BPG is committed to discovery and dissemination of knowledge
Basic Study
Copyright: ©Author(s) 2026.
World J Gastroenterol. Oct 7, 2026; 32(37): 121244
Published online Oct 7, 2026. doi: 10.3748/wjg.121244
Table 1 Wenyang Jiedu Huayu Formula composition
Chinese name
Scientific name
Common name
Weight (g)
Part used
Fu PianAconitum carmichaelii DebeauxProcessed aconite lateral root10Processed lateral root
Bai ZhuAtractylodes macrocephala KoidzLargehead atractylodes rhizome30Rhizome
Yin ChenArtemisia capillaris ThunbCapillary wormwood herb30Aerial part
Dan ShenSalvia miltiorrhiza BungeSalvia root30Root and rhizome
Chi ShaoPaeonia lactiflora PallRed peony root60Root
Yi Yi RenCoix lacryma-jobi L. var. ma-yuen (Roman.) StapfCoix seed30Seed
Table 2 Flameng scoring criteria for mitochondrial damage
Score
Description
0Normal mitochondrial morphology
1Mild swelling, decreased matrix density, and separated cristae
2Moderate swelling, translucent matrix, and intact cristae
3Severe swelling, condensed matrix, and ruptured cristae
4Severe swelling with ruptured cristae, complete loss of inner and outer membranes, and vacuolation
Table 3 Primer sequences for reverse transcription quantitative polymerase chain reaction
Gene
Forward sequence (5′-3′)
Reverse sequence (5′-3′)
Size (bp)
SDHACTGTTGCCAAGGACCTAGCATAGCCTCTTCCTTCACGGAT70
SDHBCAAAACCTTCGCCATTTACCGATTAGAGCATCCAGCACCATCG32
HIF-1αACGATTGTGAAGTTAATGCTCCCAACCAACAGAAACGAAACCCC120
β-actinACATCCGTAAAGACCTCTATGCCTACTCCTGCTTGCTGATCCAC42


Write to the Help Desk