Copyright
©The Author(s) 2023.
World J Gastroenterol. Aug 21, 2023; 29(31): 4783-4796
Published online Aug 21, 2023. doi: 10.3748/wjg.v29.i31.4783
Published online Aug 21, 2023. doi: 10.3748/wjg.v29.i31.4783
Table 1 Poly(A)-specific ribonuclease shRNA target sequence
Target number | Target sequence |
Human-PARN-1 | TATGACACAGCCTCTGAACA |
Human-PARN-2 | TGGATACTAAATTGATGGCCA |
Human-PARN-3 | CAACACATCCCTTGCGGAATT |
Table 2 Primer sequences
Gene | Sequence (5’-3’) | Tm (°C) | |
GAPDH | Forward primer | GAAAGCCTGCCGGTGACTAA | 60.32 |
Reverse primer | GCCCAATACGACCAAATCAGAG | 59.39 | |
PARN | Forward primer | GCCGCGGAATTCGATTTTAAG | 58.63 |
Reverse primer | ATCGATGGCGAAGAAGTCGG | 60.25 |
Table 3 Relationship between poly(A)-specific ribonuclease expression and tumor characteristics in patients with esophageal cancer
Features | No. of patients | PARN expression | P value | |
Low | High | |||
All patients | 91 | 48 | 43 | |
Age (yr) | 0.758 | |||
< 65 | 45 | 23 | 22 | |
≥ 65 | 46 | 25 | 21 | |
Gender | 0.433 | |||
Male | 73 | 40 | 33 | |
Female | 18 | 8 | 10 | |
Tumor size | 0.110 | |||
≤ 5 cm | 46 | 28 | 18 | |
> 5 cm | 35 | 15 | 20 | |
T Infiltrate | 0.680 | |||
T0 | 1 | 1 | 0 | |
T1 | 3 | 1 | 2 | |
T2 | 15 | 8 | 7 | |
T3 | 39 | 22 | 17 | |
T4 | 10 | 4 | 6 | |
Lymphatic metastasis (n) | 0.028a | |||
N0 | 31 | 20 | 11 | |
N1 | 18 | 10 | 8 | |
N2 | 11 | 4 | 7 | |
N3 | 8 | 2 | 6 | |
Stage | 0.336 | |||
I | 3 | 2 | 1 | |
II | 30 | 18 | 12 | |
III | 33 | 14 | 19 | |
IV | 2 | 2 | 0 | |
Lymphoid positive number | 0.164 | |||
< 1 | 43 | 26 | 17 | |
≥ 1 | 46 | 21 | 25 | |
Grade | 0.516 | |||
I | 7 | 4 | 3 | |
II | 49 | 25 | 24 | |
III | 26 | 16 | 10 |
Table 4 Relationship between poly(A)-specific ribonuclease expression and tumor characteristics (lymphatic metastasis) in patients with esophageal cancer (Spearman’s correlation coefficient for ranked data)
PARN | ||
Lymphatic metastasis (N) | Spearman correlation analysis | 0.269 |
Significance (two-tailed) | 0.027a | |
N | 68 |
Table 5 Immunohistochemistry scoring criteria
Score type | Score point | Score |
Positive cell score | No positive signal | 0 (negative) |
0% < the proportion of positive cells < 25% | 1 | |
25% ≤ the proportion of positive cells < 50% | 2 | |
50% ≤ the proportion of positive cells < 75% | 3 | |
75% ≤ the proportion of positive cells | 4 | |
Staining intensity score (the staining intensity of cytoplasm, membrane or nucleus) | No signal color | 0 (negative) |
Pale yellow | 1 | |
Brown yellow | 2 | |
Dark brown | 3 |
- Citation: Zhang FW, Xie XW, Chen MH, Tong J, Chen QQ, Feng J, Chen FT, Liu WQ. Poly(A)-specific ribonuclease protein promotes the proliferation, invasion and migration of esophageal cancer cells. World J Gastroenterol 2023; 29(31): 4783-4796
- URL: https://www.wjgnet.com/1007-9327/full/v29/i31/4783.htm
- DOI: https://dx.doi.org/10.3748/wjg.v29.i31.4783