Copyright
©The Author(s) 2003.
World J Gastroenterol. Apr 15, 2003; 9(4): 731-735
Published online Apr 15, 2003. doi: 10.3748/wjg.v9.i4.731
Published online Apr 15, 2003. doi: 10.3748/wjg.v9.i4.731
Table 1 Oligonucleotide primers
| Primer | Positiona | Sequence | ||
| 1687 (+) | 1687-1706 | 5’CGACCGACCTTGAGGCATAC3’ | ||
| Double- | PCR1 | 2498 (-) | 2498-2477 | 5’AAGCCCAGTAAAGTTTCCCACC3’ |
| round | 2267 (+) | 2267-2284 | 5’GGAGTGTGGATTCGCACT3’ | |
| PCR | PCR2 | 2436 (-) | 2436-2419 | 5’TGAGATCTTCTGCGACGC3’ |
| 1687 (+) | 1687-1706 | 5’CGACCGACCTTGAGGCATAC3’ | ||
| Triple- | PCR1 | 2498 (-) | 2498-2477 | 5’AAGCCCAGTAAAGTTTCCCACC3’ |
| round | 1795 (+) | 1795-1812 | 5’TGGTCTGTCGACCAGCAC3’ | |
| PCR | PCR2 | 2436 (-) | 2436-2419 | 5’TGAGATCTTCTGCGACGC3’ |
| 2267 (+) | 2267-2284 | 5’GGAGTGTGGATTCGCACT3’ | ||
| PCR3 | 2400 (-) | 2400-2382 | 5’CTGCGAGGCGAGGGAGTT3’ |
Table 2 Polymerase chain reaction cycling profiles
| Amplification conditions | Sizeb | ||||
| Denaturation | Annealing | Extension | |||
| Double-round | PCR1 | 94°C 30 sec | 62°C 40 sec | 72°C 80 sec | 812 bp |
| PCR | |||||
| PCR2 | 94°C 30 sec | 57°C 50 sec | 72°C 50 sec | 170 bp | |
| Triple-round | PCR1 | 94°C 30 sec | 62°C 40 sec | 72°C 80 sec | 812 bp |
| PCR | |||||
| PCR2 | 94°C 30 sec | 48°C 60 sec | 72°C 50 sec | 642 bp | |
| PCR3 | 94°C 30 sec | 50°C 60 sec | 72°C 50 sec | 134 bp | |
Table 3 HBV DNA levels measured by the amplicor HBV moni-tor test
| Time of post-inoculation (months) | HBV DNA Levels (genomes/mL) | |||||||||
| 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 10 | |
| Baboon 1 | < 400 | < 400 | 4338 | 3711 | ns | ns | < 400 | ns | < 400 | < 400 |
| Baboon 13 | < 400 | ns | ns | ns | ns | ns | 26216 | 1003 | ns | ns |
- Citation: Baptista M, Kramvis A, Jammeh S, Naicker J, Galpin JS, Kew MC. Follow up of infection of chacma baboons with inoculum containing a and non-a genotypes of hepatitis B virus. World J Gastroenterol 2003; 9(4): 731-735
- URL: https://www.wjgnet.com/1007-9327/full/v9/i4/731.htm
- DOI: https://dx.doi.org/10.3748/wjg.v9.i4.731
