|
1
|
Onishi S, Iwashita T, Tezuka Y, Kojima K, Takada J, Kubota M, Ibuka T, Shimizu M. Recurrence rates and risk factors in obscure gastrointestinal bleeding. DEN OPEN 2025; 5:e70011. [PMID: 39253626 PMCID: PMC11382536 DOI: 10.1002/deo2.70011] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Figures] [Subscribe] [Scholar Register] [Received: 07/17/2024] [Revised: 08/22/2024] [Accepted: 08/26/2024] [Indexed: 09/11/2024]
Abstract
Obscure gastrointestinal bleeding (OGIB), defined in 2010, involves bleeding from the GI tract that remains unexplained after standard diagnostic procedures. OGIB, which accounts for about 5% of all GI bleeds, poses diagnostic and management challenges, particularly due to the anatomical features of the small intestine. Advances in capsule endoscopy (CE) and balloon-assisted endoscopy have improved the diagnostic and therapeutic landscape for small intestinal lesions. Objective To determine the recurrence rate and identify risk factors for recurrence following diagnostic and therapeutic interventions using CE and balloon-assisted endoscopy in patients with OGIB. Methods A retrospective cohort study at Gifu University Hospital analyzed CE procedures for patients with OGIB from 2008 to 2022. Patients underwent CE with subsequent treatments based on the findings. Statistical analyses, including Kaplan-Meier and Cox proportional hazards models, were used to estimate cumulative recurrence rates and identify recurrence risk factors. Results Out of 417 patients, 65.2% had positive CE findings, leading to therapeutic interventions in 16.3% of cases. The cumulative recurrence rates at 12, 24, and 36 months were 4.3%, 9.0%, and 13.9%, respectively. Liver cirrhosis (hazard rate: 4.15, 95% confidence interval 1.88-9.18, p < 0.01) was identified as a significant risk factor for recurrence. Conclusions A significant recurrence rate in OGIB patients, with liver cirrhosis being a major risk factor. Despite diagnostic and therapeutic advances, a comprehensive approach including careful follow-up and consideration of risk factors is essential for management.
Collapse
Affiliation(s)
- Sachiyo Onishi
- First Department of Internal MedicineGifu University HospitalGifuJapan
| | - Takuji Iwashita
- First Department of Internal MedicineGifu University HospitalGifuJapan
| | - Yukari Tezuka
- First Department of Internal MedicineGifu University HospitalGifuJapan
| | - Kentaro Kojima
- First Department of Internal MedicineGifu University HospitalGifuJapan
| | - Jun Takada
- First Department of Internal MedicineGifu University HospitalGifuJapan
| | - Masaya Kubota
- First Department of Internal MedicineGifu University HospitalGifuJapan
| | - Takashi Ibuka
- First Department of Internal MedicineGifu University HospitalGifuJapan
| | - Masahito Shimizu
- First Department of Internal MedicineGifu University HospitalGifuJapan
| |
Collapse
|
|
2
|
Xiong Y, Jin R, Chen S, Liu X, Wu Z, Zhang D, Zeng C, Chen Y. Clinical value of capsule endoscopy, CT enterography and enteroscopy in the diagnosis of suspected small bowel bleeding. Surg Endosc 2025; 39:792-801. [PMID: 39578291 DOI: 10.1007/s00464-024-11405-6] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 07/22/2024] [Accepted: 11/03/2024] [Indexed: 11/24/2024]
Abstract
BACKGROUND Fewer studies have been conducted on the diagnostic value of capsule endoscopy, CT enterography and enteroscopy in suspected small bowel bleeding. This study aimed at analyzing the diagnostic and clinical value of capsule endoscopy, CT enterography and enteroscopy for suspected small bowel bleeding. METHODS This retrospective study compared the diagnostic rate and consistency of findings among groups. In addition, diagnostic rates were compared between combined enteroscopy versus uncombined enteroscopy associated with capsule endoscopy or CT enterography, as well as the influencing factors of diagnostic outcomes. The complete enteroscopy rates and diagnostic rates were analyzed for the one-day enteroscopy group and the non-one-day enteroscopy group. RESULTS There was no significant difference in diagnostic rates between capsule endoscopy (n = 70) and CT enterography (n = 122) (χ2 = 3.334; p = 0.068), while the diagnostic rate of enteroscopy (n = 396) is higher than capsule endoscopy (χ2 = 10.064; p = 0.002) and CT enterography (χ2 = 42.661; p < 0.001). Diagnostic rates were much higher in patients with a successful completion of docking inspection (n = 64) than in undocked patients (n = 60) (85.9% vs 46.7%; p < 0.001), even though these patients still had combined capsule endoscopy or CT enterography. The complete enteroscopy rates (χ2 = 0.364; P = 0.546) and diagnostic rates (χ2 = 2.511; P = 0.113) of enteroscopy in the one-day group (n = 55) were not significantly different from those in the non-one-day group (n = 25). CONCLUSIONS Enteroscopy is the more reliable method of diagnosing suspected small bowel bleeding among enteroscopy, capsule endoscopy and CT enterography. Moreover, uncompleted enteroscopy combined with capsule endoscopy or CT enterography may not yet be a substitute for successful completion of docking enteroscopy in clinical practice.
Collapse
Affiliation(s)
- Yiling Xiong
- Jiangxi Provincial Key Laboratory of Digestive Diseases, Department of Gastroenterology, Jiangxi Clinical Research Center for Gastroenterology, Digestive Disease Hospital, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, 17 Yongwaizheng Street, Nanchang, 330006, Jiangxi, China
| | - Ruiri Jin
- Jiangxi Provincial Key Laboratory of Digestive Diseases, Department of Gastroenterology, Jiangxi Clinical Research Center for Gastroenterology, Digestive Disease Hospital, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, 17 Yongwaizheng Street, Nanchang, 330006, Jiangxi, China
| | - Sheng Chen
- Jiangxi Provincial Key Laboratory of Digestive Diseases, Department of Gastroenterology, Jiangxi Clinical Research Center for Gastroenterology, Digestive Disease Hospital, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, 17 Yongwaizheng Street, Nanchang, 330006, Jiangxi, China
| | - Xingxing Liu
- Jiangxi Provincial Key Laboratory of Digestive Diseases, Department of Gastroenterology, Jiangxi Clinical Research Center for Gastroenterology, Digestive Disease Hospital, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, 17 Yongwaizheng Street, Nanchang, 330006, Jiangxi, China
| | - Zhenyu Wu
- Jiangxi Provincial Key Laboratory of Digestive Diseases, Department of Gastroenterology, Jiangxi Clinical Research Center for Gastroenterology, Digestive Disease Hospital, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, 17 Yongwaizheng Street, Nanchang, 330006, Jiangxi, China
| | - Die Zhang
- Jiangxi Provincial Key Laboratory of Digestive Diseases, Department of Gastroenterology, Jiangxi Clinical Research Center for Gastroenterology, Digestive Disease Hospital, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, 17 Yongwaizheng Street, Nanchang, 330006, Jiangxi, China
| | - Chunyan Zeng
- Department of Gastroenterology, Jiangxi Province Hospital of Integrated Chinese and Western Medicine, 90 Bayi Road, Xihu, Nanchang, Jiangxi, China.
| | - Youxiang Chen
- Jiangxi Provincial Key Laboratory of Digestive Diseases, Department of Gastroenterology, Jiangxi Clinical Research Center for Gastroenterology, Digestive Disease Hospital, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, 17 Yongwaizheng Street, Nanchang, 330006, Jiangxi, China.
| |
Collapse
|
|
3
|
Kadkhodayan KS, Irani S. Clinical applications of device-assisted enteroscopy: a comprehensive review. Gastrointest Endosc 2025:S0016-5107(25)00046-X. [PMID: 39870245 DOI: 10.1016/j.gie.2025.01.022] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 07/17/2024] [Revised: 12/27/2024] [Accepted: 01/20/2025] [Indexed: 01/29/2025]
Affiliation(s)
- Kambiz S Kadkhodayan
- Division is Gastroenterology, Center for Interventional Endoscopy, AdventHealth, Orlando, Florida, USA.
| | - Shayan Irani
- Division is Gastroenterology, Virginia Mason Hospital & Seattle Medical Center, Seattle, Washington, USA
| |
Collapse
|
|
4
|
Liu H, Zhang A, Liu H. Analysis of Factors Related to Throat Soreness After Painless Gastroscopy: A Single-Center Study. J Pain Res 2024; 17:4485-4491. [PMID: 39735660 PMCID: PMC11681810 DOI: 10.2147/jpr.s482679] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/14/2024] [Accepted: 12/18/2024] [Indexed: 12/31/2024] Open
Abstract
Introduction Throat soreness is a frequently encountered yet often underappreciated complication in patients undergoing gastroscopy. Few studies have explicitly explored the relationship between gastroscopy and throat soreness. This study aimed to review demographic data, summarize the characteristics, and investigate the influencing factors of throat soreness following gastroscopy. Methods This cross-sectional descriptive study included inpatients who underwent painless gastroscopy at The First Affiliated Hospital of Shandong First Medical University between December 2023 and January 2024. The analysis focused on patient demographics, duration of fasting before gastroscopy, the procedure's duration, the occurrence of vomiting post-gastroscopy, sore severity, and recovery time. Results A total of 254 patients underwent painless gastroscopy during the study period, and 123 patients experienced postoperative throat soreness (71 males, 52 females) with an average age of 57.2 years. When comparing the throat soreness and non-soreness groups, significant differences were noted in the duration of gastroscopy and fasting time before the examination. No statistically significant differences were observed in age, BMI, comorbidities, history of smoking, alcohol consumption, previous gastroesophageal surgery, reflux esophagitis, or post- procedure vomiting. Logistic regression analysis identified the duration of gastroscopy as a predictor of throat soreness post-procedure. Most of the patients reported resolution of throat soreness within 3 days. Discussion The findings of this study confirm that throat soreness is a common issue (the incidence was 48.4%) following gastroscopy, particularly associated with longer duration of gastroscopy. Fortunately, all instances of throat soreness resolved within a few days without the need for significant medical intervention.
Collapse
Affiliation(s)
- Haini Liu
- Department of Nursing, The First Affiliated Hospital of Shandong First Medical University & Shandong Provincial Qianfoshan Hospital, Jinan, Shandong, People’s Republic of China
| | - Ajuan Zhang
- Department of Intensive Care Unit, Qingdao Hiser Hospital Affiliated of Qingdao University (Qingdao Traditional Chinese Medicine Hospital), Qingdao, Shandong, People’s Republic of China
| | - Hongyan Liu
- Department of Nursing, The First Affiliated Hospital of Shandong First Medical University & Shandong Provincial Qianfoshan Hospital, Jinan, Shandong, People’s Republic of China
| |
Collapse
|
|
5
|
Niriella MA, Jayasena H, Withanachchi A, Premawardhena A. Mistakes in the management of iron deficiency anaemia: a narrative review. Hematology 2024; 29:2387987. [PMID: 39110847 DOI: 10.1080/16078454.2024.2387987] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/02/2024] [Accepted: 07/30/2024] [Indexed: 01/03/2025] Open
Abstract
INTRODUCTION Anaemia occurs due to an imbalance between erythrocyte production and loss. This imbalance can be due to ineffective erythropoiesis, blood loss or haemolysis. Whilst there are many causes for anaemia, iron deficiency anaemia (IDA) remains the predominant cause worldwide. AREAS COVERED There have been many updated guidelines on the management of IDA in the past few years. As the reasons for IDA are many, evaluation requires thorough analysis and focused investigations. As an asymptomatic disease in the early stages, IDA can lead to many mistakes in its management. This review highlights potential mistakes in assessing and managing IDA and recommendations to avoid them. CONCLUSION The effective management of IDA necessitates a comprehensive and multidisciplinary approach. By recognising and addressing the common mistakes highlighted in this narrative review, healthcare professionals can improve patient outcomes, minimise complications, and enhance the overall quality of care.
Collapse
Affiliation(s)
| | - Hiruni Jayasena
- Faculty of Medicine, General Sir John Kothalawala Defence University, Rathmalana, Sri Lanka
| | | | | |
Collapse
|
|
6
|
Tuck J, Lizaola-Mayo BC, Leighton JA. Deep enteroscopy - what's new and what works best? Curr Opin Gastroenterol 2024; 40:338-341. [PMID: 38662476 DOI: 10.1097/mog.0000000000001039] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 08/09/2024]
Abstract
PURPOSE OF REVIEW We aim to review the types of device-assisted deep enteroscopy endoscopes, tips for a successful procedure as well as areas for improvement. RECENT FINDINGS Deep enteroscopy allows for diagnostic and therapeutic intervention of the small bowel and can be used as an adjunct to video capsule endoscopy to improve the yield and management of small bowel lesions. SUMMARY Our top tips for deep enteroscopy success include reviewing patient history and prior imaging, utilizing CO 2 insufflation or water exchange, verifying quality measures and emphasizing ergonomics. With these, endoscopists can optimize patient outcomes while minimizing occupational risks. New aspects of deep enteroscopy equipment focus on high-resolution imaging, a larger working channel, and enhanced scope angulation. Proposed improvements include developing innovative technology to optimize the color and clarity of the high-resolution imaging, minimizing the number of staff required for the procedure, and decreasing ergonomic strain.
Collapse
Affiliation(s)
- Jaclyn Tuck
- Mayo Clinic, Division of Gastroenterology and Hepatology, Phoenix, Arizona, USA
| | | | | |
Collapse
|
|
7
|
Kou GJ, Liu C, Yu YB, Li YQ, Zuo XL. Single-operator single-balloon enteroscopy is safe and effective: A 6-year retrospective study. J Dig Dis 2024. [PMID: 39014971 DOI: 10.1111/1751-2980.13300] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Grants] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 12/01/2023] [Revised: 06/14/2024] [Accepted: 06/20/2024] [Indexed: 07/18/2024]
Abstract
OBJECTIVES Single-balloon enteroscopy (SBE) is an effective tool for the detection of small intestine lesions. Because it is conventionally performed by two operators, the efficacy of single-operator SBE method has not yet been elucidated. We aimed to evaluate the diagnostic yield, total enteroscopy rate, procedure time, and complications of single-operator SBE for small intestinal disease. METHODS This was a single-center, retrospective study including consecutive patients who underwent single-operator SBE for suspicious small intestinal disorders or required therapeutic interventions between December 2014 and January 2019. The SBE procedures were performed by four endoscopists. Diagnostic yield, total enteroscopy rate, procedure time, incubation depth, and complications were analyzed, and stratification analysis was performed. RESULTS Altogether 922 patients with 1422 SBE procedures were included for analysis, among whom 250, 172, and 500 patients underwent SBE via the oral route, the anal route and a combined route, respectively. The overall diagnostic yield was 78.52% (724/922). And 253 patients achieved total enteroscopy, with a total enteroscopy rate of 56.10%. The average procedure time for the oral and anal routes were 69.28 ± 14.72 min and 64.95 ± 13.87 min, respectively. While the incubation depth was 389.95 ± 131.42 cm and 191.81 ± 83.67 cm, respectively. Jejunal perforation was observed in one patient, which was managed by endoclips. Stratification analysis showed that the diagnostic yield and total enteroscopy rate significantly increased with operation experience together with decreased procedure time. CONCLUSION Single-operator SBE is effective and safe for the detection of small intestinal lesions, and is easy to master.
