of the KRAS proto-oncogene and its effect on transcription. Nucleic Acids Res 2006; 34:2536-49. [PMID: 16687659 PMCID: PMC1459413 DOI: 10.1093/nar/gkl286] [Citation(s) in RCA: 596] [Impact Index Per Article: 31.4] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/12/2023] Open
Abstract
In human and mouse, the promoter of the KRAS gene contains a nuclease hypersensitive polypurine-polypyrimidine element (NHPPE) that is essential for transcription. An interesting feature of the polypurine G-rich strand of NHPPE is its ability to assume an unusual DNA structure that, according to circular dichroism (CD) and DMS footprinting experiments, is attributed to an intramolecular parallel G-quadruplex, consisting of three G-tetrads and three loops. The human and mouse KRAS NHPPE G-rich strands display melting temperature of 64 and 73 degrees C, respectively, as well as a K+-dependent capacity to arrest DNA polymerase. Photocleavage and CD experiments showed that the cationic porphyrin TMPyP4 stacks to the external G-tetrads of the KRAS quadruplexes, increasing the T(m) by approximately 20 degrees C. These findings raise the intriguing question that the G-quadruplex formed within the NHPPE of KRAS may be involved in the regulation of transcription. Indeed, transfection experiments showed that the activity of the mouse KRAS promoter is reduced to 20% of control, in the presence of the quadruplex-stabilizing TMPyP4. In addition, we found that G-rich oligonucleotides mimicking the KRAS quadruplex, but not the corresponding 4-base mutant sequences or oligonucleotides forming quadruplexes with different structures, competed with the NHPPE duplex for binding to nuclear proteins. When vector pKRS-413, containing CAT driven by the mouse KRAS promoter, and KRAS quadruplex oligonucleotides were co-transfected in 293 cells, the expression of CAT was found to be downregulated to 40% of the control. On the basis of these data, we propose that the NHPPE of KRAS exists in equilibrium between a double-stranded form favouring transcription and a folded quadruplex form, which instead inhibits transcription. Such a mechanism, which is probably adopted by other growth-related genes, provides useful hints for the rational design of anticancer drugs against the KRAS oncogene.
Collapse
Affiliation(s)
| | - Luigi E. Xodo
- To whom correspondence should be addressed. Tel: +39 0432 494395; Fax: +39 0432 494301;
| |
Collapse
|
|
40
|
Ghosal G, Muniyappa K. Hoogsteen base-pairing revisited: resolving a role in normal biological processes and human diseases. Biochem Biophys Res Commun 2006; 343:1-7. [PMID: 16540083 DOI: 10.1016/j.bbrc.2006.02.148] [Citation(s) in RCA: 36] [Impact Index Per Article: 1.9] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/16/2006] [Accepted: 02/24/2006] [Indexed: 01/21/2023]
Abstract
For a long time since the discovery of an alternative type of hydrogen bonding between adenine and thymidine, termed Hoogsteen base-pairing, its biological role remained elusive. Recent experiments provide compelling evidence that Hoogsteen base pairs manifest in a gamut of nuclear processes encompassing gene expression, replication, recombination, and telomere length maintenance. An increasing number of proteins that have been shown to bind, unwind or cleave G-quadruplexes or triplexes with high specificity underscore their biological significance. In humans, the absence of these cellular factors or their dysfunction leads to a wide spectrum of genetic diseases including cancer, neurodegenerative syndromes, and a myriad of other disorders. Thus, development of clinically useful compounds that target G-quadruplexes or triplexes, and interfere with specific cellular processes, provides considerable promise for successful and improved treatment of human diseases.
