Published online Apr 27, 2020. doi: 10.4254/wjh.v12.i4.137
Peer-review started: December 29, 2019
First decision: February 16, 2020
Revised: February 28, 2020
Accepted: March 22, 2020
Article in press: March 22, 2020
Published online: April 27, 2020
Processing time: 115 Days and 11.6 Hours
Chronic hepatitis C (CHC) is associated with type 2 diabetes mellitus. Although the pathogenesis remains to be elucidated, a growing evidence has suggested a role of pro-inflammatory immune response. Increased serum concentrations of Interleukin 6 (IL-6) have been associated with insulin resistance, type 2 diabetes mellitus as well as advanced forms of liver disease in chronic hepatitis C infection.
To investigate the frequency of IL-6-174G/C (rs1800795) single nucleotide polymorphism (SNP) in CHC patients and in healthy subjects of the same ethnicity. Associations between type 2 diabetes mellitus (dependent variable) and demographic, clinical, nutritional, virological and, IL-6 genotyping data were also investigated in CHC patients.
Two hundred and forty-five patients with CHC and 179 healthy control subjects (blood donors) were prospectively included. Type 2 diabetes mellitus was diagnosed according to the criteria of the American Diabetes Association. Clinical, biochemical, histological and radiological methods were used for the diagnosis of the liver disease. IL-6 polymorphism was evaluated by Taqman SNP genotyping assay. The data were analysed by logistic regression models.
Type 2 diabetes mellitus, blood hypertension and liver cirrhosis were observed in 20.8% (51/245), 40.0% (98/245) and 38.4% (94/245) of the patients, respectively. The frequency of the studied IL-6 SNP did not differ between the CHC patients and controls (P = 0.81) and all alleles were in Hardy-Weinberg equilibrium (P = 0.38). In the multivariate analysis, type 2 diabetes mellitus was inversely associated with GC and CC genotypes of IL-6-174 (OR = 0.42; 95%CI = 0.22-0.78; P = 0.006) and positively associated with blood hypertension (OR = 5.56; 95%CI = 2.79-11.09; P < 0.001).
This study was the first to show that GC and CC genotypes of IL-6-174 SNP are associated with a decreased risk of type 2 diabetes mellitus in patients chronically infected with hepatitis C virus. The identification of potential inflammatory mediators involved in the crosstalk between hepatitis C virus and the axis pancreas-liver remains important issues that deserve further investigations.
Core tip: Chronic hepatitis C is associated with type 2 diabetes mellitus. Previous studies have demonstrated associations between increased serum concentrations of Interleukin 6 (IL-6) and type 2 diabetes and advanced forms of liver disease. However, the role played by IL-6-174G/C single nucleotide polymorphism on the pathogenesis of hepatitis C virus-associated type 2 diabetes remains to be elucidated. To the best of our knowledge, this is the first study to demonstrate that the GC and GG genotypes of IL-6 are inversely associated with type 2 diabetes. We believe that our results may contribute to the understanding of the extra-hepatic manifestations in hepatitis C.
- Citation: da Silva CB, Vieira DA, de Melo LF, Chagas ALS, Gomes AD, Faria Jr CLL, Teixeira R, de Magalhães Queiroz DM, Rocha GA, Soares MMS, Bezerra JMT, Silva LD. Interleukin-6-174G/C polymorphism is associated with a decreased risk of type 2 diabetes in patients with chronic hepatitis C virus. World J Hepatol 2020; 12(4): 137-148
- URL: https://www.wjgnet.com/1948-5182/full/v12/i4/137.htm
- DOI: https://dx.doi.org/10.4254/wjh.v12.i4.137
Core tip: Chronic hepatitis C is associated with type 2 diabetes mellitus. Previous studies have demonstrated associations between increased serum concentrations of Interleukin 6 (IL-6) and type 2 diabetes and advanced forms of liver disease. However, the role played by IL-6-174G/C single nucleotide polymorphism on the pathogenesis of hepatitis C virus-associated type 2 diabetes remains to be elucidated. To the best of our knowledge, this is the first study to demonstrate that the GC and GG genotypes of IL-6 are inversely associated with type 2 diabetes. We believe that our results may contribute to the understanding of the extra-hepatic manifestations in hepatitis C.
Globally, an estimated 422 million adults have diabetes mellitus[1] and around 71 million people are living with hepatitis C virus (HCV) infection[2,3]. Over the past two decades, an accumulating body of scientific evidence has been linked type 2 diabetes mellitus to HCV infection[4-11]. Given the high prevalence and the worldwide distribution of these two comorbidities, their association have an utmost impact on public health[1-3].
In pioneering study, in 1898, Naunyn firstly described an association between liver cirrhosis and diabetes mellitus that it is known as hepatogenous diabetes[12]. Hence, cirrhosis per se might lead to glucose intolerance or diabetes mellitus. The prevalence of diabetes in cirrhotic patients with non-alcoholic fatty liver disease, cryptogenic, hepatitis C, and alcoholic hepatopathy ranges from 27.3% to 56.1%[13]. Regarding the HCV and the non-alcoholic fatty hepatic disease we have to bear in mind that type 2 diabetes mellitus can be detected prior to the onset of hepatic cirrhosis[13-15] promoting a vicious cycle of hyperglycaemia causing a worsening metabolic state. Thus, altogether, glucose disturbed metabolism and HCV enhance the chronic inflammation and might interact as a reciprocal feed-forward loop[16-19].
The pathogenesis of type 2 diabetes mellitus encompasses both different degrees of insulin resistance and relative insulin deficiency[20,21]. Although, some mechanisms underlying the modified glucose metabolism in HCV infection have been elucidated[22-24], several aspects remain unknown. Additionally, Chronic hepatitis C (CHC) patients with type 2 diabetes mellitus are likely to have an accelerated liver disease progression, i.e., hepatic fibrosis, cirrhosis and hepatocellular carcinoma[25-28]. Various factors can be involved in this interaction including direct viral effects and host factors, such as overweight and pro-inflammatory markers[16,17,29,30]. Among the inflammatory markers, increased serum concentrations of interleukin-6 (IL-6) have been associated with insulin resistance, type 2 diabetes mellitus as well as advanced forms of liver disease in chronic hepatitis C infection[31-39].
Polymorphisms in the IL-6 gene, which may alter the expression of IL-6, have been investigated in the context of metabolic disease and CHC[31,32,34-42]. The association between the single nucleotide polymorphism (SNP) of IL-6 located in the promoter region at the position-174G/C (rs1800795) and type 2 diabetes mellitus was first reported in United States Pima Indians and Spanish Caucasians[43]. The C-allele was significantly associated with a decreased risk of type 2 diabetes. However, in further investigations these results have not been confirmed[34,39]. In the setting of hepatitis C, IL-6 SNP polymorphisms have been associated with hepatic-and extra hepatic-related outcomes, such as cirrhosis, hepatocellular carcinoma and poor quality of life[31,32,40-42]. Altogether, both in vitro experiments and clinical studies including healthy individuals have demonstrated that the presence of C allele is associated with lower levels of IL-6[44-46]. The interrelationship between decreased concentration of this cytokine and IL-6-174 SNP is more pronounced in individuals carrying the CC genotype[44-46].