Collapse
Affiliation(s)
- Guan Jun Kou
- Department of Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
- Laboratory of Translational Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
- Robot Engineering Laboratory for Precise Diagnosis and Therapy of GI Tumor, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
| | - Chao Liu
- Department of Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
- Laboratory of Translational Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
- Robot Engineering Laboratory for Precise Diagnosis and Therapy of GI Tumor, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
| | - Yan Bo Yu
- Department of Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
- Laboratory of Translational Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
- Robot Engineering Laboratory for Precise Diagnosis and Therapy of GI Tumor, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
| | - Yan Qing Li
- Department of Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
- Laboratory of Translational Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
- Robot Engineering Laboratory for Precise Diagnosis and Therapy of GI Tumor, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
| | - Xiu Li Zuo
- Department of Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
- Laboratory of Translational Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
- Robot Engineering Laboratory for Precise Diagnosis and Therapy of GI Tumor, Qilu Hospital of Shandong University, Jinan, Shandong Province, China
| |
Collapse
|
|
8
|
He K, Pang K, Yan X, Wang Q, Wu D. New sights in ectopic varices in portal hypertension. QJM 2024; 117:397-412. [PMID: 38321102 DOI: 10.1093/qjmed/hcae026] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 11/06/2023] [Revised: 01/31/2024] [Indexed: 02/08/2024] Open
Abstract
Ectopic varices and associated bleeding, although rare, pose a significant risk to patients with portal hypertension, carrying a relatively high mortality rate. These varices can occur in various anatomical regions, excluding the gastroesophageal region, which is typically associated with portal vein drainage. The limited data available in the literature, derived mostly from case reports and series, make the diagnosis and treatment of ectopic variceal bleeding particularly challenging. Furthermore, it is crucial to recognize that ectopic varices in different sites can exhibit variations in key decision-making factors such as aetiology and vascular anatomy, severity and bleeding risk and hepatic reserve. These factors significantly influence treatment strategies and underscore the importance of adopting individualized management approaches. Therefore, the objective of this review is to provide a comprehensive overview of the fundamental knowledge surrounding ectopic varices and to propose site-oriented, stepwise diagnosis and treatment algorithms for this complex clinical issue. A multidisciplinary treatment approach is strongly recommended in managing ectopic varices. In addition, to enhance clinical reference, we have included typical case reports of ectopic varices in various sites in our review, while being mindful of potential publication bias.
Collapse
Affiliation(s)
- K He
- State Key Laboratory of Complex Severe and Rare Diseases, Department of Gastroenterology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China
| | - K Pang
- Peking Union Medical College, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100730, China
| | - X Yan
- Peking Union Medical College, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100730, China
| | - Q Wang
- State Key Laboratory of Complex Severe and Rare Diseases, Department of Gastroenterology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China
| | - D Wu
- State Key Laboratory of Complex Severe and Rare Diseases, Department of Gastroenterology, Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China
| |
Collapse
|
|
9
|
Ye YC, Sung KY, Chang TE, Wu PS, Wang YP, Luo JC, Hou MC, Lu CL. Early double-balloon enteroscopy was not related to better clinical outcomes in patients with suspected overt small bowel bleeding. J Chin Med Assoc 2024; 87:377-383. [PMID: 38335460 DOI: 10.1097/jcma.0000000000001067] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 02/12/2024] Open
Abstract
BACKGROUND Device-assisted enteroscopy has been used for over 20 years for the management of patients with suspected small bowel bleeding. Unlike esophagogastroduodenoscopy and colonoscopy, the appropriate timing of enteroscopy is still unknown. In recent guidelines, early enteroscopy is suggested to maximize diagnostic yield and therapeutic yield in patients with suspected small bowel bleeding. However, few studies have identified its influence on clinical outcomes, including mortality or rebleeding rate. We conducted this study to evaluate the influence of the timing of double-balloon enteroscopy on clinical outcomes in patients with suspected small bowel bleeding. METHODS Patients with overt small bowel bleeding who underwent double-balloon enteroscopy from January 2013 to February 2021 were retrospectively reviewed. Patients were categorized into an early enteroscopy group (≤14 days) and a nonearly enteroscopy group (>14 days). Clinical outcomes, including short-term mortality and rebleeding rate, long-term mortality and rebleeding rate, diagnostic yield, and therapeutic yield, were analyzed. RESULTS A total of 100 patients (mean age, 66.2 years; 53% male) were included, and 44 patients were stratified into the early enteroscopy group. The diagnostic yield, therapeutic yield, mortality, and rebleeding rate were similar between two groups. In multivariate conditional logistic regression analysis, there were no significant differences between two groups regarding the 30-day rebleeding rate (adjusted odds ratio [aOR], 1.43; 95% CI, 0.47-4.33), 90-day rebleeding rate (aOR, 1.18; 95% CI, 0.47-2.94), 30-day mortality rate (aOR, 1.29; 95% CI, 0.21-8.13), 90-day mortality rate (aOR, 1.94; 95% CI, 0.48-7.87), and 90-day bleeding-related mortality (aOR, 2.18; 95% CI, 0.24-19.52). The Kaplan-Meier survival curve analysis showed that the timing of DBE was not associated with the long-term rebleeding rate or mortality rate ( p = 0.57 and 0.83, respectively). CONCLUSION The timing of enteroscopy did not influence the clinical outcomes, including the short-term mortality rate, short-term rebleeding rate, long-term mortality rate, and rebleeding rate, in patients with suspected overt small bowel bleeding.
Collapse
Affiliation(s)
- Yong-Cheng Ye
- Endoscopy Center For Diagnosis and Treatment, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Division of Gastroenterology, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Faculty of Medicine, School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC
| | - Kuan-Yi Sung
- Endoscopy Center For Diagnosis and Treatment, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Division of Gastroenterology, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Faculty of Medicine, School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC
| | - Tien-En Chang
- Endoscopy Center For Diagnosis and Treatment, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Division of Gastroenterology, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Faculty of Medicine, School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC
| | - Pei-Shan Wu
- Endoscopy Center For Diagnosis and Treatment, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Division of Gastroenterology, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Faculty of Medicine, School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC
| | - Yen-Po Wang
- Endoscopy Center For Diagnosis and Treatment, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Division of Gastroenterology, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Faculty of Medicine, School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC
- Institute of Brain Science, School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC
| | - Jiing-Chyuan Luo
- Division of Gastroenterology, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Faculty of Medicine, School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC
| | - Ming-Chih Hou
- Endoscopy Center For Diagnosis and Treatment, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Division of Gastroenterology, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Faculty of Medicine, School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC
| | - Ching-Liang Lu
- Endoscopy Center For Diagnosis and Treatment, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Division of Gastroenterology, Department of Medicine, Taipei Veterans General Hospital, Taipei, Taiwan, ROC
- Faculty of Medicine, School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC
- Institute of Brain Science, School of Medicine, National Yang Ming Chiao Tung University, Taipei, Taiwan, ROC
| |
Collapse
|
|
10
|
Singeap AM, Sfarti C, Minea H, Chiriac S, Cuciureanu T, Nastasa R, Stanciu C, Trifan A. Small Bowel Capsule Endoscopy and Enteroscopy: A Shoulder-to-Shoulder Race. J Clin Med 2023; 12:7328. [PMID: 38068379 PMCID: PMC10707315 DOI: 10.3390/jcm12237328] [Citation(s) in RCA: 3] [Impact Index Per Article: 1.5] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/17/2023] [Revised: 11/17/2023] [Accepted: 11/24/2023] [Indexed: 01/11/2025] Open
Abstract
Traditional methods have their limitations when it comes to unraveling the mysteries of the small bowel, an area historically seen as the "black box" of the gastrointestinal tract. This is where capsule endoscopy and enteroscopy have stepped in, offering a remarkable synergy that transcends the sum of their individual capabilities. From their introduction, small bowel capsule endoscopy and device-assisted enteroscopy have consistently evolved and improved, both on their own and interdependently. Each technique's history may be told as a success story, and their interaction has revolutionized the approach to the small bowel. Both have advantages that could be ideally combined into a perfect technique: safe, non-invasive, and capable of examining the entire small bowel, taking biopsies, and applying therapeutical interventions. Until the realization of this perfect tool becomes a reality, the key for an optimal approach lies in the right selection of exploration method. In this article, we embark on a journey through the intertwined development of capsule endoscopy and enteroscopy, exploring the origins, technological advancements, clinical applications, and evolving inquiries that have continually reshaped the landscape of small bowel imaging.
Collapse
Affiliation(s)
- Ana-Maria Singeap
- Department of Gastroenterology, Faculty of Medicine, “Grigore T. Popa” University of Medicine and Pharmacy, 700115 Iasi, Romania; (A.-M.S.); (C.S.); (S.C.); (T.C.); (R.N.); (C.S.); (A.T.)
- Institute of Gastroenterology and Hepatology, “St. Spiridon” University Hospital, 700111 Iasi, Romania
| | - Catalin Sfarti
- Department of Gastroenterology, Faculty of Medicine, “Grigore T. Popa” University of Medicine and Pharmacy, 700115 Iasi, Romania; (A.-M.S.); (C.S.); (S.C.); (T.C.); (R.N.); (C.S.); (A.T.)
- Institute of Gastroenterology and Hepatology, “St. Spiridon” University Hospital, 700111 Iasi, Romania
| | - Horia Minea
- Department of Gastroenterology, Faculty of Medicine, “Grigore T. Popa” University of Medicine and Pharmacy, 700115 Iasi, Romania; (A.-M.S.); (C.S.); (S.C.); (T.C.); (R.N.); (C.S.); (A.T.)
- Institute of Gastroenterology and Hepatology, “St. Spiridon” University Hospital, 700111 Iasi, Romania
| | - Stefan Chiriac
- Department of Gastroenterology, Faculty of Medicine, “Grigore T. Popa” University of Medicine and Pharmacy, 700115 Iasi, Romania; (A.-M.S.); (C.S.); (S.C.); (T.C.); (R.N.); (C.S.); (A.T.)
- Institute of Gastroenterology and Hepatology, “St. Spiridon” University Hospital, 700111 Iasi, Romania
| | - Tudor Cuciureanu
- Department of Gastroenterology, Faculty of Medicine, “Grigore T. Popa” University of Medicine and Pharmacy, 700115 Iasi, Romania; (A.-M.S.); (C.S.); (S.C.); (T.C.); (R.N.); (C.S.); (A.T.)
- Institute of Gastroenterology and Hepatology, “St. Spiridon” University Hospital, 700111 Iasi, Romania
| | - Robert Nastasa
- Department of Gastroenterology, Faculty of Medicine, “Grigore T. Popa” University of Medicine and Pharmacy, 700115 Iasi, Romania; (A.-M.S.); (C.S.); (S.C.); (T.C.); (R.N.); (C.S.); (A.T.)
- Institute of Gastroenterology and Hepatology, “St. Spiridon” University Hospital, 700111 Iasi, Romania
| | - Carol Stanciu
- Department of Gastroenterology, Faculty of Medicine, “Grigore T. Popa” University of Medicine and Pharmacy, 700115 Iasi, Romania; (A.-M.S.); (C.S.); (S.C.); (T.C.); (R.N.); (C.S.); (A.T.)
- Institute of Gastroenterology and Hepatology, “St. Spiridon” University Hospital, 700111 Iasi, Romania
| | - Anca Trifan
- Department of Gastroenterology, Faculty of Medicine, “Grigore T. Popa” University of Medicine and Pharmacy, 700115 Iasi, Romania; (A.-M.S.); (C.S.); (S.C.); (T.C.); (R.N.); (C.S.); (A.T.)
- Institute of Gastroenterology and Hepatology, “St. Spiridon” University Hospital, 700111 Iasi, Romania
| |
Collapse
|
|
11
|
Low CS, Rao N. Imaging of Gastrointestinal Bleeding: An Update. Semin Nucl Med 2023; 53:766-776. [PMID: 37451934 DOI: 10.1053/j.semnuclmed.2023.06.002] [Citation(s) in RCA: 3] [Impact Index Per Article: 1.5] [Reference Citation Analysis] [Abstract] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 05/18/2023] [Revised: 06/07/2023] [Accepted: 06/09/2023] [Indexed: 07/18/2023]
Abstract
Imaging of gastrointestinal bleeding crucial in the diagnosis of occult gastrointestinal bleeding. Gastrointestinal bleeding scintigraphy is a well-established study to aid localisation of gastrointestinal bleeding site. This article discusses about the use of gastrointestinal bleeding scintigraphy in its current practice with emphasis on radiopharmaceutical, imaging techniques, interpretation and pitfalls. There is also discussion on the use of Single Photon Emission Computed Tomography-Computed Tomography (SPECT-CT) within this method of scintigraphy. Meckel's diverticulum is known to be a frequent source of bleeding, mainly in children. It is also know that nuclear medicine imaging can help with Meckel's diverticulum identification. This article also discusses about the technique, imaging, interpretation and SPECT-CT usage for Meckel's diverticulum imaging.
Collapse
Affiliation(s)
- Chen Sheng Low
- University Hospitals Coventry and Warwickshire NHS Trust, Coventry, United Kingdom.
| | - Nikhil Rao
- University Hospitals Coventry and Warwickshire NHS Trust, Coventry, United Kingdom
| |
Collapse
|
|
12
|
Wang Y, Ma B, Li W, Li P. Effectiveness and safety of novel motorized spiral enteroscopy: a systematic review and meta-analysis. Surg Endosc 2023; 37:6998-7011. [PMID: 37349592 DOI: 10.1007/s00464-023-10179-7] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 02/23/2023] [Accepted: 05/30/2023] [Indexed: 06/24/2023]
Abstract
BACKGROUND Motorized spiral enteroscopy (MSE) is a novel advance in small bowel examination that is characterized as fast with a deep insertion. The aim of this study was to elucidate the effectiveness and safety of MSE. METHODS Relevant articles that were published before November 1, 2022 were identified by searching PubMed, EMBASE, Cochrane, and the Web of Science. The technical success rate (TSR), total (pan)-enteroscopy rate (TER), depth of maximum insertion (DMI), diagnostic yield, and adverse events were extracted and analyzed. Forest plots were graphed based on random effects models. RESULTS A total of 876 patients from 8 studies were eligible for analysis. The pooled results of the TSR were 95.0% [95% confidence interval (CI) 91.0-98.0%, I2 = 78%, p < 0.01] and the pooled outcome of the TER was 43.1% (95% CI 24.7-62.5%, I2 = 95%, p < 0.01). The pooled results of the diagnostic and therapeutic yields were 77.2% (95% CI 69.0-84.5%, I2 = 84%, p < 0.01) and 49.0% (95% CI 38.0-60.1%, I2 = 89%, p < 0.01), respectively. The pooled estimates of adverse and severe adverse events were 17.2% (95% CI 11.9-23.2%, I2 = 75%, p < 0.01) and 0.7% (95% CI 0.0-2.1%, I2 = 37%, p = 0.13), respectively. CONCLUSION MSE is a novel alternative approach for small bowel examination that can achieve high TER and diagnostic and therapeutic yields, and relatively low rates of severe adverse events. Head-to-head studies comparing MSE and other device-assisted enteroscopies are warranted.
