©The Author(s) 2023.
World J Gastroenterol. Aug 21, 2023; 29(31): 4783-4796
Published online Aug 21, 2023. doi: 10.3748/wjg.v29.i31.4783
Published online Aug 21, 2023. doi: 10.3748/wjg.v29.i31.4783
Table 1 Poly(A)-specific ribonuclease shRNA target sequence
| Target number | Target sequence |
| Human-PARN-1 | TATGACACAGCCTCTGAACA |
| Human-PARN-2 | TGGATACTAAATTGATGGCCA |
| Human-PARN-3 | CAACACATCCCTTGCGGAATT |
Table 2 Primer sequences
| Gene | Sequence (5’-3’) | Tm (°C) | |
| GAPDH | Forward primer | GAAAGCCTGCCGGTGACTAA | 60.32 |
| Reverse primer | GCCCAATACGACCAAATCAGAG | 59.39 | |
| PARN | Forward primer | GCCGCGGAATTCGATTTTAAG | 58.63 |
| Reverse primer | ATCGATGGCGAAGAAGTCGG | 60.25 |
Table 3 Relationship between poly(A)-specific ribonuclease expression and tumor characteristics in patients with esophageal cancer
| Features | No. of patients | PARN expression | P value | |
| Low | High | |||
| All patients | 91 | 48 | 43 | |
| Age (yr) | 0.758 | |||
| < 65 | 45 | 23 | 22 | |
| ≥ 65 | 46 | 25 | 21 | |
| Gender | 0.433 | |||
| Male | 73 | 40 | 33 | |
| Female | 18 | 8 | 10 | |
| Tumor size | 0.110 | |||
| ≤ 5 cm | 46 | 28 | 18 | |
| > 5 cm | 35 | 15 | 20 | |
| T Infiltrate | 0.680 | |||
| T0 | 1 | 1 | 0 | |
| T1 | 3 | 1 | 2 | |
| T2 | 15 | 8 | 7 | |
| T3 | 39 | 22 | 17 | |
| T4 | 10 | 4 | 6 | |
| Lymphatic metastasis (n) | 0.028a | |||
| N0 | 31 | 20 | 11 | |
| N1 | 18 | 10 | 8 | |
| N2 | 11 | 4 | 7 | |
| N3 | 8 | 2 | 6 | |
| Stage | 0.336 | |||
| I | 3 | 2 | 1 | |
| II | 30 | 18 | 12 | |
| III | 33 | 14 | 19 | |
| IV | 2 | 2 | 0 | |
| Lymphoid positive number | 0.164 | |||
| < 1 | 43 | 26 | 17 | |
| ≥ 1 | 46 | 21 | 25 | |
| Grade | 0.516 | |||
| I | 7 | 4 | 3 | |
| II | 49 | 25 | 24 | |
| III | 26 | 16 | 10 | |
Table 4 Relationship between poly(A)-specific ribonuclease expression and tumor characteristics (lymphatic metastasis) in patients with esophageal cancer (Spearman’s correlation coefficient for ranked data)
| PARN | ||
| Lymphatic metastasis (N) | Spearman correlation analysis | 0.269 |
| Significance (two-tailed) | 0.027a | |
| N | 68 |
Table 5 Immunohistochemistry scoring criteria
| Score type | Score point | Score |
| Positive cell score | No positive signal | 0 (negative) |
| 0% < the proportion of positive cells < 25% | 1 | |
| 25% ≤ the proportion of positive cells < 50% | 2 | |
| 50% ≤ the proportion of positive cells < 75% | 3 | |
| 75% ≤ the proportion of positive cells | 4 | |
| Staining intensity score (the staining intensity of cytoplasm, membrane or nucleus) | No signal color | 0 (negative) |
| Pale yellow | 1 | |
| Brown yellow | 2 | |
| Dark brown | 3 |
- Citation: Zhang FW, Xie XW, Chen MH, Tong J, Chen QQ, Feng J, Chen FT, Liu WQ. Poly(A)-specific ribonuclease protein promotes the proliferation, invasion and migration of esophageal cancer cells. World J Gastroenterol 2023; 29(31): 4783-4796
- URL: https://www.wjgnet.com/1007-9327/full/v29/i31/4783.htm
- DOI: https://dx.doi.org/10.3748/wjg.v29.i31.4783