Because the host’s immune response play an important role in extrahepatic manifestations in subjects chronically infected with HCV, even before the onset of hepatic cirrhosis, we hypothesized that IL-6-174G/G genotype, the IL-6 high-producer phenotype, may be associated to a high inflammatory profile that negatively affects the course of type 2 diabetes mellitus in these patients. Additionally, these factors may accelerate the liver fibrosis that also affects the insulin resistance. Thus, we evaluated the frequency of IL-6-174G/C SNP in patients chronically infected with HCV and in healthy subjects of the same ethnicity. Associations between type 2 diabetes mellitus (dependent variable) and demographic, clinical, nutritional, virological and, IL-6 genotyping data were also investigated in CHC patients.
From March 2017 to July 2019, we prospectively included 260 adult patients with confirmed CHC diagnosis attending the Viral Hepatitis Outpatient Clinic, University Hospital, Belo Horizonte, Brazil. The control group consisted of 179 consecutive volunteer blood donors from the hemocenter of Felício Rocho Hospital (Hemoter - Clínica Romeu Ibrahim de Carvalho), Belo Horizonte, Brazil. The Viral Hepatitis Outpatient Clinic is an outpatient care ambulatory of a metropolitan tertiary teaching hospital that admits patients for the treatment of viral chronic hepatitis. All participants signed the informed consent form. The study was designed and conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of Federal University of Minas Gerais/UFMG (ETIC 0404.0.203.000-10).
The exclusion criteria were: Pregnancy, breastfeeding, hepatic encephalopathy, HBV/HCV or HCV/HIV co-infection, current antiviral, use of non-steroidal anti-inflammatory drugs or corticosteroids, and the presence of advanced disease such as chronic kidney disease, heart failure, chronic pulmonary disease, chronic pancreatitis and neoplasia, including hepatocellular carcinoma.
Clinical, biochemical, histological and radiological methods were performed for the diagnosis of the liver disease[47,48]. The severity of liver dysfunction was assessed by the Child-Pugh-Turcotte score[49]. Compensated cirrhosis was defined as the absence of variceal bleeding, ascites and oedema, jaundice or symptomatic encephalopathy on physical examination, and decompensated cirrhosis as the presence of any of these complications[50]. The aspartate amino transferase to platelet ratio index[51] was calculated for each participant based on medical data.
The diagnosis of type 2 diabetes mellitus was based on documented use of oral hypoglycaemic medication or insulin; random plasma glucose levels ≥ 200 mg/dL in the presence of classic symptoms of hyperglycaemia or hyperglycaemic crisis; fasting plasma glucose ≥ 126 mg/dL on two occasions; 2 h plasma glucose ≥ 200 mg/dL during oral glucose tolerance test or haemoglobin A1c ≥ 6.5% on two occasions[52].
Blood hypertension was diagnosed according to the 2018 European Society of Hypertension/European Society of Cardiology Guidelines[53].
An expert nutritionist carried out all nutritional evaluations. Weight and height were measured with a mechanical platform scale (FILIZOLA®, São Paulo, Brazil). Body mass index was calculated using the formula, Body mass index = weight/height2 and the nutritional status of the patients were determined according to the World Health Organization criteria[54]. Elderly individuals were classified according to the Lipschitz classification[55].
Furthermore, an in-person interview was conducted using instruments to assess the sociodemographic and clinical characteristics of the patients. Fifteen patients were not included: Twelve patients who had initially agreed to take part in this study failed to complete the questionnaires; three patients were excluded because blood sample was inadequate for genotyping. Two hundred and forty-five patients and 179 healthy subjects remained in the study.
All participants were from a similar socioeconomic level, as assessed by a previously validated questionnaire[56], which was based on income and educational level, as well as similar cultural habits. All subjects were natives of Minas Gerais, state in the south-eastern region of Brazil with the following ethnic background: 56.0% of European ancestry, 32.0% of African ancestry and 12.0% of Amerindian ancestry homogeneously present in each patient, irrespective of their phenotype[57].
Blood samples were obtained from each subject after an overnight fasting for cytokine genotyping and biochemical assessments. Alanine aminotransferase, aspartate aminotransferase, gamma-glutamyl transpeptidase alkaline phosphatase, albumin, total bilirubin, prothrombin time and hemogram were evaluated by using Vitros® 5600 (Ortho Clinical Diagnosis, Raritan, NJ, United States).
HCV genotype was determined by a line probe assay (VERSANT HCV genotyping assays; Bayer’s Diagnostic Corporation, Tarrytown, NY, United States ) and viral load assessed by a commercial test (CobasTaqMan HCV test V.2.0; Roche Molecular Systems, Pleasanton, CA, United States). The assays were carried out according to the manufacturers’ recommendations.
Aliquots of leukocytes and plasma were stored at -80 ºC until analysis.
DNA was extracted from the leukocytes with the QIAmp DNA mini kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer's recommendations. DNA concentration and purity were evaluated by spectrophotometry (NanoDrop Lite Spectrophotometer, Thermo Scientific, Waltham, MA, United States). DNA concentration was determined by absorbance at 260 nm and purity was assessed by the absorbance ratio at 260/280 nm. The DNA of the samples was stored at -20 °C before use.
IL-6-174G/C (rs1800795) genotyping was Taqman assayed by Real Time PCR System 7.500 (Applied Biosystems, Thermo Scientific, Foster City, CA, United States ) by using oligonucleotide primers previously described by Fishman et al[44]. The sequence of synthetic probes and reaction conditions are described in Table 1.
| IL-6 Gene-174 (rs1800795) | |
| ACTTTTCCCCCTAGTTGTGTCTTGC[C/G]ATGCTAAAGGACGTCACATTGCACA | 60 ºC–1 min; 95 ºC–10 min; 50 cycles (95 ºC–15 s, 60 ºC–90 s) and 60 ºC–1 min |
The Hardy-Weinberg equilibrium of alleles at individual loci was assessed by two-tailed χ2 test or Fisher’s exact test.
Data were analysed with SPSS statistical software package version 17.0 (SPSS Inc., Chicago, IL, United States). Descriptive statistics were used to provide information regarding demographic, clinical, nutritional, virological, and genetic data. The Shapiro-Wilk test was used to evaluate whether the data were normally distributed. The asymptotic Pearson’s χ2 test was used to compare the percentages. The Student's t-test or ANOVA was used to compare the means and the two-tailed Mann-Whitney U test was used for medians.
The associations of each variable including IL-6-174G/C, sex, increasing age, blood hypertension, nutritional status, liver fibrosis stage (chronic hepatitis and cirrhosis) with type 2 diabetes mellitus were tested in univariate analysis. All variables with P values < 0.20 were included in the full model of logistic regression. Odds ratio and 95%CI were used as an estimate of the risk. The Hosmer-Lemeshow test was used to assess the adequacy of the models. Variables that had missing data > 10% were not selected for the models of multivariate analysis. P values ≤ 0.05 were considered significant.