Collapse
Affiliation(s)
- Yizi Wang
- Department of Obstetrics and Gynecology, Shengjing Hospital of China Medical University, No. 36, Sanhao Street, Heping District, Shenyang, 110004, China
| | - Bin Ma
- Department of Colorectal Surgery, Liaoning Cancer Hospital and Institute, Cancer Hospital of China Medical University, No. 44 Xiaoheyan Road, Dadong District, Shenyang, 110042, Liaoning Province, People's Republic of China
| | - Wenya Li
- Department of Thoracic Surgery, The First Hospital of China Medical University, No.155 North Nanjing Street, Shenyang, 110001, People's Republic of China
| | - Peiwen Li
- Department of Thoracic Surgery, The First Hospital of China Medical University, No.155 North Nanjing Street, Shenyang, 110001, People's Republic of China.
| |
Collapse
|
|
13
|
Boullier M, Fohlen A, Viennot S, Alves A. Gastrointestinal bleeding of undetermined origin: What diagnostic strategy to propose? J Visc Surg 2023:S1878-7886(23)00089-9. [PMID: 37344277 DOI: 10.1016/j.jviscsurg.2023.05.006] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 06/23/2023]
Abstract
Gastrointestinal bleeding of undetermined origin (GBUO) is defined as gastrointestinal bleeding without an identified cause or location despite an endoscopic assessment including an esogastroduodenal endoscopy (EOGD) and a total colonoscopy. A distinction is made between exteriorized GBUO and non-exteriorized occult GBUO. The causes in the majority of cases (vascular, inflammatory and tumoral) are located in the small intestine. The diagnostic strategy aiming to locate the origin of the GBUO is a real challenge. Innovation in endoscopic and imaging techniques has enabled minimally invasive exploration of the small intestine. In Europe, there is a strong consensus to recommend a video-capsule endoscopy (VCE) as the first-intention study. If there is reason to suspect intestinal obstruction, VCE is contraindicated and a CT-enteroscopy is then performed as first intention. Enteroscopy is performed as a second-line treatment, either for therapeutic purposes after a positive VCE or CT-enteroclysis, or for diagnostic purposes after a negative VCE. Finally, intraoperative enteroscopy (IOE) coupled with surgical exploration should be reserved either for therapeutic purposes in the event of impossibility or failure of preoperative enteroscopy, or for diagnostic purposes in the event of recurrent GBUO after failure of all other studies and explorations of the small intestine.
Collapse
Affiliation(s)
- Mathilde Boullier
- Digestive surgery department, university hospital center, avenue de la Côte-de-Nacre, 14000 Caen, France.
| | - Audrey Fohlen
- Uro-digestive imaging and interventional radiology department, university hospital center, 14000 Caen, France; Équipe CERVOxy, ISTCT UMR 6030-CNRS, CEA, Caen Normandie University, GIP Cycéron, 14074 Caen cedex, France
| | - Stéphanie Viennot
- Gastroenterology department, university hospital center, 14000 Caen, France
| | - Arnaud Alves
- Digestive surgery department, university hospital center, avenue de la Côte-de-Nacre, 14000 Caen, France; Inserm 1086 "ANTICIPE" Unit, Centre François-Baclesse "Cancers & Préventions", 14076 Caen cedex, France
| |
Collapse
|
|
14
|
Gorji L, Albrecht P. Hamartomatous polyps: Diagnosis, surveillance, and management. World J Gastroenterol 2023; 29:1304-1314. [PMID: 36925460 PMCID: PMC10011967 DOI: 10.3748/wjg.v29.i8.1304] [Citation(s) in RCA: 9] [Impact Index Per Article: 4.5] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Download PDF] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 09/13/2022] [Revised: 12/08/2022] [Accepted: 02/16/2023] [Indexed: 02/28/2023] Open
Abstract
Hereditary polyposis syndrome can be divided into three categories: Ade-nomatous, serrated, and hamartomatous polyps. Hamartomatous polyps, malformations of normal tissue presenting in a disorganized manner, are characterized by an autosomal dominant inheritance pattern. These syndromes exhibit hamartomatous gastrointestinal polyps in conjunction to extra-intestinal manifestations, which require conscientious and diligent monitoring. Peutz-Jeghers syndrome, Cowden syndrome, and juvenile polyposis syndrome are the most common displays of hamartomatous polyposis syndrome (HPS). Diagnosis can be pursued with molecular testing and endoscopic sampling. Early identification of these autosomal dominant pathologies allows to optimize malignancy sur-veillance, which helps reduce morbidity and mortality in both the affected patient population as well as at-risk family members. Endoscopic surveillance is an important pillar of prognosis and monitoring, with many patients eventually requiring surgical intervention. In this review, we discuss the diagnosis, surveillance, and management of HPS.
Collapse
Affiliation(s)
- Leva Gorji
- Department of Surgery, Kettering Health Dayton, Dayton, OH 45405, United States
| | - Peter Albrecht
- Department of Surgery, Kettering Health Dayton, Dayton, OH 45405, United States
| |
Collapse
|
|
15
|
Saunders H, Ghoz H, Cortes P, Alsafi W, Mzaik O, Ciofoaia V, Kroner P, Rodriguez A, Kesler A, Koralewski A, Crawford M, Lukens F, Stark M, Brahmbhatt B, Stancampiano F. Factors That Influence the Speed and Completion of Double Balloon Enteroscopy in Patients with Arteriovenous Malformations. Dig Dis Sci 2023; 68:173-180. [PMID: 35536399 DOI: 10.1007/s10620-022-07528-2] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 09/20/2021] [Accepted: 04/04/2022] [Indexed: 02/01/2023]
Abstract
BACKGROUND Double balloon enteroscopy remains a resource and time-intensive procedure that is not available in many endoscopy units. AIMS We aimed to identify variables impacting the speed and completion of double balloon enteroscopy. METHODS We retrospectively reviewed 550 patients. Using a mean time and distance for both the antegrade and retrograde approach, we determined the procedure speed and assessed factors that influenced it. In addition, we assessed the factors that contributed to a complete double balloon enteroscopy. RESULTS A total of 386 antegrade and 164 retrograde double balloon enteroscopies were performed. Greater than 10 AVMs requiring treatment was a negative predictor (AOR 0.25, CI 0.11-0.51, p < 0.001), whereas age greater than 60 years (AOR 2.66, CI 1.18-6.65, p = 0.025) was a positive predictor of a fast antegrade enteroscopy. For retrograde, prior abdominal surgery was the only factor that trended to significance (AOR 0.38, CI 0.14-0.99, p = 0.052). A total of 120 combined procedures were performed. Female gender (AOR 2.62, CI 1.16-6.24, p = 0.02), history of prior abdominal surgery (AOR 0.31, CI 0.13-0.70, p = 0.006) and Boston bowel pre-preparation score of greater than 6 (AOR 4.50, CI 1.59-14.30, p = 0.006) were the only significant predictors of a complete procedure. CONCLUSION By applying double balloon enteroscopy speed, a novel method of measuring procedure efficiency, we were able to more reliably identify the factors that will negatively impact the speed and success of the procedure.
Collapse
Affiliation(s)
- Hollie Saunders
- Department of Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL, 32224, USA.
| | - Hassan Ghoz
- Division of Gastroenterology and Hepatology, Mayo Clinic, Jacksonville, FL, USA
| | - Pedro Cortes
- Department of Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL, 32224, USA
| | - Wail Alsafi
- Department of Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL, 32224, USA
| | - Obaie Mzaik
- Division of Gastroenterology and Hepatology, Mayo Clinic, Jacksonville, FL, USA
| | - Victor Ciofoaia
- Division of Gastroenterology and Hepatology, Mayo Clinic, Jacksonville, FL, USA
| | - Paul Kroner
- Division of Gastroenterology and Hepatology, Mayo Clinic, Jacksonville, FL, USA
| | - Andrea Rodriguez
- Division of Gastroenterology and Hepatology, Mayo Clinic, Jacksonville, FL, USA
| | - Alex Kesler
- Department of Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL, 32224, USA
| | - Andrea Koralewski
- Clinical Research Internship Study Program, Mayo Clinic, Jacksonville, FL, USA
| | - Matthew Crawford
- Clinical Research Internship Study Program, Mayo Clinic, Jacksonville, FL, USA
| | - Frank Lukens
- Division of Gastroenterology and Hepatology, Mayo Clinic, Jacksonville, FL, USA
| | - Mark Stark
- Division of Gastroenterology and Hepatology, Mayo Clinic, Jacksonville, FL, USA
| | - Bhaumik Brahmbhatt
- Division of Gastroenterology and Hepatology, Mayo Clinic, Jacksonville, FL, USA
| | - Fernando Stancampiano
- Department of Medicine, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL, 32224, USA
| |
Collapse
|
|
16
|
Quality indicators for capsule endoscopy and deep enteroscopy. Gastrointest Endosc 2022; 96:693-711. [PMID: 36175176 DOI: 10.1016/j.gie.2022.08.039] [Citation(s) in RCA: 6] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 08/31/2022] [Accepted: 08/31/2022] [Indexed: 12/11/2022]
Abstract
BACKGROUND AND AIMS Capsule endoscopy (CE) and deep enteroscopy (DE) can be useful for diagnosing and treating suspected small-bowel disease. Guidelines and detailed recommendations exist for the use of CE/DE, but comprehensive quality indicators are lacking. The goal of this task force was to develop quality indicators for appropriate use of CE/DE by using a modified RAND/UCLA Appropriateness Method. METHODS An expert panel of 7 gastroenterologists with diverse practice experience was assembled to identify quality indicators. A literature review was conducted to develop a list of proposed quality indicators applicable to preprocedure, intraprocedure, and postprocedure periods. The panelists reviewed the literature; identified and modified proposed quality indicators; rated them on the basis of scientific evidence, validity, and necessity; and determined proposed performance targets. Agreement and consensus with the proposed indicators were verified using the RAND/UCLA Appropriateness Method. RESULTS The voting procedure to prioritize metrics emphasized selecting measures to improve quality and overall patient care. Panelists rated indicators on the perceived appropriateness and necessity for clinical practice. After voting and discussion, 2 quality indicators ranked as inappropriate or uncertain were excluded. Each quality indicator was categorized by measure type, performance target, and summary of evidence. The task force identified 13 quality indicators for CE and DE. CONCLUSIONS Comprehensive quality indicators have not existed for CE or DE. The task force identified quality indicators that can be incorporated into clinical practice. The panel also addressed existing knowledge gaps and posed research questions to better inform future research and quality guidelines for these procedures.
Collapse
|
|
17
|
Abstract
INTRODUCTION Capsule endoscopy (CE) and deep enteroscopy (DE) can be useful for diagnosing and treating suspected small-bowel disease. Guidelines and detailed recommendations exist for the use of CE/DE, but comprehensive quality indicators are lacking. The goal of this task force was to develop quality indicators for appropriate use of CE/DE by using a modified RAND/UCLA Appropriateness Method. METHODS An expert panel of 7 gastroenterologists with diverse practice experience was assembled to identify quality indicators. A literature review was conducted to develop a list of proposed quality indicators applicable to preprocedure, intraprocedure, and postprocedure periods. The panelists reviewed the literature; identified and modified proposed quality indicators; rated them on the basis of scientific evidence, validity, and necessity; and determined proposed performance targets. Agreement and consensus with the proposed indicators were verified using the RAND/UCLA Appropriateness Method. RESULTS The voting procedure to prioritize metrics emphasized selecting measures to improve quality and overall patient care. Panelists rated indicators on the perceived appropriateness and necessity for clinical practice. After voting and discussion, 2 quality indicators ranked as inappropriate or uncertain were excluded. Each quality indicator was categorized by measure type, performance target, and summary of evidence. The task force identified 13 quality indicators for CE and DE. DISCUSSION Comprehensive quality indicators have not existed for CE or DE. The task force identified quality indicators that can be incorporated into clinical practice. The panel also addressed existing knowledge gaps and posed research questions to better inform future research and quality guidelines for these procedures.
Collapse
|
|
18
|
Tapaskar N, Genere JR, Prachand VN, Semrad CE. Superior outcomes with double-balloon enteroscopy for small bowel lesion marking followed by intracorporeal as opposed to extracorporeal resection and reconstruction. Surg Endosc 2022; 36:3227-3233. [PMID: 34287705 DOI: 10.1007/s00464-021-08632-6] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/06/2020] [Accepted: 07/05/2021] [Indexed: 10/20/2022]
Abstract
BACKGROUND Double-balloon enteroscopy (DBE) is used for the diagnosis and therapy of small bowel disease. Endoscopic sampling and marking small bowel lesions destined for surgery permit intracorporeal resection and reconstruction (IRR), thereby facilitating a complete minimally invasive technique. There are limited data that compare outcomes of IRR to conventional extracorporeal resection and reconstruction (ERR). The purpose of this study was to evaluate the surgical outcomes of patients undergoing pre-operative DBE for lesion marking followed by laparoscopic IRR compared to those undergoing ERR. METHODS A retrospective chart review was performed on patients who underwent DBE followed by small bowel resection from 2006 to 2017 at a single tertiary care medical center. IRR was defined as laparoscopic inspection to identify the lesion (previously marked by DBE or by laparoscopic-assisted DBE) followed by intra-abdominal bowel resection and anastomosis with specimen extraction via minimal extension of a laparoscopic port site. ERR was defined as extracorporeal resection and/or reconstruction performed via a conventional or mini-laparotomy abdominal incision. RESULTS A total of 82 patients met inclusion criteria and were reviewed. Thirty-two patients (39%) had ERR and 50 patients (61%) had IRR. The most common indications for DBE were small bowel bleeding (76%) and small bowel mass or thickening on prior imaging studies (16%). Successful DBE was higher in the IRR group when compared to the ERR group, but not significantly different (90% vs 75%, p-value 0.07). Patients who underwent IRR had faster bowel function recovery (2 vs 4 days, p < 0.01), shorter time to discharge (3 vs 7 days, p < 0.01), and fewer post-operative complications (10 vs 18; p < 0.01), when compared to the ERR group. CONCLUSION DBE successfully facilitated laparoscopic small bowel IRR and this approach was associated with faster return of bowel function, shorter recovery time, and decreased morbidity when compared to ERR.
Collapse
Affiliation(s)
- Natalie Tapaskar
- Department of Medicine, The University of Chicago, Chicago, USA.