Collapse
Affiliation(s)
- Gargi Ghosal
- Department of Biochemistry, Indian Institute of Science, Bangalore 560012, India
| | | |
Collapse
|
|
41
|
Skoblov M, Shakhbazov K, Oshchepkov D, Ivanov D, Guskova A, Ivanov D, Rubtsov P, Prasolov V, Yankovsky N, Baranova A. Human RFP2 gene promoter: unique structure and unusual strength. Biochem Biophys Res Commun 2006; 342:859-66. [PMID: 16499869 PMCID: PMC1994241 DOI: 10.1016/j.bbrc.2006.01.187] [Citation(s) in RCA: 7] [Impact Index Per Article: 0.4] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/28/2006] [Accepted: 01/31/2006] [Indexed: 11/25/2022]
Abstract
Human gene RFP2 is a candidate tumor suppressor located at 13q14.3 and deleted in multiple tumor types. To explore regulation of RFP2, we determined structure of the 5'-untranslated region of RFP2 gene and its promoter. RFP2 promoter area is TATA-less, highly enriched in G and C nucleotides, and contains multiple quadruplex forming GGGGA-repeats. Deletion analysis of 5'-flanking sequences demonstrated that repeat containing fragment possesses activity seven times exceeding that of the combined SV40 promoter/enhancer. Other unusual features of the RFP2 promoter include anomalously high electrostatic fields induced by sequence-dependent dipoles and very low nucleosome forming potential. A "minimized" version of the RFP2 promoter could be used for overexpression of the various transgenes in the mammalian cells.
Collapse
Affiliation(s)
- Mikhail Skoblov
- Russian Center of Medical Genetics, Russian Academy of Medical Sciences, Moscow, Russia
- Vavilov Institute of General Genetics, Russian Academy of Science, Moscow 117 809, Russia
| | - Konstantin Shakhbazov
- Vavilov Institute of General Genetics, Russian Academy of Science, Moscow 117 809, Russia
| | - Dmitry Oshchepkov
- Institute of Cytology and Genetics SB RAS, Novosibirsk 630090, Russia
| | - Dmitry Ivanov
- Vavilov Institute of General Genetics, Russian Academy of Science, Moscow 117 809, Russia
| | - Anna Guskova
- Russian Center of Medical Genetics, Russian Academy of Medical Sciences, Moscow, Russia
- Vavilov Institute of General Genetics, Russian Academy of Science, Moscow 117 809, Russia
| | - Dmitry Ivanov
- Engelhardt Institute of Molecular Biology, 117894 Moscow, Russia
| | - Petr Rubtsov
- Engelhardt Institute of Molecular Biology, 117894 Moscow, Russia
| | | | - Nick Yankovsky
- Russian Center of Medical Genetics, Russian Academy of Medical Sciences, Moscow, Russia
| | - Ancha Baranova
- Russian Center of Medical Genetics, Russian Academy of Medical Sciences, Moscow, Russia
- Vavilov Institute of General Genetics, Russian Academy of Science, Moscow 117 809, Russia
- Molecular and Microbiology Department, CAS, George Mason University, Fairfax, VA, USA
- * Corresponding author. E-mail address: (A. Baranova)
| |
Collapse
|
|
42
|
Napoli S, Negri U, Arcamone F, Capobianco ML, Carbone GM, Catapano CV. Growth inhibition and apoptosis induced by daunomycin-conjugated triplex-forming oligonucleotides targeting the c-myc gene in prostate cancer cells. Nucleic Acids Res 2006; 34:734-44. [PMID: 16449206 PMCID: PMC1356532 DOI: 10.1093/nar/gkj473] [Citation(s) in RCA: 18] [Impact Index Per Article: 0.9] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/14/2022] Open
Abstract
Covalent attachment of intercalating agents to triplex-forming oligonucleotides (TFOs) is a promising strategy to enhance triplex stability and biological activity. We have explored the possibility to use the anticancer drug daunomycin as triplex stabilizing agent. Daunomycin-conjugated TFOs (dauno-TFOs) bind with high affinity and maintain the sequence-specificity required for targeting individual genes in the human genome. Here, we examined the effects of two dauno-TFOs targeting the c-myc gene on gene expression, cell proliferation and survival. The dauno-TFOs were directed to sequences immediately upstream (dauno-GT11A) and downstream (dauno-GT11B) the major transcriptional start site in the c-myc gene. Both dauno-TFOs were able to down-regulate promoter activity and transcription of the endogenous gene. Myc-targeted dauno-TFOs inhibited growth and induced apoptosis of prostate cancer cells constitutively expressing the gene. Daunomycin-conjugated control oligonucleotides with similar sequences had only minimal effects, confirming that the activity of dauno-TFOs was sequence-specific and triplex-mediated. To test the selectivity of dauno-TFOs, we examined their effects on growth of normal human fibroblasts, which express low levels of c-myc. Despite their ability to inhibit c-myc transcription, both dauno-TFOs failed to inhibit growth of normal fibroblasts at concentrations that inhibited growth of prostate cancer cells. In contrast, daunomycin inhibited equally fibroblasts and prostate cancer cells. Thus, daunomycin per se did not contribute to the antiproliferative activity of dauno-TFOs, although it greatly enhanced their ability to form stable triplexes at the target sites and down-regulate c-myc. Our data indicate that dauno-TFOs are attractive gene-targeting agents for development of new cancer therapeutics.