The frequencies of the IL-6 SNP did not differ between CHC patients and blood donors (Table 2). All alleles were in Hardy-Weinberg equilibrium in the control group (P > 0.95) and in the CHC patients (P > 0.38) as shown in Table 2.
| Variables | CHC, n (%) | Control, n (%) | P value |
| IL-6 genotypes | |||
| -174 | 0.81 | ||
| C/C | 18 (7.3) | 13 (7.3) | |
| G/C | 85 (34.7) | 68 (38.0) | |
| G/G | 142 (58.0) | 98 (54.7) | |
| Total | 245 (100) | 179 (100) | |
| HWE (P value) | 0.38 | 0.95 |
Among the 245 patients with CHC, 94 (38.4%) had cirrhosis [Child-Turcotte-Pugh score A5, 60 (63.8%); A6, 21 (22.3%); B7, 6 (6.4%); B8, 4 (4.3%); B9, 2 (2.1%); C10, 1, (1.1%)]. The mean age of the patients was 51.8 ± 11.4 years and 129 (52.7%) were males.
Cirrhosis was significantly more frequent (P = 0.03) in males (61.7%) than in females (38.3%). The patients with cirrhosis (53.5 ± 8.8 year) were older (P = 0.05) than those without (50.8 ± 12.7 year). Overweight tended to be more frequent (P = 0.08) in the CHC patients without (64.9%) than in those with cirrhosis (53.2%).
There was no significant difference (P = 0.11) in blood hypertension rate between CHC patients with cirrhosis (46.8%) and those without (35.8%). The frequency of type 2 diabetes did not differ (P = 0.33) between the two groups (24.5% in cirrhotic and 18.5% in non-cirrhotic patients).
There was no significant difference (P = 0.58) in the viral load between patients without [HCV-RNA log10 (IU)/mL, 5.93 (interquartile range: 5.46-6.39)] and those with cirrhosis [5.86: (interquartile range: 5.34-6.20)]. Also, the frequency of HCV Genotype 1 in patients without cirrhosis [109/126 (86.5%)] did not differ (P = 0.25) from that of patients with [61/78 (78.2%)]. The quantification of viral load and HCV genotyping were available in 213/245 (86.9%) patients.
Fifty-one (20.8%) patients had type 2 diabetes mellitus that was significantly more frequent in older patients (Table 3). The prevalence of blood hypertension was higher in type 2 diabetes mellitus than in those without the disease (Table 3). Lower frequency of IL-6-174G/C and C/C genotypes was observed in patients when compared to those without type 2 diabetes mellitus (Table 3).
| Variables | Type 2 diabetes, n (%) | Non-type 2 diabetes, n (%) | P value |
| Demographic | |||
| Male | 27 (52.9) | 102 (52.6) | 1.0 |
| Female | 24 (47.1) | 92 (47.4) | |
| Age (yr)1 | 55.5 ± 9.6 | 50.9 ± 11.7 | 0.01 |
| Clinical comorbidity | |||
| Blood hypertension | 36 (70.6) | 62 (32.0) | < 0.001 |
| Nutritional status | |||
| Body mass index (Kg/m2)2 | 27.0 (24.1-29.7) | 25.6 (23.5-28.4) | 0.11 |
| Stage of liver disease | |||
| Chronic hepatitis C | 28 (54.9) | 123 (63.4) | 0.34 |
| Liver cirrhosis | 23 (45.1) | 71 (36.6) | |
| Virological parameters | |||
| Viral load HCV-RNA [Log10 (IU/mL)]2 | 5.98 (5.66-6.24) | 5.84 (5.30-6.40) | 0.38 |
| Genotype 1 | 40/45 (88.9) | 130/159 (81.7) | 0.37 |
| IL-6 polymorphism | |||
| IL-6-174G/G genotypes | 0.04 | ||
| G/G | 37 (72.5) | 105 (54.1) | |
| G/C | 13 (25.5) | 72 (37.1) | |
| C/C | 1 (2.0) | 17 (8.8) | |
| Total | 51 (100.0) | 194 (100.0) | |
| HWE (P value) | 0.65 | 0.47 |
In the univariate analysis, type 2 diabetes mellitus was associated with old age, blood hypertension, body mass index, and the GC and CC genotypes of IL-6-174 (Table 3). In the multivariate analysis, type 2 diabetes mellitus remained inversely associated with the GC and CC genotypes of IL-6-174 and positively associated with blood hypertension (Table 4).
| Variables | Multivariate analysis | ||
| OR | 95%CI | P value | |
| Age | 1.01 | 0.98-1.05 | 0.43 |
| Body mass index | 1.03 | 0.96-1.09 | 0.45 |
| Hypertension | 5.56 | 2.79-11.09 | < 0.001 |
| IL-6-174 G/C (GC and CC) | 0.42 | 0.22-0.78 | 0.006 |
Impaired glucose tolerance and type 2 diabetes mellitus have been reported to frequently occur in patients with chronic HCV infection independently of the hepatic disease severity[26,58,59]. In consonance with the literature, we found a high prevalence of the type 2 diabetes mellitus in our patients[5,7,60,61]. Although there is a sizeable body of scientific evidence linking glucose disturbed metabolism and hepatitis C, the biological mechanisms behind the concurrence of these conditions have not been completely clarified yet.
To the best of our knowledge, this is the first study to demonstrate that the GC and GG genotypes of IL-6-174 are inversely associated with type 2 diabetes mellitus in patients chronically infected with HCV. In the current study, CHC patients with type 2 diabetes mellitus had lower frequency GC and CC IL-6-174 genotypes compared to those without diabetes. Although, several investigations have shown that subjects carrying the GC and CC genotypes of IL-6 SNP had a decreased risk of type 2 diabetes mellitus[34-38], the association has not found by others[34,39], which may be due to the differences in the study designs and/or genetic ancestry of the populations. Concerning the chronic liver diseases, the IL-6-174G/C polymorphism has been associated with both fibrosis progression and hepatocellular carcinoma development[41,62,63] in patients with CHC. The majority of the studies has verified an association between the presence of the high producer genotype (GG) and poor outcome in patients with the hepatopathy[31,32,40,41,62,63].
Patients with CHC, with insulin resistance or type 2 diabetes mellitus are likely to have a more complicated course of the infection[24-27]. Based on previous reports, it is important to keep in mind, if on the one hand insulin resistance is recognized as a risk factor for the progression of HCV-related liver disease[26-29,31,32], on the other hand, preceding HCV infection significantly increases the risk of developing type 2 diabetes mellitus[7]. Additionally, diabetic patients are at an increased risk of acquiring HCV infection[64-66]. Thus, this two-way interface, i.e., the relationship linking HCV and type 2 diabetes mellitus, is possibly determined by complex and multifaceted interactions among the hepatitis virus, the environment and the host. Our current data show that neither different HCV genotypes nor viral load was significantly associated with type 2 diabetes mellitus. In this scenario, the host-related factors should be highlighted.
