Candida-mediated vertical transmission of Helicobacter pylori in C57BL/6J mice

Table 1 Primers used to detect Helicobacter pylori and Candida strains

Gene	Sequence	Polymerase chain reaction product size (bp)	Procedure	Ref.
16S rDNA	HeliS: AAGAACCTTACCTAGGCTTGACATTG	497	94 °C 3 minutes; 37 cycles at 94 °C 45 seconds, 57 °C 60 seconds, 72 °C 60 seconds; 72 °C 5 minutes	[35]
	HeliN: GCTAAGAGATCAGCCTATGTCC
	Hpup: TGAGAGAATCCGCTAGAAATAGTGG	454	94 °C 3 minutes; 25 cycles at 94 °C 45 seconds, 57 °C 1 minutes, 72 °C 1 minutes; 72 °C 5 minutes
	Hpdown: TAGCATCCTGACTTAAGGCAAACA
ureA	PylF: CCAGATGATGTGATGGATGG	607	94 °C 3 minutes; 25 cycles at 94 °C 45 seconds; 50 °C 45 seconds, 72 °C 3 minutes; 72 °C 5 minutes	[36]
	PylR: TCAAGTCTGTATCGCCCAATC
	HpU1: GCCAATGGTAAATTAGTT	411	94 °C 3 minutes; 34 cycles at 94 °C 45 seconds, 45 °C 45 seconds, 72 °C 45 seconds; 72 °C 5 minutes
	HpU2: CTCCTTAATTGTTTTTAC
ITS	ITS1: TCCGTAGGTGAACCTGCGG	500-800	94 °C 5 minutes; 35 cycles at 94 °C 1 minutes; 60 °C 30 seconds; 72 °C 1 minutes; 72 °C 10 minutes	[37]
	ITS4: TCCTCCGCTTATTGATATGC

ITS: Internal transcribed spacer; ureA: Urease A.

Table 2 Grouping of mice models

Models	Groups	Groups number	Strains for modeling
Model of vaginal infection caused by Candida	Experimental group	V1 (n = 10)	J115
		V2 (n = 10)	H100
		V3 (n = 10)	Ca-co-Hp
	Control group	VC (n = 8)	Ca10231
	Normal group	VN1 (n = 8)
Model of gastric infection with Candida	Experimental group	G12 (n = 10)	Helicobacter pylori and Ca10231
		G2 (n = 10)	W49
		G3 (n = 10)	F67
		G4 (n = 10)	Ca-co-Hp
	Control group	GC (n = 8)	Ca10231
	Normal group	GN3 (n = 8)

¹VN group mice were inoculated intravaginally with saline solution.

²G1 group mice were simultaneously infected with Helicobacter pylori via gavage and Ca10231 via vaginal instillation.

³GN group mice received saline solution via gavage.

Table 3 Candida strains used in the establishment of animal models

Strains		Candida species	ITS GenBank ID	SRA accession code
				Hp 16S rDNA	Hp ureA
Hp negative Candida	Ca10231	Candida albicans	OP796841.1	-	-
Hp 16S rDNA and ureA genes positive Candida	J115	Candida albicans	OP824698	PRJNA1221296	PRJNA1221135
	H100	Candida tropicalis	OP850598	PRJNA1225572
	W49	Candida glabrata	OP850582
	F67	Candida guilliermondii	OQ733328
	Ca-co-Hp	Candida albicans	PV110845

Hp: Helicobacter pylori; ITS: Internal transcribed spacer; ureA: Urease A; SRA: Sequence Read Archive database; -: Polymerase chain reaction results for Helicobacter pylori 16S rDNA and ureA genes were negative.

Table 4 Rates of positive detection for the Helicobacter pylori 16S rDNA or urease A genes in maternal mice, n (%)

Group		Number of examined mice	Gastric mucosa samples		Intestinal contents		Vaginal tissues
			Hp 16S rDNA positive samples	Hp ureA positive samples	Hp 16S rDNA positive samples	Hp ureA positive samples	Hp 16S rDNA positive samples	Hp ureA positive samples
Modeling of vaginal infection with Candida1	V1	8	3 (37.5)	2 (25.0)	3 (37.5)	1 (12.5)	3 (37.5)	0 (0)
	V2	10	0 (0)	1 (10.0)	2 (20.0)	0 (0)	1 (10.0)	0 (0)
	V3	10	3 (30.0)	1 (10.0)	3 (30.0)	1 (10.0)	0 (0)	4 (40.0)
	VC	6	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)
	VN	8	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)
Modeling of gastric infection with Candida2	G1	9	4 (44.4)	0 (0)	3 (33.3)	0 (0)	1 (11.1)	2 (22.2)
	G2	8	4 (50.0)	0 (0)	4 (50.0)	0 (0)	2 (25.0)	1 (12.5)
	G3	8	2 (25.0)	1 (12.5)	3 (37.5)	1 (12.5)	0 (0)	0 (0)
	G4	8	3 (37.5)	0 (0)	3 (37.5)	0 (0)	2 (25.0)	1 (12.5)
	GC	8	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)
	GN	8	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)

