BPG is committed to discovery and dissemination of knowledge
Systematic Reveiws
©The Author(s) 2017.
World J Hepatol. May 18, 2017; 9(14): 677-688
Published online May 18, 2017. doi: 10.4254/wjh.v9.i14.677
Table 1 Overview of the modified Delphi, 18-point quality assessment checklist for studies included in the review
Ref.Yes responseNo responsePartiel reported/ unclearAssessment
Fattovich et al[21]1620High-quality
Diago et al[7]1521High-quality
Apolinario et al[9]1422High-quality
Darling et al[31]1413High-quality
Lagging et al[34]1431High-quality
Al-Ashgar[19]1332Low-quality
Derbala et al[32]1323Low-quality
Kurelac et al[33]1233Low-quality
Table 2 Baseline total patient number, number of male patients, mean age, body mass index and ethnicity for the 8 included studies
Ref.Patients
Mean ageBMIEthnicity
MalesTotal (n)(yr)(kg/m2)CaucasianAfrican AmericanAsian
Apolinario et al[9]406341 (± 9.3)5Information not providedInformation not provided6
1Lagging et al[34]16925222529
IL28B rs12979860 CC649341.6 (± 10.1)525.1 (± 3.6)5
IL28B rs12979860 CT7712341.9 (± 9.5)525.0 (± 3.5)5
IL28B rs12979860 TT283641.9 (± 11.4)525.0 (± 3.5)5
Diago et al[7]7713742 (± 9.7)5Information not providedInformation not provided
Fattovich et al[21]133226346 (± 11)524.7 (± 3.8)5226
Kurelac et al[33]174641.5 (± 12.4)523.7 (21.9-25)446
Darling et al[31]17627248.4 (± 7.4)5Information not provided138134
Darbala et al[32]14415946.47 (± 8.83)530.18 (± 5.05)5Information not provided7
Al-Ashgar et al[19]416438.7 (± 11.5)5Information not providedInformation not provided8
Table 3 Hepatitis C virus-RNA and patient liver enzyme status for the 8 included studies
Ref.HCV-RNA
Liver enzyme level
High viral load
Low viral load
All patientsASTALT
nLimitnLimit
Apolinario et al[9]28≥ 6.3 log IU/mL535< 6.3 log IU/mL5118 IU/L (± 64) $
1Lagging et al[34]
IL28B rs12979860 CC6.3 log IU/mL (± 0.8)3Information not provided
IL28B rs12979860 CT6.1 log IU/mL (± 0.7)3
IL28B rs12979860 TT5.9 log IU/mL (± 0.8)3
Diago et al[7]85≥ 5.7 log IU/mL552< 5.7 log IU/mL5117.2 IU/L (± 81.6)3
Fattovich et al[21]147≥ 5.6 log IU/mL55.74 log IU/mL (± 0.9)3592 IU/L (± 78)3
Kurelac et al[33]5.55 log IU/mL (5.52-6.1)25Information not provided
Darling et al[31]6.66 log IU/mL (± 6.76)3590.9 IU/L (72.9)3
Darbala et al[32]4.95 log IU/mL (3.6-5.63)4538 IU/L (27-51)451 IU/L (34-87)4
Al-Ashgar et al[19]45≥ 5.78 log IU/mL19< 5.78 log IU/mL567.5 IU/L (43.5-106.8)256.0 IU/L (32.0-86.0)2
Table 4 Genotype and liver fibrosis stage for the 8 included studies
Ref.Genotype (n)
MethodLiver fibrosis stage
12340123456
Apolinario et al[9]4320Scheuer score2835
Lagging et al[34]41701231491111Ishak score11616530152014
IL28B rs12979860 CC441333331827115125
IL28B rs12979860 CT9671557352717766
IL28B rs12979860 TT3031318112323
Diago et al[7]103925Ishak score10631
Fattovich et al[21]928747Metavir212121
Kurelac et al[33]46Ishak3412
Darling et al[31]272Ishak22052
Darbala et al[32]159Scheuer score10950
Ashgar et al[19]64Metavir34310 3
Table 5 Overview of the treatment regimens for pegylated interferon in combination with ribavirin, for the 8 studies included, in relation to dose and duration
Ref.GenotypeDurationInterferon treatmentRibavirin treatment
Apolinario et al[9]Multi-centerpatients148 wk180 μg peg-INF-α-2a once weekly800 mg per day or 1000 mg < 75 kg, 1200 mg > 75 kg
Non-124-48 wk
Out patiens148 wkpeg-INF-α2b 1.5 μg/kg per week1000-1200 mg per day
Non-124 wk
Lagging et al[34]16 wk1180 μg peg-INF-α-2a once weekly1000 mg < 75 kg, 1200 mg > 75 kg per day