HCV infection and type 2 diabetes mellitus are associated with increased production of IL-6, a pro-inflammatory cytokine that plays a crucial role in viral induced liver damage[17,29,31-41,61,62], and may cause insulin resistance in adipose tissue, skeletal muscle and liver by inhibiting insulin signal transduction[67,68]. Therefore, the results of the current study pointed to the role of IL-6 pathway in mediating both liver injury and disturbed glucose metabolism in CHC patients. Furthermore, even in the era of direct antiviral agents (DAAs), that has been causing dramatic changes in the treatment of CHC[69], the evidences of the current investigation should not be disregarded. Although most of the studies have demonstrated that HCV clearance by DAA treatment reverses or improves the insulin resistance[11,28,69,70], in a more recent investigation, the authors observed that successful hepatitis C virus treatment among patients with type 2 diabetes significantly reduces glycated haemoglobin shortly after treatment, but not for a long time[71]. In addition, Hengst et al[72] demonstrated that DAA-induced viral clearance does not fully re-establish the modified cytokine and chemokine milieu in CHC patients[72]. These evidences aligned with our results reinforce the role played by the immune-mediated mechanisms in the pathogenesis of insulin resistance and diabetes in HCV chronic hepatitis.
In the present study, in addition to IL-6 SNP, arterial hypertension was associated with type 2 diabetes mellitus. Studies have demonstrated that cardiovascular diseases, hypertension and diabetes are strongly correlated to each other[73]. Their powerful relationship have also been observed in patients chronically infected with HCV[74,75].
The limitations of our study should also be considered. First, the subjects included were recruited from a referral centre and, consequently, may not be representative of all patients with CHC. Second, the cross-sectional nature of the investigation hindered the likelihood to recognize any cause-effect relationship between type 2 diabetes mellitus and IL-6 SNP in hepatitis C. Furthermore, another limitation is the lack of data on the serum concentrations of IL-6 of patients and controls; however, the functional significance of the studied polymorphism is well understood[44-46].
In the current study, we demonstrated for the first time that the IL-6-174G/C gene promoter polymorphism is inversely associated with type 2 diabetes mellitus in patients with CHC. This finding reinforces the need for additional investigations focusing on the biological mechanisms of diabetes mellitus in patients chronically infected with HCV. The identification of potential inflammatory mediators involved in the crosstalk between HCV and the pancreas-liver axis remains important issues that deserve further investigations. Moreover, better understanding of these processes may positively affect the management strategies for reducing the extra-hepatic manifestations and their negative impact on health status in CHC patients.
Chronic hepatitis C (CHC) is associated with an elevated prevalence of type 2 diabetes mellitus. Although, some mechanisms underlying the modified glucose metabolism in hepatitis C virus (HCV) infection have been elucidated, several aspects remain unknown. Growing scientific evidence has suggested a role of pro-inflammatory immune response. Increased serum concentrations of interleukin-6 (IL-6) have been associated with insulin resistance, type 2 diabetes mellitus as well as advanced forms of liver disease in chronic hepatitis C infection.
Patients with CHC, with insulin resistance or type 2 diabetes mellitus are likely to have a more complicated course of the infection. Based on previous reports, it is important to keep in mind, if on the one hand insulin resistance is recognized as a risk factor for the progression of HCV-related liver disease, on the other hand, preceding HCV infection significantly increases the risk of developing type 2 diabetes mellitus. Additionally, diabetic patients are at an increased risk of acquiring HCV infection. Thus, this two-way interface, i.e., the relationship linking HCV and type 2 diabetes mellitus, is possibly determined by complex and multifaceted interactions among the hepatitis virus, the environment and the host.
The objectives of this study were therefore to investigate the frequency of IL-6-174G/C (rs1800795) single nucleotide polymorphism in CHC patients and in healthy subjects of the same ethnicity. Furthermore, the association between type 2 diabetes mellitus (dependent variable) and demographic, clinical, nutritional, virological and IL-6 genotyping data was also evaluated in patients chronically infected with HCV.
Two hundred and forty-five patients with CHC and 179 healthy control subjects (blood donors) were prospectively included. Type 2 diabetes mellitus was diagnosed according to the criteria of the American Diabetes Association. Clinical, biochemical, histological and radiological criteria were applied to make the diagnosis and staging of the liver disease. IL-6-174G/C (rs1800795) genotyping was Taqman assayed by Real Time PCR System 7.500 by using oligonucleotide primers previously described by Fishman et al[44]. The Hardy-Weinberg equilibrium of alleles at individual loci was assessed by two-tailed chi-square test or Fisher’s exact test. The associations of each variable including IL-6-174G/C, sex, increasing age, blood hypertension, nutritional status, liver fibrosis stage (chronic hepatitis and cirrhosis) with type 2 diabetes mellitus were tested in univariate analysis. All variables with P values < 0.20 were included in the full model of logistic regression. Odds ratio (OR) and 95%CI were used as an estimate of the risk. P values ≤ 0.05 were considered significant.
Type 2 diabetes mellitus, blood hypertension and liver cirrhosis were observed in 20.8% (51/245), 40.0% (98/245) and 38.4% (94/245) of the patients, respectively. The frequency of the studied IL-6 single nucleotide polymorphism did not differ between the CHC patients and controls (P = 0.81) and the alleles were in Hardy-Weinberg equilibrium (P = 0.38). In the multivariate analysis, type 2 diabetes mellitus was inversely associated with GC and CC genotypes of IL-6-174 (OR = 0.42; 95%CI = 0.22-0.78; P = 0.006) and positively associated with blood hypertension (OR = 5.56; 95%CI = 2.79-11.09; P < 0.001).
In the current study, we demonstrated for the first time that the IL-6-174G/C gene promoter polymorphism is inversely associated with type 2 diabetes mellitus in patients with CHC. This finding reinforces the need for additional investigations focusing on the biological mechanisms of diabetes mellitus in patients chronically infected with HCV.
The identification of potential inflammatory mediators involved in the crosstalk between HCV and the axis pancreas-liver remains important issues that deserve further investigations. Moreover, better understanding of these processes may positively affect the management strategies for reducing the extra-hepatic manifestations and their negative impact on health status in CHC patients.
