©The Author(s) 2002.
World J Gastroenterol. Dec 15, 2002; 8(6): 1081-1087
Published online Dec 15, 2002. doi: 10.3748/wjg.v8.i6.1081
Published online Dec 15, 2002. doi: 10.3748/wjg.v8.i6.1081
Table 1 Samples for sequencing
| Sample | Sex | Age (yrs) | Origin | Diagnosis | Regions for sequencing |
| GD1 | F | 58 | Guangdong | non A-E hepatitis | 5’UTR |
| GD3027 | M | 47 | Guangdong | hepatitis B | 5’UTR, NS5A |
| GD3040 | M | 76 | Guangdong | hepatitis B | 5’UTR |
| GD3064 | F | 20 | Guangdong | non A-E hepatitis | 5’UTR |
| GDCA | M | 26 | Guangdong | hepatocellular carcinoma | 5’UTR |
| YN1 | M | 26 | Yunnan | intravenous drug user | 5’UTR |
| YN2 | M | 38 | Yunnan | intravenous drug user | 5’UTR |
| YN3 | M | 45 | Yunnan | intravenous drug user | 5’UTR |
| HKC9 | F | 42 | Hong Kong | hepatitis C | 5’UTR |
| HKC16 | M | 38 | Hong Kong | hepatitis C | 5’UTR |
| HK8 | M | 56 | Hong Kong | recipient of bone marrow | 5’UTR |
| HK9 | M | 42 | Hong Kong | recipient of bone marrow | 5’UTR |
| HK10 | M | 38 | Hong Kong | recipient of bone marrow | 5’UTR |
| HK11 | M | 42 | Hong Kong | recipient of bone marrow | 5’UTR |
| HK12 | M | 42 | Hong Kong | recipient of bone marrow | 5’UTR |
| HK24 | F | 42 | Hong Kong | recipient of bone marrow | 5’UTR |
| HK80 | M | 40 | Hong Kong | recipient of bone marrow | 5’UTR |
| HK108 | M | 18 | Hong Kong | recipient of bone marrow | 5’UTR |
| HK116 | M | 42 | Hong Kong | recipient of bone marrow | 5’UTR |
| HK120 | M | 40 | Hong Kong | recipient of bone marrow | 5’UTR |
| A132 | M | 20 | Hong Kong | blood donor | NS5A |
| A711 | M | 25 | Hong Kong | blood donor | NS5A |
Table 2 Primers used in RT-PCR
| Primer | Polarity | Position | Nucleotide sequence |
| G1 | + | 117-136 | 5’ ATGCGTGATGACAGGGTTGG 3’ |
| G2 | - | 451-471 | 5’ TAGGTGGCCCCATGCATTTCC 3’ |
| G3 | + | 161-180 | 5’ GGTAGCCACTATAGGTGGGT 3’ |
| G4 | - | 379-398 | 5’ CACTGGTCCTTGTCAACTCG 3’ |
| 33 | + | 6672-6697 | 5’ GTTGAATTCGCGATGGAGCGCTACAC 3’ |
| 34 | - | 7267-7292 | 5’ CTGGGATCCGTATCATGTATGGTTCT 3’ |
| 35 | + | 6573-6592 | 5’ TCGATTGCTGTAGCTGAGCC 3’ |
| 36 | - | 7327-7346 | 5’ GGTAAGTTCATTGCCCACCA 3’ |
Table 3 Prevalence of HGV infection from different groups in Southern China
| Group | cases | HGV RNA Positive cases(%) |
| Bone marrow transplantation | 108 | 45(41.67) |
| Haemodialysis | 92 | 13(14.13) |
| Intravenous drug users | 84 | 15(17.86) |
| Hepatocellular carcinoma | 161 | 22(13.66) |
| Hepatitis B | 263 | 19(7.22) |
| Hepatitis C | 55 | 7(12.73) |
| Hepatitis B + Hepatitis A | 16 | 1(6.25) |
| Hepatitis B + Hepatitis C | 6 | 1(16.67) |
| Hepatitis B + Hepatitis E | 26 | 3(11.54) |
| Hepatitis E | 29 | 2(6.90) |
| Non A-E hepatitis | 83 | 21(25.30) |
| Blood donors | 506 | 13(2.57) |
| General population | 562 | 5(0.89) |
| Total | 1991 |
- Citation: Li G, Ma HH, Lau GK, Leung YK, Yao CL, Chong YT, Tang WH, Yao JL. Prevalence of hepatitis G virus infection and homology of different viral strains in Southern China. World J Gastroenterol 2002; 8(6): 1081-1087
- URL: https://www.wjgnet.com/1007-9327/full/v8/i6/1081.htm
- DOI: https://dx.doi.org/10.3748/wjg.v8.i6.1081
