Copyright
©The Author(s) 2024.
World J Gastroenterol. Mar 7, 2024; 30(9): 1189-1212
Published online Mar 7, 2024. doi: 10.3748/wjg.v30.i9.1189
Published online Mar 7, 2024. doi: 10.3748/wjg.v30.i9.1189
Table 1 Sequences of single guide ribonucleic acids used in the mouse experiments
| sgRNA | sgRNA sequence (5' to 3') |
| Ugt1a1 sgRNA1 | CACTAACAGCCTCCCAGCGT |
| Ugt1a1 sgRNA2 | CACTAACAGCCTCCCAGCGT |
| Ugt1a1 sgRNA3 | GCTGCACAATGCCGAGTTTA |
| Control sgRNA | AATCAACCGTGATAGTCTCG |
Table 2 Information about primary antibodies
| Antibody | Source | Lot number | Manufacturer | Reactivity |
| GAPDH | Mouse mAb | sc-365062 | Santa Cruz Biotechnology, Dallas, TX, United States | Mouse, human |
| Cleaved caspase-3 | Rabbit mAb | 9664 | Cell Signaling Technology, Danvers, MA, United States | Mouse, human |
| GRP78 | Rabbit mAb | ab108615 | Abcam, Cambridge, MA, United States | Mouse, human |
| MTP | Mouse mAb | sc-515742 | Santa Cruz Biotechnology, Dallas, TX, United States | Mouse, human |
| UCP2 | Mouse mAb | sc-390189 | Santa Cruz Biotechnology, Dallas, TX, United States | Mouse, human |
| p-MLKL | Rabbit mAb | 37333S | Cell Signaling Technology, Danvers, MA, United States | Mouse, human |
| MCAD | Mouse mAb | sc-365109 | Santa Cruz Biotechnology, Dallas, TX, United States | Mouse, human |
| MLKL | Rabbit mAb | PA5-34733 | Thermo Fisher Scientific, Waltham, MA, United States | Mouse, human |
| SREBP1c | Mouse mAb | MA5-16124 | Thermo Fisher Scientific, Waltham, MA, United States | Mouse, human |
| ACSL4 | Mouse mAb | sc-365230 | Santa Cruz Biotechnology, Dallas, TX, United States | Mouse, human |
Table 3 Markers of liver function in patients with uridine diphosphate glucuronosyltransferase 1A1 gene mutations
| Patient | Gender | Age | ALT, U/L | AST, U/L | TBil, μmol/L | DBil, μmol/L | IBil, μmol/L | TBA, U/L |
| Ref: 0-40 | Ref: 0-34 | Ref: 5.1-19.0 | Ref: 1.7-6.8 | Ref: 1.7-13.2 | Ref: 0-50 | |||
| 1 | Male | 34 | 76↑ | 323↑ | 565.4↑ | 269.3↑ | 296.1↑ | 225.10↑ |
| 2 | Male | 43 | 26 | 28 | 184.2↑ | 24.8↑ | 155.8↑ | 160.00↑ |
| 3 | Male | 54 | 289↑ | 134↑ | 78.4↑ | 23.5↑ | 54.9↑ | 48.40↑ |
| 4 | Female | 25 | 22 | 28 | 368.7↑ | 186.6↑ | 182.1↑ | 242.54↑ |
| 5 | Female | 27 | 6 | 13 | 43.3↑ | 7.5↑ | 35.8↑ | 43.33↑ |
| 6 | Male | 21 | 6 | 15 | 50.2↑ | 10.0↑ | 40.2↑ | 38.93↑ |
| 7 | Female | 48 | 34 | 39↑ | 42.2↑ | 7.2↑ | 34.8↑ | 14.94↑ |
- Citation: Jiang JL, Zhou YY, Zhong WW, Luo LY, Liu SY, Xie XY, Mu MY, Jiang ZG, Xue Y, Zhang J, He YH. Uridine diphosphate glucuronosyltransferase 1A1 prevents the progression of liver injury. World J Gastroenterol 2024; 30(9): 1189-1212
- URL: https://www.wjgnet.com/1007-9327/full/v30/i9/1189.htm
- DOI: https://dx.doi.org/10.3748/wjg.v30.i9.1189