| 1. | World Health Organization. Global Report on Diabetes. Geneva, 2016. [accessed 11 September 2019]. Available from: http://apps.who.int/iris/bitstream/10665/204871/1/9789241565257_eng.pdf. |
| 2. | World Health Organization. Global Hepatitis Report 2017; Resource document, 2017. [accessed 11 September 2019]. Available from: http://apps.who.int/iris/bitstream/10665/255016/1/9789241565455-eng.pdf?ua=1. |
| 3. | Polaris Observatory HCV Collaborators. Global prevalence and genotype distribution of hepatitis C virus infection in 2015: a modelling study. Lancet Gastroenterol Hepatol. 2017;2:161-176. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1292] [Reference Citation Analysis (0)] |
| 4. | Hum J, Jou JH. The link between hepatitis C virus and diabetes mellitus: Improvement in insulin resistance after eradication of hepatitis C virus. Clin Liver Dis (Hoboken). 2018;11:73-76. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 12] [Cited by in RCA: 15] [Article Influence: 1.9] [Reference Citation Analysis (0)] |
| 5. | Mehta SH, Brancati FL, Sulkowski MS, Strathdee SA, Szklo M, Thomas DL. Prevalence of type 2 diabetes mellitus among persons with hepatitis C virus infection in the United States. Ann Intern Med. 2000;133:592-599. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 530] [Cited by in RCA: 475] [Article Influence: 18.3] [Reference Citation Analysis (1)] |
| 6. | Mason AL, Lau JY, Hoang N, Qian K, Alexander GJ, Xu L, Guo L, Jacob S, Regenstein FG, Zimmerman R, Everhart JE, Wasserfall C, Maclaren NK, Perrillo RP. Association of diabetes mellitus and chronic hepatitis C virus infection. Hepatology. 1999;29:328-333. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 479] [Cited by in RCA: 443] [Article Influence: 16.4] [Reference Citation Analysis (1)] |
| 7. | Mehta SH, Brancati FL, Strathdee SA, Pankow JS, Netski D, Coresh J, Szklo M, Thomas DL. Hepatitis C virus infection and incident type 2 diabetes. Hepatology. 2003;38:50-56. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 321] [Cited by in RCA: 288] [Article Influence: 12.5] [Reference Citation Analysis (0)] |
| 8. | Zein CO, Levy C, Basu A, Zein NN. Chronic hepatitis C and type II diabetes mellitus: a prospective cross-sectional study. Am J Gastroenterol. 2005;100:48-55. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 99] [Cited by in RCA: 94] [Article Influence: 4.5] [Reference Citation Analysis (1)] |
| 9. | Shaheen M, Echeverry D, Oblad MG, Montoya MI, Teklehaimanot S, Akhtar AJ. Hepatitis C, metabolic syndrome, and inflammatory markers: results from the Third National Health and Nutrition Examination Survey [NHANES III]. Diabetes Res Clin Pract. 2007;75:320-326. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 75] [Cited by in RCA: 63] [Article Influence: 3.3] [Reference Citation Analysis (0)] |
| 10. | Stepanova M, Lam B, Younossi Y, Srishord MK, Younossi ZM. Association of hepatitis C with insulin resistance and type 2 diabetes in US general population: the impact of the epidemic of obesity. J Viral Hepat. 2012;19:341-345. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 41] [Cited by in RCA: 40] [Article Influence: 2.9] [Reference Citation Analysis (1)] |
| 11. | Li J, Zhang T, Gordon SC, Rupp LB, Trudeau S, Holmberg SD, Moorman AC, Spradling PR, Teshale EH, Boscarino JA, Schmidt MA, Daida YG, Lu M; CHeCS Investigators. Impact of sustained virologic response on risk of type 2 diabetes among hepatitis C patients in the United States. J Viral Hepat. 2018;25:952-958. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 25] [Cited by in RCA: 23] [Article Influence: 2.9] [Reference Citation Analysis (0)] |
| 12. | Naunyn B. Glykosurie and Diabetes durch experimentelle Insulte and Krankheiten der Leber. In: Naunyn B. Der Diabetes Mellitus. Vienna, 1898: 38-49. |
| 13. | Lee WG, Wells CI, McCall JL, Murphy R, Plank LD. Prevalence of diabetes in liver cirrhosis: A systematic review and meta-analysis. Diabetes Metab Res Rev. 2019;35:e3157. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 72] [Cited by in RCA: 64] [Article Influence: 9.1] [Reference Citation Analysis (0)] |
| 14. | Cimino L, Oriani G, D'Arienzo A, Manguso F, Loguercio C, Ascione A, Caporaso N, Del Vecchio Blanco C, Budillon G. Interactions between metabolic disorders (diabetes, gallstones, and dyslipidaemia) and the progression of chronic hepatitis C virus infection to cirrhosis and hepatocellular carcinoma. A cross-sectional multicentre survey. Dig Liver Dis. 2001;33:240-246. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 15] [Cited by in RCA: 11] [Article Influence: 0.4] [Reference Citation Analysis (0)] |
| 15. | Lecube A, Hernández C, Genescà J, Simó R. Glucose abnormalities in patients with hepatitis C virus infection: Epidemiology and pathogenesis. Diabetes Care. 2006;29:1140-1149. [PubMed] [DOI] [Full Text] |
| 16. | Hunter P. The inflammation theory of disease. The growing realization that chronic inflammation is crucial in many diseases opens new avenues for treatment. EMBO Rep. 2012;13:968-970. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 178] [Cited by in RCA: 219] [Article Influence: 15.6] [Reference Citation Analysis (3)] |
| 17. | Lecube A, Hernández C, Genescà J, Simó R. Proinflammatory cytokines, insulin resistance, and insulin secretion in chronic hepatitis C patients: A case-control study. Diabetes Care. 2006;29:1096-1101. [PubMed] [DOI] [Full Text] |
| 18. | Chen Y, Ji H, Shao J, Jia Y, Bao Q, Zhu J, Zhang L, Shen Y. Different Hepatitis C Virus Infection Statuses Show a Significant Risk of Developing Type 2 Diabetes Mellitus: A Network Meta-Analysis. Dig Dis Sci. 2019;. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 19] [Cited by in RCA: 17] [Article Influence: 2.8] [Reference Citation Analysis (5)] |
| 19. | Wang CC, Cheng PN, Kao JH. Systematic review: chronic viral hepatitis and metabolic derangement. Aliment Pharmacol Ther. 2020;51:216-230. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 101] [Cited by in RCA: 91] [Article Influence: 15.2] [Reference Citation Analysis (1)] |
| 20. | Stumvoll M, Goldstein BJ, van Haeften TW. Type 2 diabetes: principles of pathogenesis and therapy. Lancet. 2005;365:1333-1346. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1931] [Cited by in RCA: 1630] [Article Influence: 77.6] [Reference Citation Analysis (3)] |
| 21. | Narita R, Abe S, Kihara Y, Akiyama T, Tabaru A, Otsuki M. Insulin resistance and insulin secretion in chronic hepatitis C virus infection. J Hepatol. 2004;41:132-138. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 68] [Cited by in RCA: 65] [Article Influence: 3.0] [Reference Citation Analysis (0)] |
