BPG is committed to discovery and dissemination of knowledge
Case Control Study
©The Author(s) 2020.
World J Hepatol. Apr 27, 2020; 12(4): 137-148
Published online Apr 27, 2020. doi: 10.4254/wjh.v12.i4.137
Table 1 Probes and conditions used in the polymerase chain reaction to genotype interleukin 6 single nucleotide polymorphism at position-174 (rs1800795)
IL-6 Gene-174 (rs1800795)
ACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA60 ºC–1 min; 95 ºC–10 min; 50 cycles (95 ºC–15 s, 60 ºC–90 s) and 60 ºC–1 min
Table 2 The interleukin genotype distribution in patients with chronic hepatitis C (n = 245) and healthy controls (n = 179)
VariablesCHC, n (%)Control, n (%)P value
IL-6 genotypes
-1740.81
C/C18 (7.3)13 (7.3)
G/C85 (34.7)68 (38.0)
G/G142 (58.0)98 (54.7)
Total245 (100)179 (100)
HWE (P value)0.380.95
Table 3 Demographic, clinical comorbidity, nutritional status, liver fibrosis stage, virological, cytokine genotyping data of the chronically hepatitis C virus-infected patients with (n = 51) and without type 2 diabetes (n = 194)
VariablesType 2 diabetes, n (%)Non-type 2 diabetes, n (%)P value
Demographic
Male27 (52.9)102 (52.6)1.0
Female24 (47.1)92 (47.4)
Age (yr)155.5 ± 9.650.9 ± 11.70.01
Clinical comorbidity
Blood hypertension36 (70.6)62 (32.0)< 0.001
Nutritional status
Body mass index (Kg/m2)227.0 (24.1-29.7)25.6 (23.5-28.4)0.11
Stage of liver disease
Chronic hepatitis C28 (54.9)123 (63.4)0.34
Liver cirrhosis23 (45.1)71 (36.6)
Virological parameters
Viral load HCV-RNA [Log10 (IU/mL)]25.98 (5.66-6.24)5.84 (5.30-6.40)0.38
Genotype 140/45 (88.9)130/159 (81.7)0.37
IL-6 polymorphism
IL-6-174G/G genotypes0.04
G/G37 (72.5)105 (54.1)
G/C13 (25.5)72 (37.1)
C/C1 (2.0)17 (8.8)
Total51 (100.0)194 (100.0)
HWE (P value)0.650.47
Table 4 Variables associated with diabetes mellitus in patients with chronic hepatitis C
VariablesMultivariate analysis
OR95%CIP value
Age1.010.98-1.050.43
Body mass index1.030.96-1.090.45
Hypertension5.562.79-11.09< 0.001
IL-6-174 G/C (GC and CC)0.420.22-0.780.006


Write to the Help Desk