BPG is committed to discovery and dissemination of knowledge
Original Articles
Copyright ©The Author(s) 2000.
World J Gastroenterol. Jun 15, 2000; 6(3): 361-364
Published online Jun 15, 2000. doi: 10.3748/wjg.v6.i3.361
Table 1 PCR primer sequences and expected size of amplified products
PrimersSequenceSize
α 2(I) collagen upstream5'TGTTCGTGGTTCTCAGGGTAG3'
α 2(I) collagen downstream5'TTGTCGTAGCAGGGTTCTTTC3'254 bp
β-actin upstream5'ACATCTGCTGGAAGGTGGAC3'
β-actin downstream5'GGTACCACCATGTACCCAGG3'163 bp
Table 2 Effects of SA-A on cell intracellular [3H]TdR and [3H]Pro incorporation (cpm/well, -x±s, n = 4)
Group[3H]TdR[3H]Pro
Control1482 ± 48621018 ± 5473
10-4 mol/L SA-A675 ± 201b18659 ± 2363
10-5 mol/L SA-A969 ± 183a23761 ± 5430
10-6 mol/L SA-A868 ± 183a31408 ± 4981a
10-7 mol/L SA-A1056 ± 18726080 ± 4504
Table 3 Effects of SA-A on NIH/3T3 fibroblast collagen synthetic rates (%,-x±s, n = 4)
GroupIntracellularExtracellular
Control0.78 ± 0.032.57 ± 0.37
10-5 mol/L0.48 ± 0.24b2.54 ± 0.91
10-6 mol/L0.43 ± 0.26b3.02 ± 0.69
Table 4 The relative expression amount of α2(I) procollagen mRNA (-x±s,% of β-actin)
GroupnCol α1(I) mRNA
Control398.71 ± 9.96
10-5 mol/L SA-A376.23 ± 12.02a
10-6 mol/L SA-A368.44 ± 8.06a