| 22. | Shintani Y, Fujie H, Miyoshi H, Tsutsumi T, Tsukamoto K, Kimura S, Moriya K, Koike K. Hepatitis C virus infection and diabetes: direct involvement of the virus in the development of insulin resistance. Gastroenterology. 2004;126:840-848. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 583] [Cited by in RCA: 521] [Article Influence: 23.7] [Reference Citation Analysis (0)] |
| 23. | Ballestri S, Nascimbeni F, Romagnoli D, Baldelli E, Targher G, Lonardo A. Type 2 Diabetes in Non-Alcoholic Fatty Liver Disease and Hepatitis C Virus Infection--Liver: The "Musketeer" in the Spotlight. Int J Mol Sci. 2016;17:355. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 39] [Cited by in RCA: 40] [Article Influence: 4.0] [Reference Citation Analysis (0)] |
| 24. | Serfaty L, Capeau J. Hepatitis C, insulin resistance and diabetes: clinical and pathogenic data. Liver Int. 2009;29 Suppl 2:13-25. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 77] [Cited by in RCA: 74] [Article Influence: 4.4] [Reference Citation Analysis (3)] |
| 25. | Desbois AC, Cacoub P. Diabetes mellitus, insulin resistance and hepatitis C virus infection: A contemporary review. World J Gastroenterol. 2017;23:1697-1711. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in CrossRef: 67] [Cited by in RCA: 84] [Article Influence: 9.3] [Reference Citation Analysis (9)] |
| 26. | Negro F, Alaei M. Hepatitis C virus and type 2 diabetes. World J Gastroenterol. 2009;15:1537-1547. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in CrossRef: 102] [Cited by in RCA: 114] [Article Influence: 6.7] [Reference Citation Analysis (0)] |
| 27. | Wong A, Le A, Lee MH, Lin YJ, Nguyen P, Trinh S, Dang H, Nguyen MH. Higher risk of hepatocellular carcinoma in Hispanic patients with hepatitis C cirrhosis and metabolic risk factors. Sci Rep. 2018;8:7164. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 16] [Cited by in RCA: 14] [Article Influence: 1.8] [Reference Citation Analysis (1)] |
| 28. | Li J, Gordon SC, Rupp LB, Zhang T, Trudeau S, Holmberg SD, Moorman AC, Spradling PR, Teshale EH, Boscarino JA, Schmidt MA, Daida YG, Lu M; CHeCS Investigators. Sustained virological response to hepatitis C treatment decreases the incidence of complications associated with type 2 diabetes. Aliment Pharmacol Ther. 2019;49:599-608. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 31] [Cited by in RCA: 47] [Article Influence: 6.7] [Reference Citation Analysis (0)] |
| 29. | Fallahi P, Ferri C, Ferrari SM, Corrado A, Sansonno D, Antonelli A. Cytokines and HCV-related disorders. Clin Dev Immunol. 2012;2012:468107. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 79] [Cited by in RCA: 71] [Article Influence: 5.1] [Reference Citation Analysis (0)] |
| 30. | Nayak BS, Roberts L. Relationship between inflammatory markers, metabolic and anthropometric variables in the Caribbean type 2 diabetic patients with and without microvascular complications. J Inflamm (Lond). 2006;3:17. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 26] [Cited by in RCA: 25] [Article Influence: 1.3] [Reference Citation Analysis (0)] |
| 31. | Sghaier I, Mouelhi L, Rabia NA, Alsaleh BR, Ghazoueni E, Almawi WY, Loueslati BY. Genetic variants in IL-6 and IL-10 genes and susceptibility to hepatocellular carcinoma in HCV infected patients. Cytokine. 2017;89:62-67. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 39] [Cited by in RCA: 34] [Article Influence: 3.8] [Reference Citation Analysis (0)] |
| 32. | Falleti E, Fabris C, Vandelli C, Colletta C, Cussigh A, Smirne C, Fontanini E, Cmet S, Minisini R, Bitetto D, Toniutto P, Pirisi M. Genetic polymorphisms of interleukin-6 modulate fibrosis progression in mild chronic hepatitis C. Hum Immunol. 2010;71:999-1004. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 31] [Cited by in RCA: 31] [Article Influence: 1.9] [Reference Citation Analysis (1)] |
| 33. | Guest CB, Park MJ, Johnson DR, Freund GG. The implication of proinflammatory cytokines in type 2 diabetes. Front Biosci. 2008;13:5187-5194. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 59] [Cited by in RCA: 70] [Article Influence: 3.9] [Reference Citation Analysis (0)] |
| 34. | Huth C, Illig T, Herder C, Gieger C, Grallert H, Vollmert C, Rathmann W, Hamid YH, Pedersen O, Hansen T, Thorand B, Meisinger C, Doring A, Klopp N, Gohlke H, Lieb W, Hengstenberg C, Lyssenko V, Groop L, Ireland H, Stephens JW, Wernstedt Asterholm I, Jansson JO, Boeing H, Mohlig M, Stringham HM, Boehnke M, Tuomilehto J, Fernandez-Real JM, Lopez-Bermejo A, Gallart L, Vendrell J, Humphries SE, Kronenberg F, Wichmann HE, Heid IM. Joint analysis of individual participants' data from 17 studies on the association of the IL6 variant -174G>C with circulating glucose levels, interleukin-6 levels, and body mass index. Ann Med. 2009;41:128-138. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 44] [Cited by in RCA: 44] [Article Influence: 2.6] [Reference Citation Analysis (0)] |
| 35. | Zamora-Ginez I, García-Zapién AG, Flores-Martínez SE, Sánchez-Corona J, Baez-Duarte BG, Torres-Rasgado E, Romero JR, Pérez-Fuentes R, Mendoza-Carrera F; Multidisciplinary Research Group on Diabetes of the Instituto Mexicano del Seguro Social. Low prevalence of interleukin-6 haplotypes associated with a decreased risk of type 2 diabetes in Mexican subjects with a family history of type 2 diabetes. Arch Med Res. 2013;44:529-534. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3] [Cited by in RCA: 3] [Article Influence: 0.2] [Reference Citation Analysis (0)] |
| 36. | Cui ZH, Lu XT, Xiao KL, Chen Y, Li HQ. Association of Interleukin-6 -174G/C Polymorphism with the Risk of Diabetic Nephropathy in Type 2 Diabetes: A Meta-analysis. Curr Med Sci. 2019;39:250-258. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 8] [Cited by in RCA: 17] [Article Influence: 2.4] [Reference Citation Analysis (0)] |
| 37. | Saxena M, Srivastava N, Banerjee M. Cytokine Gene Variants as Predictors of Type 2 Diabetes Mellitus. Curr Diabetes Rev. 2018;14:307-319. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 7] [Cited by in RCA: 8] [Article Influence: 1.0] [Reference Citation Analysis (0)] |
| 38. | Yin YW, Sun QQ, Zhang BB, Hu AM, Liu HL, Wang Q, Zeng YH, Xu RJ, Zhang ZD, Zhang ZG. Association between the interleukin-6 gene -572 C/G polymorphism and the risk of type 2 diabetes mellitus: a meta-analysis of 11,681 subjects. Ann Hum Genet. 2013;77:106-114. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 17] [Cited by in RCA: 19] [Article Influence: 1.5] [Reference Citation Analysis (0)] |