- University of Chicago Medical Center, 5841 S Maryland Avenue, MC 4076, Chicago, IL, 60637, USA.
| | - Juan Reyes Genere
- Division of Gastroenterology, Washington University School of Medicine in St. Louis, St. Louis, USA
| | | | - Carol E Semrad
- Department of Medicine, The University of Chicago, Chicago, USA
- Section of Gastroenterology Hepatology and Nutrition, The University of Chicago, Chicago, USA
| |
Collapse
|
|
19
|
Kim Y, Kim JH, Kang EA, Park SJ, Park JJ, Cheon JH, Kim TI, Park J, Jeon SR. Rebleeding Rate and Risk Factors for Rebleeding after Device-Assisted Enteroscopy in Patients with Obscure Gastrointestinal Bleeding: A KASID Multicenter Study. Diagnostics (Basel) 2022; 12:diagnostics12040954. [PMID: 35454002 PMCID: PMC9027880 DOI: 10.3390/diagnostics12040954] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/02/2022] [Revised: 04/01/2022] [Accepted: 04/10/2022] [Indexed: 11/16/2022] Open
Abstract
Introduction: The impact of device-assisted enteroscopy (DAE) on long-term rebleeding in patients with obscure gastrointestinal bleeding (OGIB) exhibiting detectable small-bowel lesions remains unclear. We investigated the long-term rebleeding rate and predictive factors for DAE in patients with OGIB. Method: Patients with OGIB with small bowel lesions detected through DAE were enrolled at three Korean tertiary hospitals. Predictive risk factors associated with rebleeding were analyzed using the Cox regression analysis. Results: From April 2008 to April 2021, 141 patients were enrolled, including 38 patients (27.0%) with rebleeding. The rebleeding rates at 1, 2, and 3 years were 25.0%, 29.6%, and 31.1%, respectively. The Cox regression analysis revealed that multiple small-bowel lesions (hazard ratio [HR]: 2.551, 95% confidence interval [CI]: 1.157–5.627, p = 0.020), the need for more than five packed red blood cells (RBC) transfusions (HR: 2.704, 95% CI: 1.412–5.181, p = 0.003), and ulcerative lesions (HR: 1.992, 95% CI: 1.037–3.826, p = 0.039) were positively associated with rebleeding. Therapeutic interventions for patients with detectable lesions, overt bleeding (vs. occult bleeding), comorbidities, and medications were not associated with rebleeding. Conclusion: More than 25% of patients with OGIB having detectable small-bowel lesions had rebleeding. Patients with multiple lesions, a requirement of more than five packed RBC transfusions, and ulcerative lesions were associated with a higher risk of rebleeding.
Collapse
Affiliation(s)
- Yuna Kim
- Department of Internal Medicine and Institute of Gastroenterology, Yonsei University College of Medicine, Seoul 03722, Korea; (Y.K.); (E.-A.K.); (S.-J.P.); (J.-J.P.); (J.-H.C.); (T.-I.K.)
| | - Jae-Hyun Kim
- Division of Gastroenterology, Department of Internal Medicine, Kosin University College of Medicine, Busan 49267, Korea;
| | - Eun-Ae Kang
- Department of Internal Medicine and Institute of Gastroenterology, Yonsei University College of Medicine, Seoul 03722, Korea; (Y.K.); (E.-A.K.); (S.-J.P.); (J.-J.P.); (J.-H.C.); (T.-I.K.)
| | - Soo-Jung Park
- Department of Internal Medicine and Institute of Gastroenterology, Yonsei University College of Medicine, Seoul 03722, Korea; (Y.K.); (E.-A.K.); (S.-J.P.); (J.-J.P.); (J.-H.C.); (T.-I.K.)
| | - Jae-Jun Park
- Department of Internal Medicine and Institute of Gastroenterology, Yonsei University College of Medicine, Seoul 03722, Korea; (Y.K.); (E.-A.K.); (S.-J.P.); (J.-J.P.); (J.-H.C.); (T.-I.K.)
| | - Jae-Hee Cheon
- Department of Internal Medicine and Institute of Gastroenterology, Yonsei University College of Medicine, Seoul 03722, Korea; (Y.K.); (E.-A.K.); (S.-J.P.); (J.-J.P.); (J.-H.C.); (T.-I.K.)
| | - Tae-Il Kim
- Department of Internal Medicine and Institute of Gastroenterology, Yonsei University College of Medicine, Seoul 03722, Korea; (Y.K.); (E.-A.K.); (S.-J.P.); (J.-J.P.); (J.-H.C.); (T.-I.K.)
| | - Jihye Park
- Department of Internal Medicine and Institute of Gastroenterology, Yonsei University College of Medicine, Seoul 03722, Korea; (Y.K.); (E.-A.K.); (S.-J.P.); (J.-J.P.); (J.-H.C.); (T.-I.K.)
- Correspondence: (J.P.); (S.-R.J.)
| | - Seong-Ran Jeon
- Institute for Digestive Research, Digestive Disease Center, Soonchunhyang University College of Medicine, Seoul 04401, Korea
- Correspondence: (J.P.); (S.-R.J.)
| |
Collapse
|
|
20
|
Lu L, Yang C, He T, Bai X, Fan M, Yin Y, Wan P, Tang H. Single-centre empirical analysis of double-balloon enteroscopy in the diagnosis and treatment of small bowel diseases: A retrospective study of 466 cases. Surg Endosc 2022; 36:7503-7510. [PMID: 35286470 DOI: 10.1007/s00464-022-09179-w] [Citation(s) in RCA: 5] [Impact Index Per Article: 1.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/10/2021] [Accepted: 02/25/2022] [Indexed: 11/29/2022]
Abstract
BACKGROUND AND OBJECTIVE The diagnosis and treatment of small bowel diseases (SBDs) has always been a challenge. The purpose of this study was to evaluate the value of double-balloon enteroscopy (DBE) in the diagnosis and treatment of small bowel diseases. METHOD The clinical data of 466 patients who underwent double-balloon enteroscopy (DBE) in the Endoscope Center of Gastroenterology Department of the First People's Hospital of Yunnan Province from Jan. 2015 to Dec. 2020 were analysed retrospectively. The factors included age, sex, indications, endoscopic treatment results, pathological results, discharge diagnosis and so on. RESULTS A total of 370 patients underwent 466 double-balloon enteroscopies, among whom 274 underwent one examination and 96 received two-way examinations (oral and transanal approaches). Abnormalities were detected in 299 cases, with a detection rate of 80.81% (299/370). The common indications were occult gastrointestinal bleeding (OGIB) (30.8%, 114/370) and abdominal pain (28.3%, 105/370). The diagnosis rates were 64.9% and 77.1%, respectively. The common positive findings included nonspecific inflammation/erosion (60 cases), ulcers (34 cases), diverticulum (32 cases), polyps (26 cases) and Crohn's disease (CD) (24 cases). The common tumours were lymphoma(12 cases), adenocarcinoma(11 cases) and stromal tumour(8 cases). Lymphoma was mostly located in the ileum, while stromal tumours and adenocarcinoma were mostly located in the duodenum and jejunum. The main endoscopic intervention measures were haemostasis and polypectomy, including haemostatic clip, argon plasma coagulation (APC), endoscopic mucosal resection (EMR), endoscopic trap resection, endoscopic foreign body extraction and other operations, without serious complications. CONCLUSION DBE has a high success rate in the diagnosis and treatment of some SBDs, and it is a safe and effective management method.
Collapse
Affiliation(s)
- Liming Lu
- Department of Digestive System, Kunhua Hospital Affiliated to Kunming University of Science and Technology, The First People's Hospital of Yunnan Province, No. 157 Jinbi Road, Kunming, 650032, Yunnan, China.,Medical School, Kunming University of Science and Technology, No. 727 Jingming South Road, Kunming, 650500, Yunnan, China
| | - Chao Yang
- Department of Digestive System, Kunhua Hospital Affiliated to Kunming University of Science and Technology, The First People's Hospital of Yunnan Province, No. 157 Jinbi Road, Kunming, 650032, Yunnan, China
| | - Tian He
- Department of Digestive System, Kunhua Hospital Affiliated to Kunming University of Science and Technology, The First People's Hospital of Yunnan Province, No. 157 Jinbi Road, Kunming, 650032, Yunnan, China
| | - Xuan Bai
- Department of Digestive System, Kunhua Hospital Affiliated to Kunming University of Science and Technology, The First People's Hospital of Yunnan Province, No. 157 Jinbi Road, Kunming, 650032, Yunnan, China
| | - Minmin Fan
- Department of Digestive System, Kunhua Hospital Affiliated to Kunming University of Science and Technology, The First People's Hospital of Yunnan Province, No. 157 Jinbi Road, Kunming, 650032, Yunnan, China
| | - Yajing Yin
- Department of Digestive System, Kunhua Hospital Affiliated to Kunming University of Science and Technology, The First People's Hospital of Yunnan Province, No. 157 Jinbi Road, Kunming, 650032, Yunnan, China
| | - Ping Wan
- Department of Digestive System, Kunhua Hospital Affiliated to Kunming University of Science and Technology, The First People's Hospital of Yunnan Province, No. 157 Jinbi Road, Kunming, 650032, Yunnan, China.
| | - Hui Tang
- Department of Digestive System, Kunhua Hospital Affiliated to Kunming University of Science and Technology, The First People's Hospital of Yunnan Province, No. 157 Jinbi Road, Kunming, 650032, Yunnan, China.
| |
Collapse
|
|
21
|
Buchholz H, Mende M, Hornoff S, Faiss S. [Results of motorized spiral enteroscopy in 83 consecutive patients]. ZEITSCHRIFT FUR GASTROENTEROLOGIE 2022; 60:1635-1643. [PMID: 35176807 DOI: 10.1055/a-1744-6738] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Abstract] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 12/22/2022]
Abstract
INTRODUCTION For motorized spiral enteroscopy, only limited data are available. We report about our early experiences with the motorized spiral enteroscopy in a retrospective case series. The present worldwide study reported the results of motorized spiral enteroscopy in 68 patients with small bowel diseases and in 15 patients with ERCP and surgically altered anatomy. PATIENTS AND METHODS This retrospective single-centre study was performed between 01/2020 and 09/2021 in 83 consecutive patients. Indications were known or suspected small bowel diseases or diseases of the bile or pancreatic duct after surgical altered anatomy with Roux-Y anastomosis. RESULTS In 68 patients (38 m/30 f; mean age 66.4 years) with an indication for small bowel enteroscopy, diagnostic and therapeutic yield was 86.8% and 41.2%, respectfully. The average depth of maximum insertion was 279 cm with an average insertion time of 64.3 min. In 13 patients (19.7%), complete panenteroscopy was achieved. In patients without prior abdominal surgery, the rate of complete enteroscopy was 46.2%.In 15 patients (9 m; 6 f; mean age 61.8 years) with surgically altered anatomy and Roux-Y anastomosis (the papilla resp.), the biliodigestive anastomosis could be reached in 60%.In the entire case series, the total complication rate was 15.7%. There were no severe complications, such as perforation or major bleeding. DISCUSSION The present case series shows a high rate of panenteroscopies with a short examination time. To confirm these data, further comparative studies for ERCPs in patients with surgically altered anatomy are necessary.
Collapse
Affiliation(s)
| | - Matthias Mende
- Gastroenterology, Sana Klinikum Lichtenberg, Berlin, Germany
| | - Steffen Hornoff
- Gastroenterology, Sana Klinikum Lichtenberg, Berlin, Germany
| | - Siegbert Faiss
- Gastroenterology, Sana Klinikum Lichtenberg, Berlin, Germany
| |
Collapse
|
|
22
|
Achieving Total Enteroscopy by Consecutive Bidirectional Double-balloon Enteroscopy Procedures. Curr Med Sci 2022; 42:144-149. [PMID: 35122184 DOI: 10.1007/s11596-022-2523-6] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/30/2021] [Accepted: 06/26/2021] [Indexed: 11/03/2022]
Abstract
OBJECTIVE To investigate the feasibility and safety of achieving total enteroscopy by consecutive bidirectional double-balloon enteroscopy (DBE) procedures. METHODS The demographic data, indication, initial insertion route, examination time for each insertion and the entire procedure, total enteroscopy rate, diagnostic yield and adverse events of patients who attempted to achieve total enteroscopy by consecutive bidirectional DBE procedures from January 2014 to December 2019 were retrospectively analyzed. RESULTS A total of 189 patients were included, and the total enteroscopy rate was 87.3%. Initiating the DBE procedure via the retrograde approach as the initial insertion route achieved a higher total enterosocpy rate (90.9% vs. 78.9%, P=0.023), with shorter overall examination time (134.2±36.2 vs. 156.9±47.6 min, P=0.017) and shorter examination time for the opposite insertion route (23.8±19.9 vs. 53.1±27.6 min, P=0.000) compared with anteograde approach as the initial insertion route. The overall diagnostic yield was 37.6%. The diagnostic yield for successfully achieving total enteroscopy was higher, when compared to the yield for not successfully achieving total enteroscopy (39.4% vs. 25%, P=0.029). The overall rate of adverse events was 2.1% (4/189). There was no significant difference in adverse event rate between the overall examination time ≥2 h group and <2 h group (2.1% vs. 2.0%, P=0.593). CONCLUSION Consecutive bidirectional DBE procedure is an effective and safe strategy for achieving total enteroscopy with a considerable success rate. This may be a promising option and alternative to traditional methods, and helpful to more promptly establish a definite diagnosis. The retrograde approach, as the initial insertion route, is preferred in clinical practice.
Collapse
|
|
23
|
Nehme F, Goyal H, Perisetti A, Tharian B, Sharma N, Tham TC, Chhabra R. The Evolution of Device-Assisted Enteroscopy: From Sonde Enteroscopy to Motorized Spiral Enteroscopy. Front Med (Lausanne) 2022; 8:792668. [PMID: 35004760 PMCID: PMC8733321 DOI: 10.3389/fmed.2021.792668] [Citation(s) in RCA: 4] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 10/11/2021] [Accepted: 11/22/2021] [Indexed: 12/11/2022] Open
Abstract
The introduction of capsule endoscopy in 2001 opened the last "black box" of the gastrointestinal tract enabling complete visualization of the small bowel. Since then, numerous new developments in the field of deep enteroscopy have emerged expanding the diagnostic and therapeutic armamentarium against small bowel diseases. The ability to achieve total enteroscopy and visualize the entire small bowel remains the holy grail in enteroscopy. Our journey in the small bowel started historically with sonde type enteroscopy and ropeway enteroscopy. Currently, double-balloon enteroscopy, single-balloon enteroscopy, and spiral enteroscopy are available in clinical practice. Recently, a novel motorized enteroscope has been described with the potential to shorten procedure time and allow for total enteroscopy in one session. In this review, we will present an overview of the currently available techniques, indications, diagnostic yield, and complications of device-assisted enteroscopy.