Collapse
Affiliation(s)
| | | | | | | | | | - Carlo V. Catapano
- To whom correspondence should be addressed at Oncology Institute of Southern Switzerland, 6500 Bellinzona, Switzerland. Tel: +41 91 820 0365; Fax: +41 91 820 0397;
| |
Collapse
|
|
43
|
Zhang Z, Li M, Rayburn ER, Hill DL, Zhang R, Wang H. Oncogenes as novel targets for cancer therapy (part II): Intermediate signaling molecules. ACTA ACUST UNITED AC 2005; 5:247-57. [PMID: 16078861 DOI: 10.2165/00129785-200505040-00005] [Citation(s) in RCA: 11] [Impact Index Per Article: 0.6] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 12/30/2022]
Abstract
This is the second part of a four-part review on potential therapeutic targeting of oncogenes. The previous part introduced the new technologies responsible for the advancement of oncogene identification, target validation, and drug design. Because of such advances, new specific and more efficient therapeutic agents can be developed for cancer. This part of the review continues the exploration of various oncogenes, which we have grouped within seven categories: growth factors, tyrosine kinases, intermediate signaling molecules, transcription factors, cell cycle regulators, DNA damage repair genes, and genes involved in apoptosis. Part I included a discussion of growth factors and tyrosine kinases. This portion of the review covers intermediate signaling molecules and the various strategies used to inhibit their expression or decrease their activities.
Collapse
Affiliation(s)
- Zhuo Zhang
- Department of Pharmacology and Toxicology and Division of Clinical Pharmacology, Birmingham, Alabama 35294-0019, USA
| | | | | | | | | | | |
Collapse
|
|
44
|
Rankin S, Reszka AP, Huppert J, Zloh M, Parkinson GN, Todd AK, Ladame S, Balasubramanian S, Neidle S. Putative DNA quadruplex formation within the human c-kit oncogene. J Am Chem Soc 2005; 127:10584-9. [PMID: 16045346 PMCID: PMC2195896 DOI: 10.1021/ja050823u] [Citation(s) in RCA: 472] [Impact Index Per Article: 23.6] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/01/2023]
Abstract
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.
Collapse
Affiliation(s)
- Sarah Rankin
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, UK
| | - Anthony P. Reszka
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, UK
| | - Julian Huppert
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University Chemical Laboratory, University of Cambridge, Lensfield Road, Cambridge CB2 1EW, UK
| | - Mire Zloh
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, UK
| | - Gary N. Parkinson
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, UK
| | - Alan K. Todd
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, UK
| | - Sylvain Ladame
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University Chemical Laboratory, University of Cambridge, Lensfield Road, Cambridge CB2 1EW, UK
| | - Shankar Balasubramanian
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University Chemical Laboratory, University of Cambridge, Lensfield Road, Cambridge CB2 1EW, UK
| | - Stephen Neidle
- Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, UK
- E-mail:
| |
Collapse
|
|
45
|
Abstract
Guanine-rich DNA sequences of a particular form have the ability to fold into four-stranded structures called G-quadruplexes. In this paper, we present a working rule to predict which primary sequences can form this structure, and describe a search algorithm to identify such sequences in genomic DNA. We count the number of quadruplexes found in the human genome and compare that with the figure predicted by modelling DNA as a Bernoulli stream or as a Markov chain, using windows of various sizes. We demonstrate that the distribution of loop lengths is significantly different from what would be expected in a random case, providing an indication of the number of potentially relevant quadruplex-forming sequences. In particular, we show that there is a significant repression of quadruplexes in the coding strand of exonic regions, which suggests that quadruplex-forming patterns are disfavoured in sequences that will form RNA.
