Follow up of infection of chacma baboons with inoculum containing a and non-a genotypes of hepatitis B virus

Table 1 Oligonucleotide primers

		Primer	Positiona	Sequence
		1687 (+)	1687-1706	5’CGACCGACCTTGAGGCATAC3’
Double-	PCR1	2498 (-)	2498-2477	5’AAGCCCAGTAAAGTTTCCCACC3’
round		2267 (+)	2267-2284	5’GGAGTGTGGATTCGCACT3’
PCR	PCR2	2436 (-)	2436-2419	5’TGAGATCTTCTGCGACGC3’
		1687 (+)	1687-1706	5’CGACCGACCTTGAGGCATAC3’
Triple-	PCR1	2498 (-)	2498-2477	5’AAGCCCAGTAAAGTTTCCCACC3’
round		1795 (+)	1795-1812	5’TGGTCTGTCGACCAGCAC3’
PCR	PCR2	2436 (-)	2436-2419	5’TGAGATCTTCTGCGACGC3’
		2267 (+)	2267-2284	5’GGAGTGTGGATTCGCACT3’
	PCR3	2400 (-)	2400-2382	5’CTGCGAGGCGAGGGAGTT3’

PCR1: The first round polymerase chain reaction; PCR2: The second round polymerase chain reaction; PCR3: The triple round polymerase chain reaction. (+) sense; (-) anti-sense.

^aDenotes the nucleotide position of hepatitis B virus adw ge-nome (GenBank accession #V00866) where the EcoRI cleavage site is position 1. ^bSize of the amplicons in base pairs.

Table 2 Polymerase chain reaction cycling profiles

		Amplification conditions			Sizeb
		Denaturation	Annealing	Extension
Double-round	PCR1	94°C 30 sec	62°C 40 sec	72°C 80 sec	812 bp
PCR
	PCR2	94°C 30 sec	57°C 50 sec	72°C 50 sec	170 bp
Triple-round	PCR1	94°C 30 sec	62°C 40 sec	72°C 80 sec	812 bp
PCR
	PCR2	94°C 30 sec	48°C 60 sec	72°C 50 sec	642 bp
	PCR3	94°C 30 sec	50°C 60 sec	72°C 50 sec	134 bp

PCR1: The first round polymerase chain reaction; PCR2: The second round polymerase chain reaction; PCR3: The triple round polymerase chain reaction. (+) sense; (-) anti-sense. ^aDenotes the nucleotide position of hepatitis B virus adw ge-nome (GenBank accession #V00866) where the EcoRI cleavage site is position 1.

^bSize of the amplicons in base pairs.

Table 3 HBV DNA levels measured by the amplicor HBV moni-tor test

Time of post-inoculation (months)	HBV DNA Levels (genomes/mL)
	2	3	4	5	6	7	8	9	10	10
Baboon 1	< 400	< 400	4338	3711	ns	ns	< 400	ns	< 400	< 400
Baboon 13	< 400	ns	ns	ns	ns	ns	26216	1003	ns	ns

Notes: ns: No serum available.