©The Author(s) 2025.
World J Gastroenterol. May 14, 2025; 31(18): 105729
Published online May 14, 2025. doi: 10.3748/wjg.v31.i18.105729
Published online May 14, 2025. doi: 10.3748/wjg.v31.i18.105729
Table 1 Internal control of β-actin and the primer sequences
| Gene | Primer | Nucleotides |
| CCT6A | Forward (5′ → 3′) | CTGAAACAGGCGGATCTCTACA |
| Reverse (5′ → 3′) | CCCTGTCCATCTCTCTGCTTAC | |
| β-Actin | Forward (5′ → 3′) | GCCTGACGGCCAGGTCATCAC |
| Reverse (5′ → 3′) | CGGATGTCCACGTCACACTTC |
- Citation: Ma JX, Li XJ, Li YL, Liu MC, Du RH, Cheng Y, Li LJ, Ai ZY, Jiang JT, Yan SY. Chaperonin-containing tailless complex polypeptide 1 subunit 6A negatively regulates autophagy and protects colorectal cancer cells from cisplatin-induced cytotoxicity. World J Gastroenterol 2025; 31(18): 105729
- URL: https://www.wjgnet.com/1007-9327/full/v31/i18/105729.htm
- DOI: https://dx.doi.org/10.3748/wjg.v31.i18.105729
