Copyright
©The Author(s) 2024.
World J Gastroenterol. Mar 7, 2024; 30(9): 1189-1212
Published online Mar 7, 2024. doi: 10.3748/wjg.v30.i9.1189
Published online Mar 7, 2024. doi: 10.3748/wjg.v30.i9.1189
sgRNA | sgRNA sequence (5' to 3') |
Ugt1a1 sgRNA1 | CACTAACAGCCTCCCAGCGT |
Ugt1a1 sgRNA2 | CACTAACAGCCTCCCAGCGT |
Ugt1a1 sgRNA3 | GCTGCACAATGCCGAGTTTA |
Control sgRNA | AATCAACCGTGATAGTCTCG |
Antibody | Source | Lot number | Manufacturer | Reactivity |
GAPDH | Mouse mAb | sc-365062 | Santa Cruz Biotechnology, Dallas, TX, United States | Mouse, human |
Cleaved caspase-3 | Rabbit mAb | 9664 | Cell Signaling Technology, Danvers, MA, United States | Mouse, human |
GRP78 | Rabbit mAb | ab108615 | Abcam, Cambridge, MA, United States | Mouse, human |
MTP | Mouse mAb | sc-515742 | Santa Cruz Biotechnology, Dallas, TX, United States | Mouse, human |
UCP2 | Mouse mAb | sc-390189 | Santa Cruz Biotechnology, Dallas, TX, United States | Mouse, human |
p-MLKL | Rabbit mAb | 37333S | Cell Signaling Technology, Danvers, MA, United States | Mouse, human |
MCAD | Mouse mAb | sc-365109 | Santa Cruz Biotechnology, Dallas, TX, United States | Mouse, human |
MLKL | Rabbit mAb | PA5-34733 | Thermo Fisher Scientific, Waltham, MA, United States | Mouse, human |
SREBP1c | Mouse mAb | MA5-16124 | Thermo Fisher Scientific, Waltham, MA, United States | Mouse, human |
ACSL4 | Mouse mAb | sc-365230 | Santa Cruz Biotechnology, Dallas, TX, United States | Mouse, human |
Patient | Gender | Age | ALT, U/L | AST, U/L | TBil, μmol/L | DBil, μmol/L | IBil, μmol/L | TBA, U/L |
Ref: 0-40 | Ref: 0-34 | Ref: 5.1-19.0 | Ref: 1.7-6.8 | Ref: 1.7-13.2 | Ref: 0-50 | |||
1 | Male | 34 | 76↑ | 323↑ | 565.4↑ | 269.3↑ | 296.1↑ | 225.10↑ |
2 | Male | 43 | 26 | 28 | 184.2↑ | 24.8↑ | 155.8↑ | 160.00↑ |
3 | Male | 54 | 289↑ | 134↑ | 78.4↑ | 23.5↑ | 54.9↑ | 48.40↑ |
4 | Female | 25 | 22 | 28 | 368.7↑ | 186.6↑ | 182.1↑ | 242.54↑ |
5 | Female | 27 | 6 | 13 | 43.3↑ | 7.5↑ | 35.8↑ | 43.33↑ |
6 | Male | 21 | 6 | 15 | 50.2↑ | 10.0↑ | 40.2↑ | 38.93↑ |
7 | Female | 48 | 34 | 39↑ | 42.2↑ | 7.2↑ | 34.8↑ | 14.94↑ |
- Citation: Jiang JL, Zhou YY, Zhong WW, Luo LY, Liu SY, Xie XY, Mu MY, Jiang ZG, Xue Y, Zhang J, He YH. Uridine diphosphate glucuronosyltransferase 1A1 prevents the progression of liver injury. World J Gastroenterol 2024; 30(9): 1189-1212
- URL: https://www.wjgnet.com/1007-9327/full/v30/i9/1189.htm
- DOI: https://dx.doi.org/10.3748/wjg.v30.i9.1189