©The Author(s) 2003.
World J Gastroenterol. May 15, 2003; 9(5): 905-909
Published online May 15, 2003. doi: 10.3748/wjg.v9.i5.905
Published online May 15, 2003. doi: 10.3748/wjg.v9.i5.905
Table 1 The primer sequence of the p16 gene
| Exon | Sequence of the primer | Product of PCR (bp) | Temperature for annealing (°C) |
| 1S | 5’TCTGCGGAGAGGGGGAGAGCAG3’ | 280 | 58 |
| 1A | 5’GCGCTACCTGATTCCAATTC3’ | ||
| 2S | 5’TTCCTTTCCGTCATGCCGG 3’ | 394 | 56 |
| 2A | 5’GTACAAATTCTCAGATCATCAGTCCTC3’ | ||
| 3S | 5’GGATGTTCCACACATCTTTG3’ | 189 | 52 |
| 3A | 5’ATGAAAACTACGAAAGCGGG3’ |
Table 2 p16 protein expression at GC
| Hisological types | n | Positive | Negative | The frequency of p16 protein expression loss (%) |
| Gastric carcinoma | 40 | 9 | 31 | 77.5 |
| Adjacent nontumor tissue ( ≤ 3 cm) | 40 | 18 | 22 | 55.0 |
| Distal normal tissue (≥ 5 cm) | 40 | 33 | 7 | 17.5 |
- Citation: Zhao GH, Li TC, Shi LH, Xia YB, Lu LM, Huang WB, Sun HL, Zhang YS. Relationship between inactivation of p16 gene and gastric carcinoma. World J Gastroenterol 2003; 9(5): 905-909
- URL: https://www.wjgnet.com/1007-9327/full/v9/i5/905.htm
- DOI: https://dx.doi.org/10.3748/wjg.v9.i5.905