Collapse
Affiliation(s)
- Fredy Nehme
- Department of Gastroenterology and Hepatology, School of Medicine, Saint Luke's Hospital, University of Missouri Kansas City (UMKC), Kansas City, MO, United States
| | - Hemant Goyal
- Department of Medicine, The Wright Center for Graduate Medical Education, Scranton, PA, United States
| | - Abhilash Perisetti
- Division of Interventional Oncology and Surgical Endoscopy (IOSE), Parkview Cancer Institute, Fort Wayne, IN, United States
| | - Benjamin Tharian
- Department of Gastroenterology and Hepatology, University of Arkansas for Medical Sciences, Little Rock, AR, United States
| | - Neil Sharma
- Division of Interventional Oncology and Surgical Endoscopy (IOSE), Parkview Cancer Institute, Fort Wayne, IN, United States.,Department of Endoscopy, Indiana University School of Medicine, Fort Wayne, IN, United States
| | - Tony C Tham
- Division of Gastroenterology, Ulster Hospital, Belfast, United Kingdom
| | - Rajiv Chhabra
- Department of Gastroenterology and Hepatology, School of Medicine, Saint Luke's Hospital, University of Missouri Kansas City (UMKC), Kansas City, MO, United States
| |
Collapse
|
|
24
|
Jafari MD, Bleier JIS. Lower GI Hemorrhage. THE ASCRS TEXTBOOK OF COLON AND RECTAL SURGERY 2022:699-713. [DOI: 10.1007/978-3-030-66049-9_40] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 01/04/2025]
|
|
25
|
Factors Affecting Route Selection of Balloon-Assisted Enteroscopy in Patients with Obscure Gastrointestinal Bleeding: A KASID Multicenter Study. Diagnostics (Basel) 2021; 11:diagnostics11101860. [PMID: 34679558 PMCID: PMC8535013 DOI: 10.3390/diagnostics11101860] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/10/2021] [Revised: 10/05/2021] [Accepted: 10/07/2021] [Indexed: 11/26/2022] Open
Abstract
Balloon-assisted enteroscopy (BAE) is an important diagnostic modality for ongoing obscure gastrointestinal bleeding (OGIB). However, it is difficult to determine the optimal insertion route. We retrospectively analyzed the records of patients with OGIB contained in a multicenter enteroscopy database of 1108 balloon-assisted enteroscopy (BAE) procedures (875 patients) to find out factors affecting BAE route selection in patients with OGIB. A total of 603 BAE procedures in 512 patients were investigated: there were 392 (65.0%) bidirectional and 211 (35.0%) unidirectional procedures. Overt OGIB was more frequent in the latter group (p = 0.024). Computed tomography (CT) was more frequently performed in the unidirectional group (p < 0.001). Capsule endoscopy and a small bowel barium study were performed more frequently in the bidirectional group (p < 0.001 and p = 0.039, respectively). Multivariate analysis showed that occult OGIB, capsule endoscopy and a small bowel barium study were independently associated with use of the bidirectional approach (p = 0.011, p = 0.013 and p = 0.046, respectively). Conversely, CT was associated with use of the unidirectional approach (p < 0.001). Conclusion: CT can aid the selection of an optimal insertion route in OGIB patients. However, capsule endoscopy and small bowel barium study are unhelpful.
Collapse
|
|
26
|
McDonald MJ. Acute Gastrointestinal Bleeding – Locating the Source and Correcting the Disorder. PHYSICIAN ASSISTANT CLINICS 2021. [DOI: 10.1016/j.cpha.2021.05.011] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Indexed: 11/29/2022]
|
|
27
|
Chen HY, Ning SB, Yin X, Li BR, Zhang J, Jin XW, Sun T, Xia ZB, Zhang XP. Balloon-assisted endoscopic submucosal dissection for treating small intestinal lipomas: Report of two cases. World J Clin Cases 2021; 9:1631-1638. [PMID: 33728306 PMCID: PMC7942049 DOI: 10.12998/wjcc.v9.i7.1631] [Citation(s) in RCA: 7] [Impact Index Per Article: 1.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 08/01/2020] [Revised: 08/21/2020] [Accepted: 01/05/2021] [Indexed: 02/06/2023] Open
Abstract
BACKGROUND Most small intestinal lipomas are treated surgically, and some require repeated surgeries for multiple lipomas. However, application of endoscopic submucosal dissection (ESD) technology in the deep small intestine is rarely reported owing to the special anatomical structure of the small intestine, medical equipment limitations, and the lack of relevant experience among endoscopists.
CASE SUMMARY Two patients with small intestinal lipomas treated at the Air Force Medical Center from November 2015 to September 2019 were selected to undergo balloon-assisted ESD to treat the lipomas and explore the technical feasibility and safety of ESD for treating small intestinal lipomas. The two patients successfully underwent balloon-assisted ESD to treat four small intestinal lipomas, with a complete resection rate of 100% (4/4), without intraoperative or postoperative bleeding, perforation, or other complications. After 3-6 mo of postoperative follow-up, the clinical symptoms caused by the lipomas were significantly relieved or disappeared after treatment.
CONCLUSION Balloon-assisted ESD is a safe and reliable new method for treating deep intestinal lipomas and shows good clinical feasibility.
Collapse
Affiliation(s)
- Hong-Yu Chen
- Department of Gastroenterology, Air Force Medical Center, PLA of China, Beijing 100142, China
| | - Shou-Bin Ning
- Department of Gastroenterology, Air Force Medical Center, PLA of China, Beijing 100142, China
| | - Xin Yin
- Department of Gastroenterology, Air Force Medical Center, PLA of China, Beijing 100142, China
| | - Bai-Rong Li
- Department of Gastroenterology, Air Force Medical Center, PLA of China, Beijing 100142, China
| | - Jing Zhang
- Department of Gastroenterology, Air Force Medical Center, PLA of China, Beijing 100142, China
| | - Xiao-Wei Jin
- Department of Gastroenterology, Air Force Medical Center, PLA of China, Beijing 100142, China
| | - Tao Sun
- Department of Gastroenterology, Air Force Medical Center, PLA of China, Beijing 100142, China
| | - Zhi-Bo Xia
- Department of Gastroenterology, Air Force Medical Center, PLA of China, Beijing 100142, China
| | - Xiao-Peng Zhang
- Department of Gastroenterology, Air Force Medical Center, PLA of China, Beijing 100142, China
| |
Collapse
|
|
28
|
Causes and Clinical Characteristics of Small Bowel Bleeding in Northern Vietnam. Can J Gastroenterol Hepatol 2020; 2020:8884092. [PMID: 33313021 PMCID: PMC7721493 DOI: 10.1155/2020/8884092] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 05/27/2020] [Revised: 11/13/2020] [Accepted: 11/23/2020] [Indexed: 11/17/2022] Open
Abstract
AIM Causes, clinical features, and diagnostic approaches for small bowel (SB) bleeding were analyzed to derive recommendations in dealing with this clinical condition. METHODS We included 54 patients undergoing surgical treatment for SB bleeding, from January 2009 to December 2019. Detailed clinical data, diagnosis procedures, and causes of bleeding were collected. RESULTS Among 54 cases with SB bleeding, the most common causes were tumors (64.8%), followed by angiopathy (14.8%), ulcers (9.3%), diverticula (5.6%), tuberculosis (3.7%), and enteritis (1.9%). Most tumors (32/35 cases, 91.4%) and vascular lesions (8/8 cases, 100%) were located in the jejunum. The incidence of tumors was higher in the older (30/41 cases, 73.1%) than that in patients younger than 40 years of age (5/13 cases, 38.5%, P < 0.01). Common initial findings were melena (68.5%) and hematochezia (31.5%). The overall diagnostic yield of computed tomographic enterography (CTE) was 57.4% (31/54 cases), with the figures for tumors, vascular lesions, and inflammatory lesions being 71.4% (25/35 cases), 62.5% (5/8 cases), and 12.5% (1/8 cases), respectively. Double-balloon enteroscopy (DBE) definitively identified SB bleeding sources in 16/22 (72.7%) patients. CONCLUSION Tumors, angiopathy, ulcers, and diverticula were the most common causes of SB bleeding in Northern Vietnamese population. CTE has a high detection rate for tumors in patients with SB bleeding. CTE as a triage tool may identify patients before double-balloon enteroscopy because of the high prevalence of SB tumors.
Collapse
|
|
29
|
Kim K, Gaddam S, Verula J, Lai E, Dollentas A, Hill B, Francis S, Chess S, Lo S. Is sore throat an underreported and under-estimated quality indicator for endoscopic procedures? Results from a large prospective cohort. Endosc Int Open 2020; 8:E1398-E1404. [PMID: 33015343 PMCID: PMC7508659 DOI: 10.1055/a-1223-2002] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 04/07/2020] [Accepted: 06/05/2020] [Indexed: 11/08/2022] Open
Abstract
Background and study aims Patients often develop sore throat after upper endoscopy procedures but there data are very limited on the magnitude of the problem. The aim of this study was to evaluate and identify independent risk factors of sore throat in patients undergoing endoscopy. Patients and methods Data were collected prospectively on consecutive outpatient endoscopy procedures performed at Cedars-Sinai Medical Center from October 2018 to February 2019. Procedure nurses collected pre-procedure, intra-procedure, and immediate post-procedure surveys including evaluation of sore throat (pain scale from 1 - 10). Significant univariate variables ( P < 0.05) were entered into a multivariate logistic regression model. Results Data were collected on 715 patients. Four hundred seventy-two patients (mean age = 61 years, females = 53 %) were included in the analysis and 85 patients (18 %) experienced post-procedure sore throat. On univariate analysis, female gender, oral endoscopic ultrasound (EUS), oral double balloon enteroscopy (DBE), fellow involvement, throat suctioning, general anesthesia, oral airway, and prolonged procedure (> 30 minutes) were risk factors for sore throat (all P < 0.05). On the multivariate analysis, independent risk-factors for post-procedure sore throat were oral DBE (odds ratio [OR] 5.2), oral airway (OR 4.8), general anesthesia (OR 2.7), fellow involvement (OR 2.5), oral EUS (OR 2.4), and female gender (OR 2.0). Conclusions Contrary to popular belief, our study found that post-procedural sore throat is more common (18 %) than previously reported. Two types of endoscopic procedures, two anesthesia maneuvers, female gender, and fellow involvement were all independent risk factors. This is of particular concern for interventionalists who perform EUS and oral DBE as these patients are at higher risk for sore throat.
Collapse
Affiliation(s)
- Katherine Kim
- Cedars Sinai Medical Center, Department of Gastroenterology, Los Angeles, California, United States
| | - Srinivas Gaddam
- Cedars Sinai Medical Center, Department of Gastroenterology, Los Angeles, California, United States
| | - John Verula
- Cedars Sinai Medical Center, Department of Gastroenterology, Los Angeles, California, United States
| | - Ellis Lai
- Cedars Sinai Medical Center, Department of Gastroenterology, Los Angeles, California, United States,Cedars Sinai Medical Center, Department of Anesthesiology, Los Angeles, California, United States
| | - Ashley Dollentas
- Cedars Sinai Medical Center, Department of Gastroenterology, Los Angeles, California, United States
| | - Bee Hill
- Cedars Sinai Medical Center, Department of Gastroenterology, Los Angeles, California, United States
| | - Sarah Francis
- Cedars Sinai Medical Center, Department of Gastroenterology, Los Angeles, California, United States
| | - Shara Chess
- Cedars Sinai Medical Center, Department of Gastroenterology, Los Angeles, California, United States
| | - Simon Lo
- Cedars Sinai Medical Center, Department of Gastroenterology, Los Angeles, California, United States
| |
Collapse
|
|
30
|
Elsharif M, Hague AG, Ahmed H, Ackroyd R. After you Roux, what do you do? A systematic review of most successful advanced assisted ERCP techniques in patients with various altered upper gastrointestinal surgical anatomical reconstructions with particular focus on RYGB (last 10 years). Clin J Gastroenterol 2020; 13:985-1009. [PMID: 32809134 DOI: 10.1007/s12328-020-01201-9] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.4] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 02/02/2020] [Accepted: 07/30/2020] [Indexed: 02/07/2023]
Abstract
Access to the Common Bile Duct in patients with surgically altered UGI anatomy such as RYGB is exceptionally challenging. Previously, these patients could only be treated by open surgery; however, multiple new advanced assisted ERCP techniques such as EDGE, LA-ERCP, and DEA-ERCP have now been developed and indeed successfully used to treat these patients. Despite growing experience, these techniques have yet to become part of our mainstream practice and many clinicians remain unfamiliar or even unaware of them; as a result, they are unfortunately often overlooked. We conducted this systematic review to try and shed more light on them and understand which of these techniques resulted in the best patient outcomes. We conducted a systematic review of PubMed database publications between December 2008 and December 2018. Keyword variants of "EDGE, Enteroscopy-assisted & laparoscopy-assisted ERCP" and "altered surgical anatomy" were combined to identify relevant papers for inclusion. We identified 34 studies, comprising a total of 1848 advanced assisted ERCPs in patients with altered UGI anatomy from 12 different countries. These papers were critically appraised, summarised, and presented in table format. EDGE and LA-ERCP were associated with both the highest overall combined CBD cannulation rates (99.3% for both vs 74.6% for DEA-ERCP) and ERCP interventional success (98.3% for EDGE vs 97.4% for LA-ERCP and 67.6% for DEA-ERCP). Advanced ERCP is associated with excellent success rates and a higher safety profile than surgery; however, patient selection and identification of the exact surgical anatomy are key.
Collapse
Affiliation(s)
- Mohamed Elsharif
- Department of Upper GI Surgery, Northern General Hospital, Sheffield Teaching Hospitals, Flat 2, 23 Montgomery Road, Sheffield, S71LN, UK.
| | - Adam Gary Hague
- Department of Upper GI Surgery, Northern General Hospital, Sheffield Teaching Hospitals, Flat 2, 23 Montgomery Road, Sheffield, S71LN, UK
| | - Hussam Ahmed
- Department of Upper GI Surgery, Northern General Hospital, Sheffield Teaching Hospitals, Flat 2, 23 Montgomery Road, Sheffield, S71LN, UK
| | - Roger Ackroyd
- Department of Upper GI Surgery, Northern General Hospital, Sheffield Teaching Hospitals, Flat 2, 23 Montgomery Road, Sheffield, S71LN, UK
| |
Collapse
|
|
31
|
Uchida D, Tsutsumi K, Kato H, Matsumi A, Saragai Y, Tomoda T, Matsumoto K, Horiguchi S, Okada H. Potential Factors Affecting Results of Short-Type Double-Balloon Endoscope-Assisted Endoscopic Retrograde Cholangiopancreatography. Dig Dis Sci 2020; 65:1460-1470. [PMID: 31562611 DOI: 10.1007/s10620-019-05857-3] [Citation(s) in RCA: 13] [Impact Index Per Article: 2.6] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 06/26/2019] [Accepted: 09/18/2019] [Indexed: 12/13/2022]
Abstract
BACKGROUND Short-type double-balloon endoscope (DBE)-assisted endoscopic retrograde cholangiopancreatography (ERCP) has been developed as an alternative approach for cases with a surgically altered gastrointestinal anatomy. However, this technique is sometimes technically challenging and carries a risk of severe adverse events. AIMS To evaluate the factors affecting the technical success rate and adverse events of DBE-ERCP. METHODS A total of 319 patients (805 procedures) with a surgically altered gastrointestinal anatomy underwent short DBE-ERCP. The factors affecting the technical success rate and adverse events, and the learning curve of the trainees were retrospectively evaluated. RESULTS The technical success rate of all procedures was 90.7%. Adverse events occurred in 44 (5.5%) procedures. A multivariate analysis indicated that Roux-en-Y reconstruction and first-time short DBE-ERCP were factors affecting the technical failure and adverse event rates, while the modified Child method after subtotal stomach-preserving pancreaticoduodenectomy reconstruction was a non-risk factor for adverse events. The trainee caseload did not affect the technical success or adverse event rates significantly; however, trainees tended to perform cases involving the modified Child method after subtotal stomach-preserving pancreaticoduodenectomy reconstruction. The success rate of scope insertion increased according to experience; however, the overall success rate did not differ to a statistically significant extent. CONCLUSION Short DBE-ERCP was useful and safe for managing cases with a surgically altered anatomy; however, trainees should concentrate on accumulating experience with easy cases, such as those with the modified Child method after subtotal stomach-preserving pancreaticoduodenectomy reconstruction or a history of DBE-ERCP.
