©The Author(s) 2000.
World J Gastroenterol. Jun 15, 2000; 6(3): 361-364
Published online Jun 15, 2000. doi: 10.3748/wjg.v6.i3.361
Published online Jun 15, 2000. doi: 10.3748/wjg.v6.i3.361
Table 1 PCR primer sequences and expected size of amplified products
| Primers | Sequence | Size |
| α 2(I) collagen upstream | 5'TGTTCGTGGTTCTCAGGGTAG3' | |
| α 2(I) collagen downstream | 5'TTGTCGTAGCAGGGTTCTTTC3' | 254 bp |
| β-actin upstream | 5'ACATCTGCTGGAAGGTGGAC3' | |
| β-actin downstream | 5'GGTACCACCATGTACCCAGG3' | 163 bp |
Table 2 Effects of SA-A on cell intracellular [3H]TdR and [3H]Pro incorporation (cpm/well, -x±s, n = 4)
Table 3 Effects of SA-A on NIH/3T3 fibroblast collagen synthetic rates (%,-x±s, n = 4)
Table 4 The relative expression amount of α2(I) procollagen mRNA (-x±s,% of β-actin)
- Citation: Liu CH, Hu YY, Wang XL, Xu LM, Liu P. Effects of salvianolic acid-A on NIH/3T3 fibroblast proliferation, collagen synthesis and gene expression. World J Gastroenterol 2000; 6(3): 361-364
- URL: https://www.wjgnet.com/1007-9327/full/v6/i3/361.htm
- DOI: https://dx.doi.org/10.3748/wjg.v6.i3.361
