©The Author(s) 2024.
World J Gastroenterol. Jun 7, 2024; 30(21): 2793-2816
Published online Jun 7, 2024. doi: 10.3748/wjg.v30.i21.2793
Published online Jun 7, 2024. doi: 10.3748/wjg.v30.i21.2793
Table 1 Genomic DNA removal
| Constituent | Dose |
| Template RNA | 1.76 μg |
| 4 × gDNA wiper Mix | 4 μL |
| RNase-free ddH2O | 16 μL |
Table 2 Preparation of reverse transcriptional response system
| Constituent | Dose |
| 5 × HiScript II Select qRT SuperMix II | 4 μL |
| Reaction liquid from step 1 | 16 μL |
| Reverse transcriptase | 1 μL |
Table 3 Primer sequence
| Gene | Primer | Sequence (5'-3') | PCR product |
| Homo GAPDH | Upstream | TCAAGAAGGTGGTGAAGCAGG | 115 bp |
| Downstream | TCAAAGGTGGAGGAGTGGGT | ||
| Homo HIF-1α | Upstream | GTGGCGAAGATGGTCAAGTC | 116 bp |
| Downstream | GGAGTGCCCTTGTTGAGGTGTT |
Table 4 Real-time fluorescence quantitative polymerase chain reaction system
| Constituent | Dose |
| cDNA | 4 μL |
| Forward Primer (10 μM) | 0.4 μL |
| Reverse Primer (10 μM) | 0.4 μL |
| SYBR Green Master Mix | 10 μL |
| 50 × ROX Reference Dye 2 | 0.4 μL |
| Taq Plus DNA Polymerase | 1 μL |
| RNase-free ddH2O | 25 μL |
Table 5 Real-time fluorescence quantitative polymerase chain reaction program
| Item | Temperature | Time | Cycle-index |
| Predegeneration | 95 ℃ | 10 min | 1 |
| Denaturation | 95 ℃ | 15 s | 40 |
| Annealing elongation | 60 ℃ | 60 s | 40 |
| Melting curve acquisition | 95 ℃ | 15 s | 1 |
| 60 ℃ | 60 s | 1 | |
| 95 ℃ | 15 s | 1 |
Table 6 Preparation of sodium dodecyl sulfate-polyacrylamide gel electrophoresis separation glue
| Reagent | Separation glue concentration (%) | |||||
| 8% | 10% | 12% | 15% | 18% | 20% | |
| H2O | 4.63 mL | 4 mL | 3.3 mL | 2.3 mL | 1.3 mL | 0.63 mL |
| 30% acrylamide (29: 1) | 2.67 mL | 3.3 mL | 4 mL | 5 mL | 6 mL | 6.67 mL |
| 1.5M Tris-HCl (pH 8.8) | 2.5 mL | 2.5 mL | 2.5 mL | 2.5 mL | 2.5 mL | 2.5 mL |
| 10%SDS | 0.1 mL | 0.1 mL | 0.1 mL | 0.1 mL | 0.1 mL | 0.1 mL |
| Ammonium persulfate | 0.1 mL | 0.1 mL | 0.1 mL | 0.1 mL | 0.1 mL | 0.1 mL |
| TEMED | 5 μL | 5 μL | 5 μL | 5 μL | 5 μL | 5 μL |
| Bulk volume | 10 mL | 10 mL | 10 mL | 10 mL | 10 mL | 10 mL |
Table 7 Preparation of sodium dodecyl sulfate-polyacrylamide gel electrophoresis concentrated glue
| Reagent | Concentration | |||
| H2O | 2 mL | 3 mL | 4 mL | 6 mL |
| 30% acrylamide (29:1) | 0.5 mL | 0.75 mL | 1 mL | 1.5 mL |
| 1M TRIS-HCl (pH 6.8) | 0.5 mL | 0.75 mL | 1 mL | 1.5 mL |
| 10%SDS | 40 μL | 60 μL | 80 μL | 120 μL |
| Ammonium persulfate | 30 μL | 45 μL | 60 μL | 90 μL |
| TEMED | 4 μL | 6 μL | 8 μL | 12 μL |
| Bulk volume | 3 mL | 4.5 mL | 6 mL | 9 mL |
Table 8 Objective fragment double enzyme digestion process
| Constituent | Dose |
| 1 × Tango Buffer | 2.0 μL |
| BamH I | 0.5 μL |
| EcoR I | 0.5 μL |
| Objective fragment | 8.0 μL |
| ddH2O | 9.0 μL |
| Total dose | 20.0 μL |
Table 9 Carrier double enzyme digestion process
| Constituent | Dose |
| 1 × Tango Buffer | 2.0 μL |
| BamH I | 0.5 μL |
| EcoR I | 0.5 μL |
| Carrier plasmid DNA | 8.0 μL |
| ddH2O | 9.0 μL |
| Total dose | 20.0 μL |
Table 10 Connection system processing
| Constituent | Dose |
| 2 × Sosoo Cloning MIX | 5.0 μL |
| pLVX-SV40-IRES-EGFP-Puro | 2.0 μL |
| Target fragment | 2.0 μL |
| ddH2O | 1.0 μL |
Table 11 Culture solution identified by polymerase chain reaction
| Constituent | Dose |
| EntilinkTM PCR Master Mix | 25.0 μL |
| Forward Primer (10 μM) | 2.0 μL |
| Reverse Primer (10 μM) | 2.0 μL |
| Template | Appropriate amount |
| ddH2O | Up to 50 μL |
Table 12 shRNA annealing reaction system
| Constituent | Dose |
| 10 × annealing buffer | 5 μL |
| Forward Primer (10 μM) | 10 μL |
| Reverse Primer (10 μM) | 10 μL |
| ddH2O | Up to 50 μL |
Table 13 shRNA annealing polymerase chain reaction conditions
| Procedure | Temperature | Time | Cycle-index |
| Predegeneration | 95 ℃ | 2 min | 10 |
| Degeneration | 95 ℃ | 30 s | |
| Anneal | 60 ℃ | 30 s | |
| Final insulation | 4 ℃ | Unlimited |
Table 14 Recombinant plasmid linking system
| Constituent | Dose |
| 10 × ligase Buffer | 2.0 μL |
| pLVshRNA-EGFP(2A)Puro double enzyme digestion vector | 2.0 μL |
| Target fragment | 2.0 μL |
| Ligase | 0.5 μL |
| ddH2O | 1.0 μL |
- Citation: Zhao ZX, Li S, Liu LX. Thymoquinone affects hypoxia-inducible factor-1α expression in pancreatic cancer cells via HSP90 and PI3K/AKT/mTOR pathways. World J Gastroenterol 2024; 30(21): 2793-2816
- URL: https://www.wjgnet.com/1007-9327/full/v30/i21/2793.htm
- DOI: https://dx.doi.org/10.3748/wjg.v30.i21.2793