Diago et al[7]148 wkpeg-INF-α-2b 1.5 μg/kg per week or 180 μg peg-INF-α-2a/week1000 mg < 75 kg, 1200 mg > 75 kg per day
Non-124 wk
Fattovich et al[21]1 and 448 wkpeg-INF-α-2b 1.5 μg/kg per week or 180 μg peg-INF-α-2a/week800-1200 mg per day
2 and 324 wk
Kurelac et al[33]148 wkpeg-INF-α-2b 1.5 μg/kg per weekWeight based ribavirin treatment2
Darling et al[31]148 wk180 μg peg-INF-α-2a once weekly1000-1200 mg per day
Derbala et al[32]448 wkPeg-IFN once weekly31000 mg < 75 kg, 1200 mg > 75 kg per day
Al-Ashgar[19]448 wk180 μg peg-INF-α-2a once weekly1000 mg < 75 kg, 1200 mg > 75 kg
Table 6 Overview of the marker distribution, in the four studied that supplied information on interleukin 28B single nucleotide polymorphism
Ref.Genotype (n)rs12979860
rs12980275
rs8099917
rs11881222
CCCTTTAAAGGGTTTGGGAAAGGG
Lagging et al[30]1 (253)9312337101115371539010
Fattovich et al[21]1 (92)33441533451449385
2 (87)34431034421147346
3 (47)252112520234130
Darling et al[31]1 (201)6310344
Derbala et al[32]4 (159)57772596558647520
Table 7 Overview of rapid virological response in the 3 studies providing information on baseline inducible protein-10’s, and hepatitis C virus RNA levels at week 4
Ref.Patients (n)IP-10 measurement methodGenotype (n)Baseline IP-10 concentration, grouped by rapid virological response (pg/mL)
Overall RVR (n)
RVRNon-RVRP-valueRVRNon-RVR
Lagging et al[34]170ELISA (Quantikine, R and D systems, Minneapolis, MN, United States)1 (170)222401P < 0.01 (median)33137
1Fattovich et al[21]226ELISA (Quantikine, R and D systems, Minneapolis, MN, United States)1 (92)2.4 (± 0.28)2.6 (± 0.25)P < 0.01 (log mean ± SD)172108
2 (87)2.38 (± 0.31)2.3 (± 0.30)P > 0.05 (log mean ± SD)
3 (47)2.45 (± 0.23)2.48 (± 0.39)P > 0.05 (log mean ± SD)
Al-Ashgar et al[19]64ELISA (Quantikine, R and D systems, Minneapolis, MN, United States)4 (64)483.9 (± 261.6)609.9 (±424.3)P > 0.05 (mean ± SD)1252
Table 8 Overview of sustained viral response in the 8 studies providing information on baseline inducible protein-10’s, and hepatitis C virus-RNA levels 24 wk after end-of- treatment
Ref.Patients (n)IP-10 measurement methodGenotype (n)Baseline IP-10 concentration, grouped by sustained virological response (pg/mL)
Overall SVR
SVRNon-SVRP-valueSVRNon-SVR
Apolinario et al[9]63ELISA (OptEIA, Pharmingen, San Diego, CA, United States)1 (43)245 (± 154)381 (± 138)P < 0.05 (mean ± SD)3627
Diago et al[7]137ELISA (Human immunoassay kit; BioSource Europe SA, Nivelles, Belgium1 (103)347 (± 197.4)500.6 (± 311.2)P < 0.01 (mean ± SD)792582
1 (103)332.4 (± 222.1)476.8 (± 305.3)P < 0.01 (mean ± SD)
2 (9)
3 (25)
1Fattovich et al[21]226ELISA (Quantikine, R and D systems, Minneapolis, MN, United States )1 (92)2.47 ± 0.232.65 ± 0.28P < 0.001 (log mean ± SD)2092712
2 (87)2.37 ± 0.312.33 ± 0.35P > 0.05 (log mean ± SD)
3 (47)2.42 ± 0.212.67 ± 0.46P < 0.05a (log mean ± SD)
Kurelac et al[33]46ELISA (Quantikine, R and D systems, Minneapolis, MN, United States )1 (46)185 (63-518)395.5 (111-926)P < 0.0001 (median, range)2620
Darling et al[31]272ELISA (Quantikine, R and D systems, Minneapolis, MN, United States )1 (272)437 (± 31)704 (± 44)P < 0.001 (mean ± SD)157115
Derbala et al[32]159Luminex, Cytokine multiplex immunoassay kit (Merck Millipore, Billerica, MA, United States)4 (159)Exact data not provided, only graphic presentationP < 0.001 (median, IQR)9861
Al-Ashgar et al[19]64ELISA (Quantikine, R andD systems, Minneapolis, MN, United States )4 (64)462 (± 282.6)840.4 (± 490.6)P < 0.01 (mean ± SD)4123


Write to the Help Desk