Collapse
|
|
46
|
Di Giusto DA, King GC. Construction, stability, and activity of multivalent circular anticoagulant aptamers. J Biol Chem 2004; 279:46483-9. [PMID: 15322086 DOI: 10.1074/jbc.m408037200] [Citation(s) in RCA: 63] [Impact Index Per Article: 3.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/06/2022] Open
Abstract
Here we describe the design and construction of multivalent circular DNA aptamers. Four aptameric binding motifs directed at blood-borne targets are used as a model set from which larger, multidomain aptamers are constructed in a straightforward manner. Intra- or intermolecular ligation of precursor oligonucleotides provides a stabilizing mechanism against degradation by the predominant exonuclease activity of blood products without the need for post-selection chemical modification. In many cases, circular DNA aptamer half-lives are extended beyond 10 h in serum and plasma, making such constructs viable for therapeutic and diagnostic applications. Duplexes and three-way junctions are used as scaffold architectures around which two, three, or four aptameric motifs can be arranged in a structurally defined manner, giving rise to improved binding characteristics through stability and avidity gains. Circular aptamers targeted against thrombin display improved anticoagulant potency with EC50 values 2-3-fold better than those of the canonical GS-522 thrombin DNA aptamer. Intrinsic duplex regions provide an opportunity to incorporate additional transcription factor binding motifs, whereas ancillary loops can be used to provide further functionality. These anticoagulant aptamers provide a starting point for merging the principles of DNA nanotechnology with aptameric functions.
Collapse
Affiliation(s)
- Daniel A Di Giusto
- School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney NSW 2052, Australia
| | | |
Collapse
|
|
47
|
Carbone GM, Napoli S, Valentini A, Cavalli F, Watson DK, Catapano CV. Triplex DNA-mediated downregulation of Ets2 expression results in growth inhibition and apoptosis in human prostate cancer cells. Nucleic Acids Res 2004; 32:4358-67. [PMID: 15314206 PMCID: PMC514370 DOI: 10.1093/nar/gkh744] [Citation(s) in RCA: 68] [Impact Index Per Article: 3.2] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 01/11/2023] Open
Abstract
Ets2 is a member of the Ets family of transcription factors that in humans comprise 25 distinct members. Various Ets-domain transcription factors have been implicated in cancer development. Ets2 is expressed in prostate and breast cancer cells and is thought to have a role in promoting growth and survival in these cell types. However, a definitive role and the mechanisms whereby Ets2 acts in cancer cells are still unclear. Structural and functional similarities as well as overlapping DNA binding specificities complicate the identification of the specific roles of the various Ets factors. In this study, we used a triplex-forming oligonucleotide (TFO) to selectively inhibit Ets2 transcription in prostate cancer cells. We had previously shown that the Ets2-targeting TFO, which was directed to a unique purine-rich sequence critical for Ets2 promoter activity, acted with a high degree of sequence-specificity and target selectivity. TFO-mediated downregulation of Ets2 in prostate cancer cells induced important phenotypic changes, including inhibition of anchorage-dependent and anchorage -independent growth, cell cycle alterations and induction of apoptotic cell death. Expression of Ets2 under the control of a heterologous promoter abolished the anti-proliferative effects of the TFO in both short- and long-term assays, suggesting that these effects were a direct result of downregulation of Ets2 transcription and confirming target selectivity of the TFO. Furthermore, normal human fibroblasts, which expressed low levels of Ets2, were not affected by the Ets2-targeting TFO. Downregulation of Ets2 in prostate cancer cells was associated with reduced levels of the anti-apoptotic protein bcl-x(L) and growth regulatory factors cyclin D1 and c-myc. These data revealed a specific role of this transcription factor in promoting growth and survival of prostate cancer cells. Furthermore, the activity and selectivity of the Ets2-targeting TFO suggest that it might represent a valid approach to prostate cancer therapy.
Collapse
Affiliation(s)
- Giuseppina M Carbone
- Laboratory of Experimental Oncology, Oncology Institute of Southern Switzerland, Via Vela 6, 6500 Bellinzona, Switzerland.
| | | | | | | | | | | |
Collapse
|