¹Group V1, V2, and V3 mice were intravaginally inoculated with Candida J115, H100, and Ca-co-Hp, respectively. Group VC mice were intravaginally inoculated with Candida Ca10231, whereas group VN mice received saline solution.

²Group G1 mice were infected with Helicobacter pylori via gavage, and Candida Ca10231 was intravaginally inoculated. Group G2, G3, G4, and GC mice were infected via gavage with the Candida strains W49, F67, Ca-co-Hp, and Ca10231, respectively. Group GN mice received saline solution via gavage. Strains J115, H100, W49, F67, and Ca-co-Hp were positive for Helicobacter pylori 16S rDNA and ureA genes, whereas the control strain, Ca10231, tested negative for both genes.

Hp: Helicobacter pylori; ureA: Urease A.

Table 5 Rates of positive detection for the Helicobacter pylori 16S rDNA or urease A genes in offspring mice, n (%)

Group		Number of examined mice	Gastric mucosa samples1		Intestinal tissues1		Number of examined mice	Gastric mucosa samples2		Intestinal contents2		Number of examined mice	Gastric mucosa samples3		Intestinal contents3
			Hp 16S rDNA positive samples	Hp ureA positive samples	Hp 16S rDNA positive samples	Hp ureA positive samples		Hp 16S rDNA positive samples	Hp ureA positive samples	Hp 16S rDNA positive samples	Hp ureA positive samples		Hp 16S rDNA positive samples	Hp ureA positive samples	Hp 16S rDNA positive samples	Hp ureA positive samples
Modeling of vaginal infection with Candida	V1	8	3 (37.5)	1 (12.5)	5 (62.5)	3 (37.5)	15	0 (0)	0 (0)	1 (6.7)	0 (0)	16	2 (12.5)	1 (6.3)	0 (0)	2 (12.5)
	V2	10	3 (30.0)	2 (20.0)	3 (30.0)	0 (0)	16	2 (12.5)	0 (0)	0 (0)	0 (0)	17	2 (11.8)	0 (0)	1 (5.9)	0 (0)
	V3	10	3 (30.0)	0 (0)	0 (0)	1 (10.0)	17	6 (35.3)	0 (0)	3 (17.6)	3 (17.6)	18	2 (11.1)	0 (0)	2 (11.1)	0 (0)
	VC	6	0 (0)	0 (0)	0 (0)	0 (0)	8	0 (0)	0 (0)	0 (0)	0 (0)	9	0 (0)	0 (0)	0 (0)	0 (0)
	VN	8	0 (0)	0 (0)	0 (0)	0 (0)	15	0 (0)	0 (0)	0 (0)	0 (0)	14	0 (0)	0 (0)	0 (0)	0 (0)
Modeling of gastric infection with Candida	G1	8	0 (0)	2 (25.0)	0 (0)	1 (12.5)	14	0 (0)	4 (28.6)	1 (7.1)	0 (0)	11	3 (27.3)	2 (18.2)	2 (18.2)	0 (0)
	G2	8	1 (12.5)	1 (12.5)	1 (12.5)	1 (12.5)	18	1 (5.6)	2 (11.1)	3 (16.7)	0 (0)	14	3 (21.4)	4 (28.6)	1 (7.1)	0 (0)
	G3	8	1 (12.5)	1 (12.5)	2 (25.0)	2 (25.0)	20	1 (5.0)	3 (15.0)	4 (20.0)	0 (0)	19	3 (15.8)	0 (0)	2 (10.5)	0 (0)
	G4	8	0 (0)	3 (37.5)	0 (0)	0 (0)	14	0 (0)	0 (0)	5 (35.7)	0 (0)	10	1 (10.0)	0 (0)	3 (30.0)	1 (10.0)
	GC	7	0 (0)	0 (0)	0 (0)	0 (0)	20	0 (0)	0 (0)	0 (0)	0 (0)	12	0 (0)	0 (0)	0 (0)	0 (0)
	GN	8	0 (0)	0 (0)	0 (0)	0 (0)	12	0 (0)	0 (0)	0 (0)	0 (0)	10	0 (0)	0 (0)	0 (0)	0 (0)

¹0-week mice.

