BPG is committed to discovery and dissemination of knowledge
Basic Study
©The Author(s) 2020.
World J Hepatol. Oct 27, 2020; 12(10): 775-791
Published online Oct 27, 2020. doi: 10.4254/wjh.v12.i10.775
Table 1 Sites of sample collection
Types of locations of sample collection
Detailed description of the actual sites of collection
Co-ordinates
Distance from central Kolkata1 (in Km)
Number of currency samples collected (n = 70)
Number of samples that are hepatitis B virus-positive
HospitalsNil Ratan Sircar Medical College and Hospital22.5638° N, 88.3690° E2.6 21 HBV-positive (S5)
SSKM Hospital22.5396° N, 88.3439° E4.82-
Chittaranjan National Cancer Institute (CNCI)22.5254° N, 88.3465° E3.72-
Calcutta National Medical College and Hospital (CNMC)22.5467° N, 88.3704° E4.531HBV-positive (S8)
KPC Medical College and Hospital22.4956° N, 88.3706° E9.34-
Public transport routes (bus): First stop and last stop2302(Kamarhati to Alipore Zoo)22.6847° N, 88.3706° E-22.5248° N, 88.3312° E13.4 - 5.14-
47B (Lake town to Super Market, Prince Anwar Shah Road)22.6070° N, 88.4028° E-22.5015° N, 88.3617° E19.4-7.55-
3C/1 (Anandapur to Nagerbazar)22.5148° N, 88.4098° E-22.6218° N, 88.4180° E11.5 -19.75-
45 (Dumdum to Baishnabghata)22.6471° N, 88.4317° E-22.4729° N, 88.3764° E22.8-11.45-
S9 (Jadavpur to Karunamoyee)22.4956° N, 88.3706° E-22.5851° N, 88.4222° E8.8 -13.551 HBV-positive (S6)
Grocery shopShyam Bazar 22.5982° N, 88.3687° E6.23-
Big Bazaar, Ganguli Bagan22.4800° N, 88.3757° E18.23-
South City Mall22.5015° N, 88.3617° E7.54-
Dunlop 22.6519° N, 88.3786° E12.44-
Gariahat22.5170° N, 88.3658° E6.74-
Fish-meat marketHowrah22.5958° N, 88.2636° E6.121 HBV-positive (S7)
Baguihati22.6107° N, 88.4271° E18.34-
Hazra22.5228° N, 88.3500° E4.34-
Jadavpur22.4956° N, 88.3706° E8.821 HBV-positive (S9)
Gariahat22.5170° N, 88.3658° E6.73-
Table 2 Oligonucleotide primers used for amplifying target genes in hepatitis B virus
Name
Sequence 5’-3’
Amplicon size (bp)
Reference
SPL-3-FGCGCGCGCTAGCACCATGGGGARCAYCRYATCRGGA1652[7]
SPL-2-RGCCTTTGCAAGCTTCASACCAATTTATGCCTAC
SPL-4-FACCACAGAGTCTAGACTYGTGGT1277
SPL-5-RGGTCGGAACRRCAGRCGRAGAAG
HBVRT-FGTGTCTGCGGCGTTTTATCA98This study
HBVRT-RGACAAACGGGCAACATACCTT


Write to the Help Desk