Collapse
Affiliation(s)
- Daisuke Uchida
- Department of Gastroenterology, Okayama University Hospital, 2-5-1 Shikata-cho, Kita-ku, Okayama, 700-8558, Japan.
- Center for Innovative Clinical Medicine, Okayama University Hospital, Okayama, Japan.
| | - Koichiro Tsutsumi
- Department of Gastroenterology, Okayama University Hospital, 2-5-1 Shikata-cho, Kita-ku, Okayama, 700-8558, Japan
| | - Hironari Kato
- Department of Gastroenterology, Okayama University Hospital, 2-5-1 Shikata-cho, Kita-ku, Okayama, 700-8558, Japan
| | - Akihiro Matsumi
- Department of Gastroenterology, Okayama University Hospital, 2-5-1 Shikata-cho, Kita-ku, Okayama, 700-8558, Japan
| | - Yosuke Saragai
- Department of Gastroenterology, Okayama University Hospital, 2-5-1 Shikata-cho, Kita-ku, Okayama, 700-8558, Japan
| | - Takeshi Tomoda
- Department of Gastroenterology, Okayama University Hospital, 2-5-1 Shikata-cho, Kita-ku, Okayama, 700-8558, Japan
| | - Kazuyuki Matsumoto
- Department of Gastroenterology, Okayama University Hospital, 2-5-1 Shikata-cho, Kita-ku, Okayama, 700-8558, Japan
| | - Shigeru Horiguchi
- Department of General Medicine, Okayama University Hospital, Okayama, Japan
| | - Hiroyuki Okada
- Department of Gastroenterology, Okayama University Hospital, 2-5-1 Shikata-cho, Kita-ku, Okayama, 700-8558, Japan
| |
Collapse
|
|
32
|
Wang P, Wang Y, Dong Y, Guo J, Fu H, Li Z, Du Y. Outcomes and safety of double-balloon enteroscopy in small bowel diseases: a single-center experience of 1531 procedures. Surg Endosc 2020; 35:576-583. [DOI: 10.1007/s00464-020-07418-6] [Citation(s) in RCA: 8] [Impact Index Per Article: 1.6] [Reference Citation Analysis] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 09/22/2019] [Accepted: 02/10/2020] [Indexed: 12/17/2022]
|
|
33
|
Single incision laparoscopic assisted double balloon enteroscopy: a novel technique to manage small bowel pathology. Surg Endosc 2020; 34:2773-2779. [PMID: 32072281 DOI: 10.1007/s00464-020-07446-2] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.4] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 08/16/2019] [Accepted: 02/10/2020] [Indexed: 12/22/2022]
Abstract
BACKGROUND AND AIMS Double balloon enteroscopy (DBE) has revolutionised the diagnosis and treatment of small bowel (SB) conditions. However, deep SB insertion can be challenging in patients with a history of abdominal surgery and a two-step procedure is required when findings are not amenable to endoscopic therapy. This case series reports the development of laparoscopically assisted DBE (LA-DBE) using single incision laparoscopic surgery (SILS). METHODS Retrospective review of LA-DBE procedures performed in a single tertiary centre over 6 years. RESULTS Seventeen patients (median age: 40 years, male 41%) underwent 17 LA-DBE procedures. The approach was oral in 13 and rectal in 4. Laparoscopic approach was standard (multi-port) in the first four cases, SILS was then used in all subsequent patients (13/17). Indications for LA-DBE were previously failed standard DBE (n = 16) and need for a combined procedure (n = 1). Indications for DBE were Peutz-Jeghers syndrome (PJS) (n = 10), suspected submucosal/polypoid lesion at small bowel imaging (n = 5) and obscure gastrointestinal bleeding (OGIB) with vascular abnormalities seen at capsule endoscopy (n = 2). In 1/17 the suggested pathology on imaging was not identified. Therapy was applied in 15/17 (88%) cases. Diagnoses were PJS polyps (n = 8), neuroendocrine tumour (NET) (n = 2), PJS and NET (n = 1), transmural arteriovenous malformation (n = 1), angioectesia (n = 1), inflammatory polyp (n = 1), leiomyoma (n = 1) and Meckel's diverticulum (n = 1). The median (range) procedure time was 147 (84-210) mins. Median (range) length of stay post-procedure was 2 (1-19) days. Three patients developed complications. The 30-day mortality rate was 0%. CONCLUSIONS LA-DBE is a safe, effective and minimally invasive procedure that can be applied for the management of selected patients with small bowel pathology. A SILS approach allows all therapeutic modalities to be available, including conversion to intraoperative enteroscopy (IOE), laparoscopic small bowel resection and laparotomy.
Collapse
|
|
34
|
Spada C, McNamara D, Despott EJ, Adler S, Cash BD, Fernández-Urién I, Ivekovic H, Keuchel M, McAlindon M, Saurin JC, Panter S, Bellisario C, Minozzi S, Senore C, Bennett C, Bretthauer M, Dinis-Ribeiro M, Domagk D, Hassan C, Kaminski MF, Rees CJ, Valori R, Bisschops R, Rutter MD. Performance measures for small-bowel endoscopy: A European Society of Gastrointestinal Endoscopy (ESGE) Quality Improvement Initiative. United European Gastroenterol J 2019; 7:614-641. [PMID: 31210941 DOI: 10.1177/2050640619850365] [Citation(s) in RCA: 54] [Impact Index Per Article: 9.0] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 04/11/2019] [Accepted: 04/24/2019] [Indexed: 12/17/2022] Open
Abstract
The European Society of Gastrointestinal Endoscopy (ESGE) together with the United European Gastroenterology (UEG) recently developed a short list of performance measures for small-bowel endoscopy (i.e. small-bowel capsule endoscopy and device-assisted enteroscopy) with the final goal of providing endoscopy services across Europe with a tool for quality improvement. Six key performance measures both for small-bowel capsule endoscopy and for device-assisted enteroscopy were selected for inclusion, with the intention being that practice at both a service and endoscopist level should be evaluated against them. Other performance measures were considered to be less relevant, based on an assessment of their overall importance, scientific acceptability, and feasibility. Unlike lower and upper gastrointestinal endoscopy, for which performance measures had already been identified, this is the first time small-bowel endoscopy quality measures have been proposed.
Collapse
Affiliation(s)
- Cristiano Spada
- Digestive Endoscopy Unit and Gastroenterology, Fondazione Poliambulanza, Brescia, Italy.,Digestive Endoscopy Unit, Fondazione Policlinico Universitario A. Gemelli - IRCCS, Rome, Italy
| | - Deirdre McNamara
- TAGG Research Centre, Department of Clinical Medicine, Tallaght Hospital, Trinity College Dublin, Ireland
| | - Edward J Despott
- Royal Free Unit for Endoscopy, The Royal Free Hospital and UCL Institute for Liver and Digestive Health, London, UK
| | - Samuel Adler
- Division of Gastroenterology, Shaare Zedek Medical Center, Jerusalem, Israel
| | - Brooks D Cash
- Department of Gastroenterology, Hepatology, and Nutrition, UT Health Science Center at Houston/Memorial Hermann, Houston, TX, USA.,McGovern Medical School, Department of Internal Medicine, Houston, TX, USA
| | | | - Hrvoje Ivekovic
- Department of Gastroenterology and Hepatology, University Hospital Centre, Zagreb, Croatia
| | - Martin Keuchel
- Clinic for Internal Medicine, Bethesda Krankenhaus Bergedorf, Hamburg, Germany
| | - Mark McAlindon
- Academic Department of Gastroenterology and Hepatology, Sheffield Teaching Hospitals NHS Trust, Sheffield, UK
| | - Jean-Christophe Saurin
- Gastroenterology and Endoscopy Unit, Hospices Civils de Lyon, Hôpital E. Herriot, Lyon, France
| | - Simon Panter
- Department of Gastroenterology, South Tyneside NHS Foundation Trust, South Shields, UK
| | | | - Silvia Minozzi
- CPO Piemonte, AOU Città della Salute e della Scienza, Turin, Italy
| | - Carlo Senore
- CPO Piemonte, AOU Città della Salute e della Scienza, Turin, Italy
| | - Cathy Bennett
- Office of Research and Innovation, Royal College of Surgeons in Ireland Coláiste Ríoga na Máinleá in Éirinn, Dublin, Ireland
| | - Michael Bretthauer
- Clinical Effectiveness Research Group, University of Oslo and Oslo University Hospital, Oslo, Norway
| | - Mario Dinis-Ribeiro
- Servicio de Gastroenterologia, Instituto Portugues de Oncologia Francisco Gentil, Porto, Portugal
| | - Dirk Domagk
- Department of Medicine I, Josephs-Hospital Warendorf, Academic Teaching Hospital, University of Muenster, Warendorf, Germany
| | - Cesare Hassan
- Endoscopy Unit, Nuovo Regina Margherita Hospital, Rome, Italy
| | - Michal F Kaminski
- Department of Gastroenterology, Hepatology and Oncology, Medical Center for Postgraduate Education, Warsaw, Poland.,Department of Gastroenterological Oncology and Department of Cancer Prevention, The Maria Sklodowska-Curie Memorial Cancer Center and Institute of Oncology, Warsaw, Poland.,Department of Health Management and Health Economics, University of Oslo, Oslo, Norway
| | - Colin J Rees
- Northern Institute for Cancer Research, Newcastle University, Newcastle, UK
| | - Roland Valori
- Department of Gastroenterology, Gloucestershire Hospitals NHS Foundation Trust, Gloucestershire, UK
| | - Raf Bisschops
- Department of Gastroenterology and Hepatology. University Hospital Leuven, Leuven, Belgium
| | - Matthew D Rutter
- Northern Institute for Cancer Research, Newcastle University, Newcastle, UK.,Department of Gastroenterology, University Hospital of North Tees, Stockton-on-Tees, Cleveland, UK
| |
Collapse
|
|
35
|
Muftah M, Mulki R, Dhere T, Keilin S, Chawla S. Diagnostic and therapeutic considerations for obscure gastrointestinal bleeding in patients with chronic kidney disease. Ann Gastroenterol 2018; 32:113-123. [PMID: 30837783 PMCID: PMC6394262 DOI: 10.20524/aog.2018.0341] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.3] [Reference Citation Analysis] [Abstract] [Key Words] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 10/17/2018] [Accepted: 11/18/2018] [Indexed: 12/12/2022] Open
Abstract
Recurrent obscure gastrointestinal bleeding amongst patients with chronic kidney disease is a challenging problem gastroenterologists are facing and is associated with an extensive diagnostic workup, limited therapeutic options, and high healthcare costs. Small-bowel angiodysplasia is the most common etiology of obscure and recurrent gastrointestinal bleeding in the general population. Chronic kidney disease is associated with a higher risk of gastrointestinal bleeding and of developing angiodysplasia compared with the general population. As a result, recurrent bleeding in this subgroup of patients is more prevalent and is associated with an increased number of endoscopic and radiographic procedures with uncertain benefit. Alternative medical therapies can reduce re-bleeding; however, more studies are needed to confirm their efficacy in this subgroup of patients.
Collapse
Affiliation(s)
- Mayssan Muftah
- Department of Medicine (Mayssan Muftah), Atlanta, United States
| | - Ramzi Mulki
- Medicine, Division of Digestive Diseases, Emory University School of Medicine (Ramzi Mulki, Tanvi Dhere, Steven Keilin, Saurabh Chawla), Atlanta, United States
| | - Tanvi Dhere
- Medicine, Division of Digestive Diseases, Emory University School of Medicine (Ramzi Mulki, Tanvi Dhere, Steven Keilin, Saurabh Chawla), Atlanta, United States
| | - Steven Keilin
- Medicine, Division of Digestive Diseases, Emory University School of Medicine (Ramzi Mulki, Tanvi Dhere, Steven Keilin, Saurabh Chawla), Atlanta, United States
| | - Saurabh Chawla
- Medicine, Division of Digestive Diseases, Emory University School of Medicine (Ramzi Mulki, Tanvi Dhere, Steven Keilin, Saurabh Chawla), Atlanta, United States.,Grady Memorial Hospital (Saurabh Chawla), Atlanta, United States
| |
Collapse
|
|
36
|
Yeh HY, Su MY, Lin WP, Lai MW, Chao HC, Chen SY, Chiu CT. Double-balloon enteroscopy for pediatric patients: Application and feasibility evaluation in a medical center in northern Taiwan. J Formos Med Assoc 2018; 118:341-346. [PMID: 30268344 DOI: 10.1016/j.jfma.2018.05.014] [Citation(s) in RCA: 1] [Impact Index Per Article: 0.1] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 12/23/2017] [Revised: 04/25/2018] [Accepted: 05/24/2018] [Indexed: 12/22/2022] Open
Abstract
BACKGROUND/PURPOSE The diagnostic and therapeutic benefits of double-balloon enteroscopy (DBE) in adults are established, but few data are available on pediatric patients. The aim of this study was to evaluate the clinical efficacy and safety of DBE in pediatric patients in Taiwan. METHODS From April 2005 to September 2015, DBE procedures performed for diagnosis or therapy of small-bowel disease in children less than 18 years of age at Linkou Chang Gung Memorial Hospital, Taiwan were evaluated. The clinical decision to perform DBE via the oral or anal approach was based on the patient's primary clinical presentation. Data on indications, endoscopic findings, treatment outcome, and complications associated with the procedure were collected and reviewed retrospectively. RESULT In total, 20 pediatric patients underwent a total of 29 DBEs due to suspicion of small-bowel disease. Among them, nine patients were evaluated for suspected small-bowel bleeding, six for Peutz-Jeghers syndrome, two for chronic abdominal pain, two for chronic diarrhea, and one for suspected protein-losing enteropathy. After excluding the six Peutz-Jeghers syndrome patients, 9 of the 14 patients (64%) got a positive endoscopic finding and diagnosis in 8 of the 14 patients (57%). DBE resulted in a further therapeutic intervention (endoscopic or surgical) in 50% of the patients (10/20) without serious complications. CONCLUSION DBE has a high diagnostic yield and leads to therapeutic interventions in pediatric patients and shows promise for assessment and treating small-intestinal diseases in children in Taiwan.