²3-week mice.

³6-week mice.

Hp: Helicobacter pylori; ureA: Urease A.

Table 6 Rates of positive detection for Helicobacter pylori in vaginally and cesarean section-delivered offspring, n (%)

Group		Vaginal delivery1		Cesarean section1		Vaginal delivery2		Cesarean section2		Vaginal delivery3		Cesarean section3
		Number of mice	Hp positive mice4	Number of mice	Hp positive mice	Number of mice	Hp positive mice	Number of mice	Hp positive mice	Number of mice	Hp positive mice	Number of mice	Hp positive mice
Modeling of vaginal infection with Candida	V1	4	1 (25.0)	4	3 (75.0)	9	0 (0)	6	1 (16.7)	10	2 (20.0)	6	1 (16.7)
	V2	4	2 (50.0)	6	3 (50.0)	7	2 (28.6)	9	0 (0)	7	2 (28.6)	10	0 (0)
	V3	4	1 (25.0)	6	2 (33.3)	7	4 (57.1)	10	4 (40.0)	8	1 (12.5)	10	2 (20.0)
	VC	2	0 (0)	4	0 (0)	3	0 (0)	5	0 (0)	3	0 (0)	6	0 (0)
	VN	4	0 (0)	4	0 (0)	9	0 (0)	6	0 (0)	8	0 (0)	6	0 (0)
Modeling of gastric infection with Candida	G1	5	0 (0)	3	2 (66.7)	9	4 (44.4)	5	0 (0)	7	3 (42.9)	4	3 (75.0)
	G2	4	1 (25.0)	4	2 (50.0)	11	4 (36.4)	7	1 (14.3)	9	5 (55.6)	5	1 (20.0)
	G3	4	2 (50.0)	4	2 (50.0)	9	2 (22.2)	11	5 (45.5)	7	0 (0)	12	4 (33.3)
	G4	4	2 (50.0)	4	1 (25.0)	7	3 (42.9)	7	2 (28.6)	4	2 (50.0)	6	1 (16.7)
	GC	4	0 (0)	3	0 (0)	13	0 (0)	7	0 (0)	7	0 (0)	5	0 (0)
	GN	4	0 (0)	4	0 (0)	6	0 (0)	6	0 (0)	3	0 (0)	7	0 (0)

¹0-week mice.

²3-week mice.

³6-week mice.

⁴If one of the samples among those obtained for the gastric mucosa, intestinal tissue, or intestinal contents of the offspring mice is positive for the Helicobacter pylori 16S rDNA or urease A gene, it is identified as a Helicobacter pylori-positive mouse.

Hp: Helicobacter pylori.

Table 7 Rates of positive detection for Helicobacter pylori 16S rDNA or urease A genes in the placenta and fetal membranes of cesarean section-delivered offspring mice, n (%)

Group		Number of examined samples	Placenta		Fetal membranes
			Hp 16S rDNA positive samples	Hp ureA positive samples	Hp 16S rDNA positive samples	Hp ureA positive samples
Modeling of vaginal infection with Candida	V1	4	1 (25.0)	0 (0)	1 (25.0)	0 (0)
	V2	6	2 (33.3)	1 (16.7)	1 (16.7)	1 (16.7)
	V3	6	2 (33.3)	0 (0)	1 (16.7)	2 (33.3)
	VC	4	0 (0)	0 (0)	0 (0)	0 (0)
	VN	4	0 (0)	0 (0)	0 (0)	0 (0)
Modeling of gastric infection with Candida	G1	4	0 (0)	1 (25.0)	0 (0)	1 (25.0)
	G2	4	0 (0)	0 (0)	0 (0)	0 (0)
	G3	4	1 (25.0)	1 (25.0)	0 (0)	1 (25.0)
	G4	4	0 (0)	0 (0)	0 (0)	0 (0)
	GC	4	0 (0)	0 (0)	0 (0)	0 (0)
	GN	4	0 (0)	0 (0)	0 (0)	0 (0)

Hp: Helicobacter pylori; ureA: Urease A.