Copyright
©The Author(s) 2003.
World J Gastroenterol. Aug 15, 2003; 9(8): 1762-1766
Published online Aug 15, 2003. doi: 10.3748/wjg.v9.i8.1762
Published online Aug 15, 2003. doi: 10.3748/wjg.v9.i8.1762
Table 1 Oligonucleotide primers used for vacA typing
Gene and region amplified | Genotype identified | Primer designation | Primer sequence | Size of PCR product(bp) |
Mid-region | m1/m2 | VAG-F | 5’CAATCTGTCCAATCAAGCGAG3’ | 567/642 |
VAG-R | 5’GCGTCAAAATAATTCCAAGG3’ | |||
Signal sequence | s1/s2* | VA1-F | 5’ATGGAAATACAACAAACACAC3’ | 259/286* |
VA1-R | 5’CTGCTTGAATGCGCCAAAC3’ | |||
s1a | SS1-F# | 5’GTCAGCATCACACCGCAAC3’ | 190 | |
s1b | SS3-F# | 5’AGCGCCATACCGCAAGAC3’ | 187 |
Table 2 The system of PCR
Constituents | Volume/per tube (μL) | Final concentration |
Water | 36 | |
10×PCR buffer | 5 | 1× |
4dNTP, 2.5mmol/L /each | 4 | 0.2mmol/L each |
primer 1.25 μmol/L | 1 | 0.5 μmol/L |
primer 2.25 μmol/L | 1 | 0.5 μmol/L |
MgCl2, 50 mmol/L | 1.5 | 1.5 mmol/L |
Taq DNA polymerase, 5MU/L | 0.5 | 0.1 MU/L |
Template DNA | 1 |
Table 3 H.pylori signal sequence typing and gastric diseases
s type | GC | CSG | CAG | GU | DU | Total(%) |
s1a | 43a | 14 | 37 | 5 | 12 | 111 (57.8) |
s1b | 10 | 13 | 25 | 8 | 7 | 63 (32.8) |
s2 | 3 | 4 | 7 | 3 | 1 | 18 (9.4) |
Total | 56 | 31 | 69 | 16 | 20 | 192 (100.0) |
Table 4 H.pylori signal sequence typing and gastric diseases
m type | GC | CSG | CAG | GU | DU | Total(%) |
m1 | 31 | 13 | 36 | 7 | 12 | 99 (51.6) |
m2 | 25 | 18 | 33 | 9 | 8 | 93 (48.4) |
Total | 56 | 31 | 69 | 16 | 20 | 192 (100.0) |
Table 5 Relationship between vacA typing and grade of vacu-olating cytotoxin activity
vacA type | Grade of vacuolating cytotoxin activity | ||
None | Low | High | |
s1a | 5 | 38 | 68 |
s1b | 17 | 24 | 22 |
s2 | 18 | 0 | 0 |
m1 | 10 | 30 | 59 |
m2 | 30 | 32 | 31 |
Table 6 Relationship between vacA typing, cagA gene and gastric diseases for 192 H. pylori isolates
vacA type | cagA+ | Total(%) | ||||
GC | CSG | CAG | GU | DU | ||
s1a | 43 | 14 | 37 | 4 | 12 | 110 (66.7) |
s1b | 10 | 10 | 22 | 6 | 7 | 55 (33.3) |
s2 | 0 | 0 | 0 | 0 | 0 | 0 (0.0) |
m1 | 31 | 12 | 36 | 6 | 12 | 97 (58.8) |
m2 | 22 | 12 | 23 | 4 | 7 | 78 (46.2) |
-
Citation: Qiao W, Hu JL, Xiao B, Wu KC, Peng DR, Atherton JC, Xue H. cagA and vacA genotype of
Helicobacter pylori associated with gastric diseases in Xi’an area. World J Gastroenterol 2003; 9(8): 1762-1766 - URL: https://www.wjgnet.com/1007-9327/full/v9/i8/1762.htm
- DOI: https://dx.doi.org/10.3748/wjg.v9.i8.1762