| 39. | Huth C, Heid IM, Vollmert C, Gieger C, Grallert H, Wolford JK, Langer B, Thorand B, Klopp N, Hamid YH, Pedersen O, Hansen T, Lyssenko V, Groop L, Meisinger C, Döring A, Löwel H, Lieb W, Hengstenberg C, Rathmann W, Martin S, Stephens JW, Ireland H, Mather H, Miller GJ, Stringham HM, Boehnke M, Tuomilehto J, Boeing H, Möhlig M, Spranger J, Pfeiffer A, Wernstedt I, Niklason A, López-Bermejo A, Fernández-Real JM, Hanson RL, Gallart L, Vendrell J, Tsiavou A, Hatziagelaki E, Humphries SE, Wichmann HE, Herder C, Illig T. IL6 gene promoter polymorphisms and type 2 diabetes: joint analysis of individual participants' data from 21 studies. Diabetes. 2006;55:2915-2921. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 83] [Cited by in RCA: 77] [Article Influence: 3.9] [Reference Citation Analysis (0)] |
| 40. | Cussigh A, Falleti E, Fabris C, Bitetto D, Cmet S, Fontanini E, Bignulin S, Fornasiere E, Fumolo E, Minisini R, Pirisi M, Toniutto P. Interleukin 6 promoter polymorphisms influence the outcome of chronic hepatitis C. Immunogenetics. 2011;63:33-41. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 59] [Cited by in RCA: 55] [Article Influence: 3.7] [Reference Citation Analysis (0)] |
| 41. | Giannitrapani L, Soresi M, Balasus D, Licata A, Montalto G. Genetic association of interleukin-6 polymorphism (-174 G/C) with chronic liver diseases and hepatocellular carcinoma. World J Gastroenterol. 2013;19:2449-2455. [PubMed] [DOI] [Full Text] |
| 42. | Vieira DA, da Cunha LR, da Silva CB, Almeida MTB, Gomes AD, de Faria CLL, Teixeira R, Neves FS, Rocha GA, de Melo FF, de Magalhães Queiroz DM, Silva LD. The combined polymorphisms of interleukin-6-174GG genotype and interleukin-10 ATA haplotype are associated with a poor quality of life in patients with chronic hepatitis C. Qual Life Res. 2019;28:1531-1542. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 6] [Cited by in RCA: 6] [Article Influence: 0.9] [Reference Citation Analysis (0)] |
| 43. | Vozarova B, Fernández-Real JM, Knowler WC, Gallart L, Hanson RL, Gruber JD, Ricart W, Vendrell J, Richart C, Tataranni PA, Wolford JK. The interleukin-6 (-174) G/C promoter polymorphism is associated with type-2 diabetes mellitus in Native Americans and Caucasians. Hum Genet. 2003;112:409-413. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 119] [Cited by in RCA: 119] [Article Influence: 5.2] [Reference Citation Analysis (0)] |
| 44. | Fishman D, Faulds G, Jeffery R, Mohamed-Ali V, Yudkin JS, Humphries S, Woo P. The effect of novel polymorphisms in the interleukin-6 (IL-6) gene on IL-6 transcription and plasma IL-6 levels, and an association with systemic-onset juvenile chronic arthritis. J Clin Invest. 1998;102:1369-1376. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1721] [Cited by in RCA: 1632] [Article Influence: 58.3] [Reference Citation Analysis (3)] |
| 45. | Terry CF, Loukaci V, Green FR. Cooperative influence of genetic polymorphisms on interleukin 6 transcriptional regulation. J Biol Chem. 2000;275:18138-18144. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 615] [Cited by in RCA: 581] [Article Influence: 22.3] [Reference Citation Analysis (0)] |
| 46. | Woo P, Humphries SE. IL-6 polymorphisms: a useful genetic tool for inflammation research? J Clin Invest. 2013;123:1413-1414. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 28] [Cited by in RCA: 37] [Article Influence: 2.8] [Reference Citation Analysis (0)] |
| 47. | Tsochatzis EA, Bosch J, Burroughs AK. Liver cirrhosis. Lancet. 2014;383:1749-1761. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1536] [Cited by in RCA: 1356] [Article Influence: 113.0] [Reference Citation Analysis (4)] |
| 48. | Bedossa P, Poynard T. An algorithm for the grading of activity in chronic hepatitis C. The METAVIR Cooperative Study Group. Hepatology. 1996;24:289-293. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3413] [Cited by in RCA: 3117] [Article Influence: 103.9] [Reference Citation Analysis (1)] |
| 49. | Child CG, Turcotte JG. Surgery and portal hypertension. Major Probl Clin Surg. 1964;1:1-85. [PubMed] |
| 50. | D'Amico G, Pasta L, Morabito A, D'Amico M, Caltagirone M, Malizia G, Tinè F, Giannuoli G, Traina M, Vizzini G, Politi F, Luca A, Virdone R, Licata A, Pagliaro L. Competing risks and prognostic stages of cirrhosis: a 25-year inception cohort study of 494 patients. Aliment Pharmacol Ther. 2014;39:1180-1193. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 476] [Cited by in RCA: 401] [Article Influence: 33.4] [Reference Citation Analysis (0)] |
| 51. | Wai CT, Greenson JK, Fontana RJ, Kalbfleisch JD, Marrero JA, Conjeevaram HS, Lok AS. A simple noninvasive index can predict both significant fibrosis and cirrhosis in patients with chronic hepatitis C. Hepatology. 2003;38:518-526. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3517] [Cited by in RCA: 3340] [Article Influence: 145.2] [Reference Citation Analysis (4)] |
| 52. | American Diabetes Association. 2. Classification and Diagnosis of Diabetes: Standards of Medical Care in Diabetes-2018. Diabetes Care. 2018;41:S13-S27. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 2581] [Cited by in RCA: 2331] [Article Influence: 291.4] [Reference Citation Analysis (3)] |
| 53. | Williams B, Mancia G, Spiering W, Agabiti Rosei E, Azizi M, Burnier M, Clement D, Coca A, De Simone G, Dominiczak A, Kahan T, Mahfoud F, Redon J, Ruilope L, Zanchetti A, Kerins M, Kjeldsen S, Kreutz R, Laurent S, Lip GYH, McManus R, Narkiewicz K, Ruschitzka F, Schmieder R, Shlyakhto E, Tsioufis K, Aboyans V, Desormais I; List of authors/Task Force members:. 2018 Practice Guidelines for the management of arterial hypertension of the European Society of Hypertension and the European Society of Cardiology: ESH/ESC Task Force for the Management of Arterial Hypertension. J Hypertens. 2018;36:2284-2309. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 442] [Cited by in RCA: 620] [Article Influence: 77.5] [Reference Citation Analysis (0)] |
| 54. | World Health Organization. Physical status: the use and interpretation of anthropometry, 2015. [accessed 8 Nov 2019]. Available from: http://www.who.int/childgrowth/publications/physical_status/en/. |
| 55. | Lipschitz DA. Screening for nutritional status in the elderly. Prim Care. 1994;21:55-67. [PubMed] |
| 56. | Silva LD, Cunha CC, Cunha LR, Araújo RF, Barcelos VM, Menta PL, Neves FS, Teixeira R, Rocha GA, Gontijo ED. Depression rather than liver impairment reduces quality of life in patients with hepatitis C. Braz J Psychiatry. 2015;37:21-30. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 13] [Cited by in RCA: 15] [Article Influence: 1.4] [Reference Citation Analysis (0)] |
| 57. | Queiroz DM, Anacleto C, Trant C, Pinto AM, Calixto RS, Teixeira KN, Kehdy FS, Santos ET, Coimbra RS, Rocha GA, Rocha AMC. Ancestral origin and virulence markers of H. pylori strains and host genetic structure as predictors of gastric cancer and duodenal ulcer in an admixed population. Gastroenterology. 2013;144:S-4. [DOI] [Full Text] |
| 58. | Petit JM, Bour JB, Galland-Jos C, Minello A, Verges B, Guiguet M, Brun JM, Hillon P. Risk factors for diabetes mellitus and early insulin resistance in chronic hepatitis C. J Hepatol. 2001;35:279-283. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 195] [Cited by in RCA: 172] [Article Influence: 6.9] [Reference Citation Analysis (1)] |
