©The Author(s) 2000.
World J Gastroenterol. Jun 15, 2000; 6(3): 411-414
Published online Jun 15, 2000. doi: 10.3748/wjg.v6.i3.411
Published online Jun 15, 2000. doi: 10.3748/wjg.v6.i3.411
Table 1 Primers for p16INK4a and p15INK4b genes analysis
| Gene | Primers | Fragment length (bp) | Ref |
| p16INK4a exon 1 | 5'GGGAGCAGCATGGAGCCCG3' (sense) | 204 | [6] |
| 5'AGTCGCCCGCCATCCCCT3' (antisense) | |||
| p16INK4a intron 1 and exon 2 | 5'GGAAATTGGAAACTGGAAGC3' (sense) | 168 | [1] |
| 5'GCTGCCCATCATCATGACCT3' (antisense) | |||
| p16INK4a exon 2 and exon 3 | 5'GGCAGGTCATGATGATGGGC3' (sense) | 362 | [1] |
| 5'TCTGAGCTTTGGAAGCTCT3' (antisense) | |||
| p15INK4b exon 2 | 5'GGCCGGCATCTCCCATACCTG3' (sense) | 345 | [9] |
| 5'TGTGGGCGGCTGGGAACCTG3' (antisense) |
- Citation: Qin Y, Li B, Tan YS, Sun ZL, Zuo FQ, Sun ZF. Polymorphism of p16INK4a gene and rare mutation of p15INK4b gene exon2 in primary hepatocarcinoma. World J Gastroenterol 2000; 6(3): 411-414
- URL: https://www.wjgnet.com/1007-9327/full/v6/i3/411.htm
- DOI: https://dx.doi.org/10.3748/wjg.v6.i3.411