Collapse
Affiliation(s)
- Hung-Yu Yeh
- Division of Pediatric Gastroenterology, Chang Gung Children's Hospital, Linkou, Taoyuan, Taiwan
| | - Ming-Yao Su
- Department of Gastroenterology and Hepatology, Linkou Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan; Taiwan Association for the Study of Small Intestinal Diseases (TASSID), Taoyuan, Taiwan
| | - Wei-Pin Lin
- Taiwan Association for the Study of Small Intestinal Diseases (TASSID), Taoyuan, Taiwan; Department of Gastroenterology and Hepatology, Linkou Chang Gung Memorial Hospital, Taoyuan, Taiwan
| | - Ming-Wei Lai
- Division of Pediatric Gastroenterology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan
| | - Hsun-Ching Chao
- Division of Pediatric Gastroenterology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan
| | - Shih-Yen Chen
- Division of Pediatric Gastroenterology, Chang Gung Children's Hospital, Chang Gung University College of Medicine, Taiwan Association for the Study of Small Intestinal Diseases (TASSID), Taoyuan, Taiwan; Department of Pediatrics, Taipei Medical University Shuang Ho Hospital, Taiwan.
| | - Cheng-Tang Chiu
- Department of Gastroenterology and Hepatology, Linkou Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan; Taiwan Association for the Study of Small Intestinal Diseases (TASSID), Taoyuan, Taiwan.
| |
Collapse
|
|
37
|
Zhao ZY, Jiang YL, Li BR, Yu ED, Ning SB. A novel STK11 missense mutation (c.346G > T) causing Peutz-Jeghers syndrome in a Chinese male with a negative family history. Dig Liver Dis 2018; 50:864-866. [PMID: 29921539 DOI: 10.1016/j.dld.2018.05.020] [Citation(s) in RCA: 0] [Impact Index Per Article: 0] [Reference Citation Analysis] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 04/15/2018] [Revised: 05/25/2018] [Accepted: 05/29/2018] [Indexed: 12/11/2022]
Affiliation(s)
- Zi-Ye Zhao
- Department of Colorectal Surgery, Shanghai Changhai Hospital, Shanghai, China
| | - Yu-Liang Jiang
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China
| | - Bai-Rong Li
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China
| | - En-Da Yu
- Department of Colorectal Surgery, Shanghai Changhai Hospital, Shanghai, China.
| | - Shou-Bin Ning
- Department of Gastroenterology, Airforce General Hospital of PLA, Beijing, China.
| |
Collapse
|
|
38
|
Pattni V, Tate DJ, Terlevich A, Marden P, Hughes S. Device-assisted enteroscopy in the UK: description of a large tertiary case series under conscious sedation. Frontline Gastroenterol 2018; 9:122-128. [PMID: 29588840 PMCID: PMC5868440 DOI: 10.1136/flgastro-2017-100842] [Citation(s) in RCA: 5] [Impact Index Per Article: 0.7] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 03/29/2017] [Revised: 06/20/2017] [Accepted: 07/03/2017] [Indexed: 02/06/2023] Open
Abstract
OBJECTIVE Device-assisted enteroscopy (DAE) has developed rapidly, particularly with the advent of double-balloon enteroscopy (DBE). This study reports a case series from a UK tertiary centre for DAE across two modalities-DBE and spiral enteroscopy (SE)-under conscious sedation. DESIGN Retrospective observational study of 257 enteroscopy procedures from 2008 to 2014. Data were collected on demographics, indications, diagnosis, sedation requirements, duration, complications, tolerance, therapy performed and completion rate. Procedures were performed under conscious sedation using a combination of midazolam, pethidine and fentanyl in a solely outpatient setting. RESULTS Obscure gastrointestinal bleeding (OGIB) was the commonest indication for DAE (n=164, 63.8%). Overall, yield of DAE was 47.2% and varied significantly across the indications (p=0.003). There was a greater likelihood of positive findings if the indication was polyposis syndrome (75%), abnormal capsule endoscopy (67%) or OGIB (53%) and in older patients (mean age normal exam 60.3 vs abnormal exam 67.9 years, p<0.001). Higher mean doses of midazolam were used for DBE from above (5.4 mg, SD 2.24) and SE (5.6 mg, SD 2.9) to DBE from below (4.4 mg, SD 1.8). No serious complications were recorded. Tolerance of DAE was good with the majority (240/257, 93.4%) of procedures tolerated with comfort scores 0 or 1. Therapy was performed in 121/257 (47.1%) of procedures. The strongest predictor indications for therapy to be performed at DAE were abnormal capsule endoscopy (88.9%) and occult gastrointestinal (GI) bleeding (54.9%). Completion rates were higher in DBEb (91.8%) compared to DBEa (76.5%) and SE (81.6%). CONCLUSION DAE under conscious sedation is safe and well tolerated. DAE has a high yield if performed for recognised indications and may be safely used to provide therapy where a diagnosis has been made using other modalities.
Collapse
Affiliation(s)
- Vijay Pattni
- Department of Gastroenterology, Southmead Hospital, North Bristol NHS Trust, Bristol, UK
| | - David J Tate
- Department of Gastroenterology, Southmead Hospital, North Bristol NHS Trust, Bristol, UK
| | - Ana Terlevich
- Department of Gastroenterology, Southmead Hospital, North Bristol NHS Trust, Bristol, UK
| | - Peter Marden
- Department of Gastroenterology, Southmead Hospital, North Bristol NHS Trust, Bristol, UK
| | - Steve Hughes
- Department of Gastroenterology, Southmead Hospital, North Bristol NHS Trust, Bristol, UK
| |
Collapse
|
|
39
|
Zhao ZY, Jiang YL, Li BR, Yang F, Li J, Jin XW, Ning SB, Sun SH. Sanger sequencing in exonic regions of STK11 gene uncovers a novel de-novo germline mutation (c.962_963delCC) associated with Peutz-Jeghers syndrome and elevated cancer risk: case report of a Chinese patient. BMC MEDICAL GENETICS 2017; 18:130. [PMID: 29141581 PMCID: PMC5688745 DOI: 10.1186/s12881-017-0471-y] [Citation(s) in RCA: 9] [Impact Index Per Article: 1.1] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Download PDF] [Figures] [Subscribe] [Scholar Register] [Received: 08/17/2017] [Accepted: 09/27/2017] [Indexed: 01/24/2023]
Abstract
Background Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Case presentation We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members’. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. Conclusions The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence. Electronic supplementary material The online version of this article (10.1186/s12881-017-0471-y) contains supplementary material, which is available to authorized users.
Collapse
Affiliation(s)
- Zi-Ye Zhao
- Department of Medical Genetics, Naval Medical University, 800 Xiangyin Rd, Shanghai, 200433, China
| | - Yu-Liang Jiang
- Hebei North University, 11 South Zuanshi Rd., Zhangjiakou, Hebei Province, 075061, China.,Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd, Beijing, 100142, China
| | - Bai-Rong Li
- Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd, Beijing, 100142, China
| | - Fu Yang
- Department of Medical Genetics, Naval Medical University, 800 Xiangyin Rd, Shanghai, 200433, China
| | - Jing Li
- Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd, Beijing, 100142, China
| | - Xiao-Wei Jin
- Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd, Beijing, 100142, China
| | - Shou-Bin Ning
- Department of Gastroenterology, Airforce General Hospital of PLA, 30 Fucheng Rd, Beijing, 100142, China.
| | - Shu-Han Sun
- Department of Medical Genetics, Naval Medical University, 800 Xiangyin Rd, Shanghai, 200433, China.
| |
Collapse
|
|
40
|
A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History. Dig Dis Sci 2017; 62:3014-3020. [PMID: 28986664 DOI: 10.1007/s10620-017-4741-5] [Citation(s) in RCA: 5] [Impact Index Per Article: 0.6] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 04/19/2017] [Accepted: 08/28/2017] [Indexed: 12/31/2022]
Abstract
BACKGROUND AND AIMS Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.
Collapse
|
|
41
|
Levels of Faecal Calprotectin and Magnetic Resonance Enterocolonography Correlate with Severity of Small Bowel Crohn's Disease: A Retrospective Cohort Study. Sci Rep 2017; 7:1970. [PMID: 28512287 PMCID: PMC5434057 DOI: 10.1038/s41598-017-02111-6] [Citation(s) in RCA: 10] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 01/31/2017] [Accepted: 04/05/2017] [Indexed: 12/18/2022] Open
Abstract
Few studies have evaluated the usefulness of fecal calprotectin (FC) or magnetic resonance enterography (MRE) in diagnosing active Crohn's disease (CD) of the small bowel. In the study, we investigated the reliability of FC and MRE in assessing the activity of ileal CD and further explored the relationship between levels of FC and MRE scores. A total of 221 patients were diagnosed with ileal or ileo-colitis CD in our department between July 2012 and October 2016. The global magnetic resonance index of activity (MaRIA) correlated with the simple endoscopic score for CD (SES-CD) (r = 0.527, P = 0.005). When analysed segment-by-segment, a significant correlation was still observed (r = 0.590, P < 0.001). The SES-CD correlated closest with FC (r = 0.503), followed by CRP (r = 0.461), ESR (0.377) and the CDAI (r = 0.320). In receiver operating characteristic (ROC) analyses, the FC cut-off value of mucosal healing was 213.1 μg/g, with 76.1% sensitivity and 66.7% specificity. As for MaRIA, a cut-off value of 6.8 for each segment provided a sensitivity of 100% and a specificity of 79.2%. No agreement between MaRIA and FC levels was found. In conclusion, a combination of FC levels and MaRIA could be effective in monitoring mucosal activity in patients with small bowel CD.
Collapse
|
|
42
|
Level of Fecal Calprotectin Correlates With Severity of Small Bowel Crohn's Disease, Measured by Balloon-assisted Enteroscopy and Computed Tomography Enterography. Clin Gastroenterol Hepatol 2017; 15:56-62. [PMID: 27565523 DOI: 10.1016/j.cgh.2016.08.015] [Citation(s) in RCA: 39] [Impact Index Per Article: 4.9] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 04/15/2016] [Revised: 08/05/2016] [Accepted: 08/11/2016] [Indexed: 02/07/2023]
Abstract
BACKGROUND & AIMS Previous studies have not found a correlation between fecal level of calprotectin and small bowel Crohn's disease (CD). However, these studies evaluated patients mainly by ileocolonoscopy, which views up to only the terminal ileum rather than entire small intestine. We investigated whether level of fecal calprotectin (FC) is a marker of active CD of the small bowel, identified by balloon-assisted enteroscopy and computed tomography enterography (CTE). METHODS We performed a prospective study of 123 patients with CD (35 with ileitis, 72 with ileocolitis, and 16 with colitis) evaluated by balloon-assisted enteroscopy from May 2012 through July 2015 at Toho University Sakura Medical Centre in Japan. Patients with strictures detected by balloon-assisted enteroscopy were evaluated by CTE (n = 17). Fecal samples were collected from each patient, and levels of calprotectin were measured; patient demographic variables and medical history were also collected. We developed a CTE scoring system for disease severity that was based on bowel wall thickness, mural hyperenhancement, and engorged vasa recta. The association between level of FC and simple endoscopic index for CD score or CTE was evaluated by using Spearman rank correlation coefficient. RESULTS Level of FC correlated with the simple endoscopic index for CD score (r = 0.6362, P < .0001), even in patients with only active disease of the small intestine (r = 0.6594, P = .0005). In the 17 patients with strictures that could not be passed with the enteroscope, CTE detected all lesions beyond the strictures as well as areas in the distal side of the strictures. Level of FC correlated with CTE score in these patients (r = 0.4018, P = .0011, n = 63). In receiver operating characteristic analyses, the FC cutoff value for mucosal healing was 215 μg/g; this cutoff value identified patients with healing with 82.8% sensitivity, 71.4% specificity, positive predictive value of 74.3%, negative predictive value of 80.6%, odds ratio of 12.0, and area under the receiver operating characteristic curve value of 0.81. CONCLUSIONS A combination of measurement of level of FC and CTE appears to be effective for monitoring CD activity in patients with small intestinal CD, including patients with strictures that cannot be passed by conventional endoscopy.
Collapse
|
|
43
|
Abstract
Since the introduction of double-balloon enteroscopy 15 years ago, flexible enteroscopy has become an established method in the diagnostic and therapeutic work-up of small bowel disorders. With appropriate patient selection, diagnostic and therapeutic yields of 70% to 85% can be expected. The complication rates with diagnostic and therapeutic DBE are estimated at approximately 1% and 3% to 4%, respectively. Appropriate patient selection and device selection, as well as skill, are the key issues for successful enteroscopy. However, technical developments and improvements mean that carrying out enteroscopy is likely to become easier.
Collapse
Affiliation(s)
- Andrea May
- Department of Gastroenterology, Sana Klinikum Offenbach GmbH, Starkenburgring 66, Offenbach am Main 63069, Germany.
| |
Collapse
|
|
44
|
Hahnemann M, Dechene A, Kathemann S, Sirin S, Gerken G, Lauenstein T, Kinner S. Diagnostic value of diffusion-weighted imaging (DWI) for the assessment of the small bowel in patients with inflammatory bowel disease. Clin Radiol 2017; 72:95.e1-95.e8. [DOI: 10.1016/j.crad.2016.08.007] [Citation(s) in RCA: 4] [Impact Index Per Article: 0.5] [Reference Citation Analysis] [Track Full Text] [Journal Information] [Subscribe] [Scholar Register] [Received: 06/01/2016] [Revised: 07/28/2016] [Accepted: 08/18/2016] [Indexed: 12/22/2022]
|
|
45
|
Pérez-Cuadrado-Robles E, Esteban-Delgado P, Martínez-Andrés B, Zamora-Nava LE, Rodrigo-Agudo JL, Chacón-Martínez S, Torrella-Cortes E, Shanabo J, López-Higueras A, Muñoz-Bertrán E, Hallal H, Latorre R, López-Albors O, Soria F, Bebia-Conesa P, Pérez-Cuadrado-Martínez E. [Diagnosis agreement between capsule endoscopy and double-balloon enteroscopy in obscure gastrointestinal bleeding at a referral center]. REVISTA ESPANOLA DE ENFERMEDADES DIGESTIVAS 2016; 107:495-500. [PMID: 26228953 DOI: 10.17235/reed.2015.3665/2015] [Citation(s) in RCA: 12] [Impact Index Per Article: 1.3] [Reference Citation Analysis] [Abstract] [MESH Headings] [Subscribe] [Scholar Register] [Indexed: 11/20/2022]
Abstract
BACKGROUND AND AIM Capsule endoscopy and double balloon enteroscopy are well-recognized procedures in obscure gastrointestinal bleeding, with many factors that may influence their diagnosis yield. The aim of the present study was to characterize the degree of agreement between both techniques with focus on the type of lesion in a large cohort of patients at a referral center. MATERIAL AND METHOD One thousand two hundred and nine capsules were administered in 1,078 patients and 381 enteroscopies were performed in 361 patients with obscure-gastrointestinal bleeding from 2004 to 2014. RESULTS Both procedures were carried out in 332 patients (mean age: 65.22 +/- 15.41, 183 men) and they have a similar diagnosis yield (70.5% vs. 69.6%, p = 0.9). Overall enteroscopy diagnosis yield was higher within patients with a previous positive capsule endoscopy (79.3% vs. 27.9%, p < 0.001). The degree of agreement was very good for polyps (0.89 [95% CI: 0.78-0.99]), good for vascular lesions (0.66 [95% CI: 0.55-0.77]) and tumors(0.66 [95% CI: 0.55-0.76]) and moderate for ulcers (0.56 [95% CI: 0.46-0.67]). Diverticula (0.39 [95% CI: 0.29-0.5]) achieved a fair agreement. The results of CE and DBE differed in 73 patients (22%). CONCLUSIONS The present study confirms that although overall diagnostic yield by capsule endoscopy and double-balloon enteroscopy is similar, there are many factors which can modify these values, mainly the type of lesion.