| 59. | White DL, Ratziu V, El-Serag HB. Hepatitis C infection and risk of diabetes: a systematic review and meta-analysis. J Hepatol. 2008;49:831-844. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 339] [Cited by in RCA: 306] [Article Influence: 17.0] [Reference Citation Analysis (5)] |
| 60. | Giordanino C, Bugianesi E, Smedile A, Ciancio A, Abate ML, Olivero A, Pellicano R, Cassader M, Gambino R, Bo S, Ciccone G, Rizzetto M, Saracco G. Incidence of type 2 diabetes mellitus and glucose abnormalities in patients with chronic hepatitis C infection by response to treatment: results of a cohort study. Am J Gastroenterol. 2008;103:2481-2487. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 74] [Cited by in RCA: 63] [Article Influence: 3.5] [Reference Citation Analysis (1)] |
| 61. | Simó R, Hernández C, Genescà J, Jardí R, Mesa J. High prevalence of hepatitis C virus infection in diabetic patients. Diabetes Care. 1996;19:998-1000. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 190] [Cited by in RCA: 174] [Article Influence: 5.8] [Reference Citation Analysis (1)] |
| 62. | Estrabaud E, Vidaud M, Marcellin P, Asselah T. Genomics and HCV infection: progression of fibrosis and treatment response. J Hepatol. 2012;57:1110-1125. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 81] [Cited by in RCA: 81] [Article Influence: 5.8] [Reference Citation Analysis (5)] |
| 63. | Wang X, Yan Z, Ye Q. Interleukin-6 gene polymorphisms and susceptibility to liver diseases: A meta-analysis. Medicine (Baltimore). 2019;98:e18408. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 13] [Cited by in RCA: 22] [Article Influence: 3.1] [Reference Citation Analysis (0)] |
| 64. | Villar LM, Geloneze B, Vasques ACJ, Pires MLE, Miguel JC, da Silva EF, Marques VA, Scalioni LP, Lampe E. Prevalence of hepatitis B and hepatitis C among diabetes mellitus type 2 individuals. PLoS One. 2019;14:e0211193. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 6] [Cited by in RCA: 14] [Article Influence: 2.0] [Reference Citation Analysis (0)] |
| 65. | Naing C, Mak JW, Ahmed SI, Maung M. Relationship between hepatitis C virus infection and type 2 diabetes mellitus: meta-analysis. World J Gastroenterol. 2012;18:1642-1651. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in CrossRef: 114] [Cited by in RCA: 108] [Article Influence: 7.7] [Reference Citation Analysis (5)] |
| 66. | Guo X, Jin M, Yang M, Liu K, Li JW. Type 2 diabetes mellitus and the risk of hepatitis C virus infection: a systematic review. Sci Rep. 2013;3:2981. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 51] [Cited by in RCA: 47] [Article Influence: 3.6] [Reference Citation Analysis (5)] |
| 67. | Pradhan AD, Manson JE, Rifai N, Buring JE, Ridker PM. C-reactive protein, interleukin 6, and risk of developing type 2 diabetes mellitus. JAMA. 2001;286:327-334. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3363] [Cited by in RCA: 3030] [Article Influence: 121.2] [Reference Citation Analysis (4)] |
| 68. | Akbari M, Hassan-Zadeh V. IL-6 signalling pathways and the development of type 2 diabetes. Inflammopharmacology. 2018;26:685-698. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 251] [Cited by in RCA: 198] [Article Influence: 24.8] [Reference Citation Analysis (0)] |
| 69. | Spearman CW, Dusheiko GM, Hellard M, Sonderup M. Hepatitis C. Lancet. 2019;394:1451-1466. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 354] [Cited by in RCA: 305] [Article Influence: 43.6] [Reference Citation Analysis (6)] |
| 70. | Adinolfi LE, Nevola R, Guerrera B, D'Alterio G, Marrone A, Giordano M, Rinaldi L. Hepatitis C virus clearance by direct-acting antiviral treatments and impact on insulin resistance in chronic hepatitis C patients. J Gastroenterol Hepatol. 2018;33:1379-1382. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 58] [Cited by in RCA: 63] [Article Influence: 7.9] [Reference Citation Analysis (0)] |
| 71. | Li J, Gordon SC, Rupp LB, Zhang T, Trudeau S, Holmberg SD, Moorman AC, Spradling PR, Teshale EH, Boscarino JA, Schmidt MA, Daida YG, Lu M; CHeCS Investigators. Sustained virological response does not improve long-term glycaemic control in patients with type 2 diabetes and chronic hepatitis C. Liver Int. 2019;39:1027-1032. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 16] [Cited by in RCA: 23] [Article Influence: 3.3] [Reference Citation Analysis (2)] |
| 72. | Hengst J, Falk CS, Schlaphoff V, Deterding K, Manns MP, Cornberg M, Wedemeyer H. Direct-Acting Antiviral-Induced Hepatitis C Virus Clearance Does Not Completely Restore the Altered Cytokine and Chemokine Milieu in Patients With Chronic Hepatitis C. J Infect Dis. 2016;214:1965-1974. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 128] [Cited by in RCA: 122] [Article Influence: 12.2] [Reference Citation Analysis (0)] |
| 73. | Lucaroni F, Cicciarella Modica D, Macino M, Palombi L, Abbondanzieri A, Agosti G, Biondi G, Morciano L, Vinci A. Can risk be predicted? An umbrella systematic review of current risk prediction models for cardiovascular diseases, diabetes and hypertension. BMJ Open. 2019;9:e030234. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 15] [Cited by in RCA: 30] [Article Influence: 4.3] [Reference Citation Analysis (0)] |
| 74. | Chou CH, Ho CS, Tsai WC, Wang MC, Tsai YS, Chen JY. Effects of chronic hepatitis C infection on arterial stiffness. J Am Soc Hypertens. 2017;11:716-723. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 7] [Cited by in RCA: 8] [Article Influence: 0.9] [Reference Citation Analysis (0)] |
| 75. | Perticone M, Maio R, Tassone EJ, Tripepi G, Di Cello S, Miceli S, Caroleo B, Sciacqua A, Licata A, Sesti G, Perticone F. Insulin-resistance HCV infection-related affects vascular stiffness in normotensives. Atherosclerosis. 2015;238:108-112. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 17] [Cited by in RCA: 19] [Article Influence: 1.6] [Reference Citation Analysis (0)] |
Open-Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See:
Manuscript source: Invited manuscript
Corresponding Author's Membership in Professional Societies: The European Association for the Study of the Liver, No. 12302; American Association for the Study of Liver Diseases - International Member (07/01/2019-06/30/2020), No. 115795; the European Society of Clinical Nutrition and Metabolism, ESPEN, No. 43011.
Specialty type: Gastroenterology and hepatology
Country/Territory of origin: Brazil
Peer-review report´s scientific quality classification
Grade A (Excellent): 0
Grade B (Very good): 0
Grade C (Good): C
Grade D (Fair): 0
Grade E (Poor): 0
P-Reviewer: Nayak S S-Editor: Zhang L L-Editor: A E-Editor: Li X