©The Author(s) 2020.
World J Hepatol. Oct 27, 2020; 12(10): 775-791
Published online Oct 27, 2020. doi: 10.4254/wjh.v12.i10.775
Published online Oct 27, 2020. doi: 10.4254/wjh.v12.i10.775
Table 1 Sites of sample collection
| Types of locations of sample collection | Detailed description of the actual sites of collection | Co-ordinates | Distance from central Kolkata1 (in Km) | Number of currency samples collected (n = 70) | Number of samples that are hepatitis B virus-positive |
| Hospitals | Nil Ratan Sircar Medical College and Hospital | 22.5638° N, 88.3690° E | 2.6 | 2 | 1 HBV-positive (S5) |
| SSKM Hospital | 22.5396° N, 88.3439° E | 4.8 | 2 | - | |
| Chittaranjan National Cancer Institute (CNCI) | 22.5254° N, 88.3465° E | 3.7 | 2 | - | |
| Calcutta National Medical College and Hospital (CNMC) | 22.5467° N, 88.3704° E | 4.5 | 3 | 1HBV-positive (S8) | |
| KPC Medical College and Hospital | 22.4956° N, 88.3706° E | 9.3 | 4 | - | |
| Public transport routes (bus): First stop and last stop | 2302(Kamarhati to Alipore Zoo) | 22.6847° N, 88.3706° E-22.5248° N, 88.3312° E | 13.4 - 5.1 | 4 | - |
| 47B (Lake town to Super Market, Prince Anwar Shah Road) | 22.6070° N, 88.4028° E-22.5015° N, 88.3617° E | 19.4-7.5 | 5 | - | |
| 3C/1 (Anandapur to Nagerbazar) | 22.5148° N, 88.4098° E-22.6218° N, 88.4180° E | 11.5 -19.7 | 5 | - | |
| 45 (Dumdum to Baishnabghata) | 22.6471° N, 88.4317° E-22.4729° N, 88.3764° E | 22.8-11.4 | 5 | - | |
| S9 (Jadavpur to Karunamoyee) | 22.4956° N, 88.3706° E-22.5851° N, 88.4222° E | 8.8 -13.5 | 5 | 1 HBV-positive (S6) | |
| Grocery shop | Shyam Bazar | 22.5982° N, 88.3687° E | 6.2 | 3 | - |
| Big Bazaar, Ganguli Bagan | 22.4800° N, 88.3757° E | 18.2 | 3 | - | |
| South City Mall | 22.5015° N, 88.3617° E | 7.5 | 4 | - | |
| Dunlop | 22.6519° N, 88.3786° E | 12.4 | 4 | - | |
| Gariahat | 22.5170° N, 88.3658° E | 6.7 | 4 | - | |
| Fish-meat market | Howrah | 22.5958° N, 88.2636° E | 6.1 | 2 | 1 HBV-positive (S7) |
| Baguihati | 22.6107° N, 88.4271° E | 18.3 | 4 | - | |
| Hazra | 22.5228° N, 88.3500° E | 4.3 | 4 | - | |
| Jadavpur | 22.4956° N, 88.3706° E | 8.8 | 2 | 1 HBV-positive (S9) | |
| Gariahat | 22.5170° N, 88.3658° E | 6.7 | 3 | - |
Table 2 Oligonucleotide primers used for amplifying target genes in hepatitis B virus
| Name | Sequence 5’-3’ | Amplicon size (bp) | Reference |
| SPL-3-F | GCGCGCGCTAGCACCATGGGGARCAYCRYATCRGGA | 1652 | [7] |
| SPL-2-R | GCCTTTGCAAGCTTCASACCAATTTATGCCTAC | ||
| SPL-4-F | ACCACAGAGTCTAGACTYGTGGT | 1277 | |
| SPL-5-R | GGTCGGAACRRCAGRCGRAGAAG | ||
| HBVRT-F | GTGTCTGCGGCGTTTTATCA | 98 | This study |
| HBVRT-R | GACAAACGGGCAACATACCTT |
- Citation: Das P, Supekar R, Chatterjee R, Roy S, Ghosh A, Biswas S. Hepatitis B virus detected in paper currencies in a densely populated city of India: A plausible source of horizontal transmission? World J Hepatol 2020; 12(10): 775-791
- URL: https://www.wjgnet.com/1948-5182/full/v12/i10/775.htm
- DOI: https://dx.doi.org/10.4254/wjh.v12.i10.775