Collapse
|
|
46
|
Pasha SF, Leighton JA. Detection of suspected small bowel bleeding: challenges and controversies. Expert Rev Gastroenterol Hepatol 2016; 10:1235-1244. [PMID: 27366927 DOI: 10.1080/17474124.2016.1207525] [Citation(s) in RCA: 7] [Impact Index Per Article: 0.8] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Indexed: 12/22/2022]
Abstract
Detection of small bowel (SB) bleeding remains a challenge to gastroenterologists, with a dearth of standardized recommendations regarding evaluation and management. Areas covered: A recursive literature search was performed using PubMed, Cochrane and Medline databases for original and review articles on SB and obscure gastrointestinal bleeding (OGIB). Based upon the available literature, this review outlines the main challenges and controversies, and provides a practical and cost-effective approach towards SB bleeding. Expert commentary: SB bleeding is suspected in patients with persistent or recurrent bleeding after negative bidirectional endoscopy, and unexplained iron deficiency anemia. Selection of test(s) should be individualized based upon patient presentation and suspicion for type of underlying lesion. Endoscopic or radiologic evaluation and treatment is the mainstay in the majority of patients, while pharmacologic agents may have a role in patients with refractory bleeding, and those unable to undergo evaluation.
Collapse
Affiliation(s)
- Shabana F Pasha
- a Division of Gastroenterology and Hepatology , Mayo Clinic Arizona , Scottsdale , AZ , USA
| | - Jonathan A Leighton
- a Division of Gastroenterology and Hepatology , Mayo Clinic Arizona , Scottsdale , AZ , USA
| |
Collapse
|
|
47
|
Hong SN, Jang HJ, Ye BD, Jeon SR, Im JP, Cha JM, Kim SE, Park SJ, Kim ER, Chang DK. Diagnosis of Bleeding Meckel's Diverticulum in Adults. PLoS One 2016; 11:e0162615. [PMID: 27626641 PMCID: PMC5023169 DOI: 10.1371/journal.pone.0162615] [Citation(s) in RCA: 18] [Impact Index Per Article: 2.0] [Reference Citation Analysis] [Abstract] [MESH Headings] [Grants] [Track Full Text] [Download PDF] [Figures] [Journal Information] [Subscribe] [Scholar Register] [Received: 03/05/2016] [Accepted: 08/25/2016] [Indexed: 12/21/2022] Open
Abstract
BACKGROUND AND AIMS Various modalities have been used to diagnose Meckel's diverticulum (MD) in practice, but with their diagnostic accuracy deemed to be unsatisfactory for clinical practice. Moreover, the usefulness of these modalities has not been evaluated for the diagnosis of bleeding MD in adults, due to the relative rarity of this condition. Therefore, the aim of our multicenter study was to determine the most accurate modality for the preoperative diagnosis of bleeding MD in adults. METHODS We conducted a retrospective analysis of the diagnostic accuracy for small bowel bleeding associated with MD of different modalities in patients ≥18 years old who underwent assessment for MD, with confirmation at the time of explorative surgery. Diagnostic accuracy of the different modalities was evaluated against the diagnosis obtained using technetium-99m pertechnetate scintigraphy (also known as Meckel's scan), considered to be the gold standard for the diagnosis of bleeding MD in pediatrics. RESULTS Thirty-five adults were identified with bleeding in MD over the study period, between 2005 and 2012. Among these patients, only 24 (68.6%) were diagnosed with MD preoperatively. The mean (95% confidence interval) diagnostic accuracy of selected modalities was as follows: Meckel's scan, 21.4% (5.7%-51.2%); capsule endoscopy, 35.7% (14.0%-64.4%); balloon-assisted enteroscopy (BAE), 85.0% (61.1%-96.0%); angiography, 0.0% (0.0%-80.2%); computed tomography, 31.8% (14.7%-54.9%); and small-bowel follow-through, 62.5% (25.9%-90.0%). The diagnostic accuracy was significantly higher for BAE than for Meckel's scan (P = 0.001). CONCLUSIONS Among available diagnostic modalities, BAE provides the highest accuracy for the diagnosis of bleeding MD in adults and, therefore, should be considered as the preferred modality for preoperative diagnosis.
Collapse
Affiliation(s)
- Sung Noh Hong
- Department of Internal Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Republic of Korea
| | - Hyun Joo Jang
- Dongtan Sacred Heart Hospital, Hallym University College of Medicine, Hwaseong, Republic of Korea
- * E-mail:
| | - Byong Duk Ye
- Asan Medical Center, University of Ulsan College of Medicine, Seoul, Republic of Korea
| | - Seong Ran Jeon
- Institute for Digestive Research, Soonchunhyang University College of Medicine, Seoul, Republic of Korea
| | - Jong Pil Im
- Department of Internal Medicine and Liver Research Institute, Seoul National University College of Medicine, Seoul, Republic of Korea
| | - Jae Myung Cha
- Gang Dong Kyung Hee University Hospital, Kyung Hee University College of Medicine, Seoul, Republic of Korea
| | - Seong-Eun Kim
- Ewha Womans University College of Medicine, Seoul, Republic of Korea
| | - Soo Jung Park
- Institute of Gastroenterology, Yonsei University College of Medicine, Seoul, Republic of Korea
| | - Eun Ran Kim
- Department of Internal Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Republic of Korea
| | - Dong Kyung Chang
- Department of Internal Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Republic of Korea
| |
Collapse
|
|
48
|
Kopáčová M, Bureš J, Rejchrt S, Vávrová J, Bártová J, Soukup T, Tomš J, Tachecí I. Risk Factors of Acute Pancreatitis in Oral Double Balloon Enteroscopy. ACTA MEDICA (HRADEC KRÁLOVÉ) 2016; 59:84-90. [PMID: 27638962 DOI: 10.14712/18059694.2016.95] [Citation(s) in RCA: 2] [Impact Index Per Article: 0.2] [Reference Citation Analysis] [Abstract] [Key Words] [Track Full Text] [Subscribe] [Scholar Register] [Indexed: 12/24/2022]
Abstract
Double balloon enteroscopy (DBE) was introduced 15 years ago. The complications of diagnostic DBE are rare, acute pancreatitis is most redoubtable one (incidence about 0.3%). Hyperamylasemia after DBE seems to be a rather common condition respectively. The most probable cause seems to be a mechanical straining of the pancreas. We tried to identify patients in a higher risk of acute pancreatitis after DBE. We investigated several laboratory markers before and after DBE (serum cathepsin B, lactoferrin, E-selectin, SPINK 1, procalcitonin, S100 proteins, alfa-1-antitrypsin, hs-CRP, malondialdehyde, serum and urine amylase and serum lipase). Serum amylase and lipase rose significantly with the maximum 4 hours after DBE. Serum cathepsin and procalcitonin decreased significantly 4 hours after DBE compared to healthy controls and patients values before DBE. Either serum amylase or lipase 4 hours after DBE did not correlate with any markers before DBE. There was a trend for an association between the number of push-and-pull cycles and procalcitonin and urine amylase 4 hours after DBE; between procalcitonin and alfa-1-antitrypsin, cathepsin and hs-CRP; and between E-selectin and malondialdehyde 4 hours after DBE. We found no laboratory markers determinative in advance those patients in a higher risk of acute pancreatitis after DBE.
Collapse
Affiliation(s)
- Marcela Kopáčová
- 2nd Department of Medicine - Gastroenterology, Charles University, Faculty of Medicine in Hradec Králové, University Teaching Hospital, Hradec Králové, Czech Republic.
| | - Jan Bureš
- 2nd Department of Medicine - Gastroenterology, Charles University, Faculty of Medicine in Hradec Králové, University Teaching Hospital, Hradec Králové, Czech Republic
| | - Stanislav Rejchrt
- 2nd Department of Medicine - Gastroenterology, Charles University, Faculty of Medicine in Hradec Králové, University Teaching Hospital, Hradec Králové, Czech Republic
| | - Jaroslava Vávrová
- Institute of Clinical Biochemistry and Diagnostics, Charles University, Faculty of Medicine in Hradec Králové, University Teaching Hospital, Hradec Králové, Czech Republic
| | - Jolana Bártová
- 2nd Department of Medicine - Gastroenterology, Charles University, Faculty of Medicine in Hradec Králové, University Teaching Hospital, Hradec Králové, Czech Republic
| | - Tomáš Soukup
- 2nd Department of Medicine - Gastroenterology, Charles University, Faculty of Medicine in Hradec Králové, University Teaching Hospital, Hradec Králové, Czech Republic
| | - Jan Tomš
- 2nd Department of Medicine - Gastroenterology, Charles University, Faculty of Medicine in Hradec Králové, University Teaching Hospital, Hradec Králové, Czech Republic
| | - Ilja Tachecí
- 2nd Department of Medicine - Gastroenterology, Charles University, Faculty of Medicine in Hradec Králové, University Teaching Hospital, Hradec Králové, Czech Republic
| |
Collapse
|
|
49
|
Dişibeyaz S, Suna N, Kuzu UB, Saygılı F, Öztaş E, Ödemiş B, Önal İK, Kılıç ZMY, Akdoğan M, Kayaçetin E. Double balloon enteroscopy: A 7-year experience at a tertiary care Centre. Eur J Intern Med 2016; 33:108-11. [PMID: 27339642 DOI: 10.1016/j.ejim.2016.06.011] [Citation(s) in RCA: 4] [Impact Index Per Article: 0.4] [Reference Citation Analysis] [Abstract] [Key Words] [MESH Headings] [Track Full Text] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 12/19/2015] [Revised: 06/09/2016] [Accepted: 06/10/2016] [Indexed: 12/22/2022]
Abstract
BACKGROUND Double Balloon Enteroscopy (DBE) provides the opportunity not only to investigate but also apply endoscopic therapeutic interventions for small intestinal disturbances. The aim of this study is to assess the indications, diagnosis, therapeutic interventions, complications and safety in clinical practise of DBE procedures that have been performed in our clinic. MATERIAL-METHODS The data of patients who had undergone DBE procedure in our clinic between October 2007 and December 2014 were retrospectively investigated. All features including indications, findings, histopathological results, applied interventions and complications due to procedure were noted. RESULTS A total of 297 patients, 160 (53,9%) male and 137 (46,1%) female were enrolled in the study. Total number of procedures for these 297 patients were 372 [256 (68,8%) oral and 116 (31,2%) anal]. Mean age of the patients was 46,9 (14-94) years. The most common indications were; obscure gastrointestinal (GI) bleeding (28,3%), iron deficiency anaemia (17,5% ) and abnormal findings in a prior imaging study (13,8%), respectively. The rate of new diagnosis with DBE was 11.8%, where the rate for confirmation of a possible diagnosis was 16.2%, rate of endoscopic treatment with definite diagnosis was 11%, rate for ruling out possible diagnosis or showing normal findings was 34.7% and rate for insufficient or unsuccessful procedures was 26.3%. Ulcers, inflammation and erosions (13%), polyposis syndromes (9.8%) and vascular pathologies (7.4%) were the most common endoscopic findings. CONCLUSION Our study shows that DBE has high efficacy for diagnosis and ability to perform treatment of small intestinal disturbances with safety.
Collapse
Affiliation(s)
- Selçuk Dişibeyaz
- Turkiye Yuksek Ihtisas Education and Research Hospital, Department of Gastroenterology, M.D
| | - Nuretdin Suna
- Turkiye Yuksek Ihtisas Education and Research Hospital, Department of Gastroenterology, M.D
| | - Ufuk Barış Kuzu
- Turkiye Yuksek Ihtisas Education and Research Hospital, Department of Gastroenterology, M.D..
| | - Fatih Saygılı
- Turkiye Yuksek Ihtisas Education and Research Hospital, Department of Gastroenterology, M.D
| | - Erkin Öztaş
- Turkiye Yuksek Ihtisas Education and Research Hospital, Department of Gastroenterology, M.D
| | - Bülent Ödemiş
- Turkiye Yuksek Ihtisas Education and Research Hospital, Department of Gastroenterology, M.D
| | - İbrahim Koral Önal
- Turkiye Yuksek Ihtisas Education and Research Hospital, Department of Gastroenterology, M.D
| | - Zeki Mesut Yalın Kılıç
- Turkiye Yuksek Ihtisas Education and Research Hospital, Department of Gastroenterology, M.D
| | - Meral Akdoğan
- Turkiye Yuksek Ihtisas Education and Research Hospital, Department of Gastroenterology, M.D
| | - Ertuğrul Kayaçetin
- Turkiye Yuksek Ihtisas Education and Research Hospital, Department of Gastroenterology, M.D
| |
Collapse
|
|
50
|
Kim M, Jang HJ. The role of small bowel endoscopy in small bowel Crohn's disease: when and how? Intest Res 2016; 14:211-7. [PMID: 27433142 PMCID: PMC4945524 DOI: 10.5217/ir.2016.14.3.211] [Citation(s) in RCA: 11] [Impact Index Per Article: 1.2] [Reference Citation Analysis] [Abstract] [Key Words] [Download PDF] [Figures] [Journal Information] [Submit a Manuscript] [Subscribe] [Scholar Register] [Received: 03/09/2016] [Revised: 03/09/2016] [Accepted: 03/10/2016] [Indexed: 12/14/2022] Open
Abstract
Endoscopy has a crucial role in the diagnosis, management, and surveillance of inflammatory bowel disease (IBD). It contributes in supporting the diagnosis of IBD with the clinical history, physical examination, laboratory findings, and targeted biopsies. Furthermore, endoscopy has a significant role in assessing disease activity and distribution in treatment efficacy evaluation, post-surgical recurrence risk, and cancer surveillance in patients with long-lasting illness. Endoscopy also provides therapeutic potential for the treatment of IBD, especially with stricture dilatation and treatment of bleeding. Small bowel (SB) endoscopy (capsule endoscopy and device-assisted enteroscopy) and cross-sectional radiologic imaging (computed tomography enterography and magnetic resonance enterography) have become important diagnostic options to diagnose and treat patients with SB Crohn's disease. We reviewed the present role of SB endoscopy in patients with SB Crohn's disease.
Collapse
Affiliation(s)
- Mikang Kim
- Division of Gastroenterology, Department of Internal Medicine, Hallym University Dongtan Sacred Heart Hospital, Hwaseong, Gyeonggi-do, Korea
| | - Hyun Joo Jang
- Division of Gastroenterology, Department of Internal Medicine, Hallym University Dongtan Sacred Heart Hospital, Hwaseong, Gyeonggi-do, Korea
| |
Collapse
|