©The Author(s) 2023.
World J Gastroenterol. May 28, 2023; 29(20): 3103-3118
Published online May 28, 2023. doi: 10.3748/wjg.v29.i20.3103
Published online May 28, 2023. doi: 10.3748/wjg.v29.i20.3103
Table 1 The drugs with the highest affinity of transforming growth factor β type II receptor
| Name | ZINC_ID | Affinity (kcal/mol) | Indications |
| Darifenacin | ZINC000001996117 | -7.6 | Urinary frequency, urgency, and incontinence caused by bladder hyperstimulation |
| Cyproheptadine | ZINC000000968264 | -7.4 | Allergy |
| Lifitegrast | ZINC000084668739 | -7.4 | Symptoms and signs of dry eye |
| Difenoxin | ZINC000000601317 | -7.3 | Functional diarrhea and chronic enteritis |
| Phenytoin | ZINC000002510358 | -7.3 | Epilepsy, neuralgia, and arrhythmia |
| DHE | ZINC000003978005 | -7.3 | Severe orthostatic hypotension, migraine, and headache |
| Naldemedine | ZINC000100378061 | -7.3 | Non-cancerous pain and opioid induced constipation |
| Irinotecan | ZINC000001612996 | -7.3 | Advanced colorectal cancer and postoperative adjuvant chemotherapy |
Table 2 Content of secondary structural analysis from DSSP method
| Structure | Coil | β-Sheet | β-Bridge | Bend | Turn | 3-Helix |
| TGFβR2 | 0.58 | 0.3 | 0.42 | 0.02 | 0.12 | 0.13 |
| TGFβR2-DHE | 0.56 | 0.3 | 0.42 | 0.02 | 0.12 | 0.12 |
Table 3 DNA sequence of extracellular transforming growth factor β type II receptor before and after mutation
| Before mutation | After mutation | |
| DNA sequence of TGFβR2 extracellular domain | ACGATCCCACCGCACGTTCAGAAGTCGGTTAATAACGACA | ACGATCCCACCGCACGTTCAGAAGTCGGTTAATAACGACA |
- Citation: Zheng KX, Yuan SL, Dong M, Zhang HL, Jiang XX, Yan CL, Ye RC, Zhou HQ, Chen L, Jiang R, Cheng ZY, Zhang Z, Wang Q, Jin WZ, Xie W. Dihydroergotamine ameliorates liver fibrosis by targeting transforming growth factor β type II receptor. World J Gastroenterol 2023; 29(20): 3103-3118
- URL: https://www.wjgnet.com/1007-9327/full/v29/i20/3103.htm
- DOI: https://dx.doi.org/10.3748/wjg.v29.i20.3103
