©The Author(s) 2022.
World J Gastroenterol. Jan 14, 2022; 28(2): 242-262
Published online Jan 14, 2022. doi: 10.3748/wjg.v28.i2.242
Published online Jan 14, 2022. doi: 10.3748/wjg.v28.i2.242
Table 1 Demographic characteristics of the study population, n (%)
| Variable | Helicobacter pylori (+ve) | Helicobacter pylori (-ve) | Total | P value | |
| n = 61 | n = 61 | n = 122 | |||
| Mean age in yr ± Standard deviation (range) | 44.00 ± 16.99 (15-85) | 44.74 ± 18.10 (17-89) | 44.37 ± 17.48 (15-89) | 0.91841 | |
| Gender | Male | 36 (50.00) | 36 (50.00) | 72 (59.02) | 1.0000 |
| Female | 25 (50.00) | 25 (50.00) | 50 (40.98) | ||
| Residence | Urban | 24 (44.44) | 30 (55.56) | 54 (44.26) | 0.3622 |
| Rural | 37 (54.41) | 31 (45.59) | 68 (55.74) | ||
| Hospital | Public | 21 (33.87) | 31 (49.21) | 52 (41.60) | 0.0667 |
| Private | 41 (58.57) | 29 (41.43) | 70 (57.38) | ||
Table 2 Gastric pathologies of the study population, n (%)
| Endoscopy results | n (%) | Helicobacter pylori (+ve) | Helicobacter pylori (-ve) | P value1 |
| Normal gastric findings | 9 (7.40) | 4 (6.45) | 5 (7.94) | 0.2686 |
| Esophagitis | 4 (3.30) | 3 (4.80) | 1 (1.59) | |
| Esophageal varices | 6 (4.90) | 1 (1.61) | 5 (7.94) | |
| Gastritis | 55 (45.10) | 28 (45.16) | 27 (42.86) | |
| Duodenitis | 6 (4.90) | 3 (4.84) | 3 (4.76) | |
| Peptic ulcer | 27 (22.13) | 17 (27.42) | 10 (15.87) | |
| Cancer | 15 (12.30) | 5 (8.20) | 10 (16.4) | |
| Total | 122 (100) | 61 (50.00) | 61 (50.00) |
Table 3 Nucleotide variations in the 5’-regulatory (-584 to +107) region of tumor necrosis alpha in Sudanese Helicobacter pylori-infected patients
| SNP | Event | SNP locus1 | Chromosomeposition | Serialnumber (rs) |
| C>G (homozygous) | Transversion | -567 | NG_007462.1:g.4422 C>G | rs2857711 |
| G>A (heterozygous) | Transition | -375 | NG_007462.1:g.4614 G>A | rs1800750 |
| G>A (heterozygous and homozygous) | Transition | -307 | NG_007462.1:g.4682 G>A | rs1800629 |
| G>A (heterozygous) | Transition | -237 | NG_007462.1:g.4752 G>A | rs361525 |
| T>A (heterozygous) | Transversion | -76 | NG_007462.1:g.4913 T>A | rs41297589 |
| A>T (heterozygous) | Transversion | +27 | NG_007462.1:g.5016 A>T2 | - |
| Insertion of C | - | +70 | NG_007462.1:g.5058-5059 InsC | - |
Table 4 Overview of the in silico predicted tumor necrosis factor-alpha promoter regions for the respective prediction programs. The most predicted region is indicated in bold
Table 5 Summary of the in silico predicted transcription factor binding sites for tumor necrosis factor-alpha (-146 to +10) region
| TranscriptionFactor | Position1 | SNP in binding site | Software | |||||||
| Start | End | AliBaba2.1 | Alggen Promo | Tfsitescan | TF-Binding | GPMiner | ||||
| Elk-1 | -145 | -130 | X2 | X | ||||||
| Sp1 | -138 | -126 | X | X | ||||||
| AP-2 | -129 | -118 | X | X | ||||||
| Ets-1 | -118 | -111 | X | |||||||
| PEA3/ Ets-1 | -118 | -110 | X | |||||||
| T3R_TRE1 | -115 | -108 | X | X | X | |||||
| TNF-alpha-CRE | -112 | 92 | X | X | ||||||
| C/EBP-beta | -100 | -74 | rs41297589 [-76]3 | X | X | |||||
| NF-kappaB | -99 | -86 | X | X | ||||||
| AP-1 | -67 | -57 | X | |||||||
| NF-kappaB | -55 | -46 | rs765073823 [-48]rs537401710 [-47] | X | ||||||
| Sp1 | -54 | -41 | rs765073823 [-48]rs537401710 [-47] | X | X | X | ||||
| Sp1 | -48 | -39 | rs765073823 [-48]rs537401710 [-47] | X | X | X | ||||
| GATA | -40 | -30 | rs539666421 [-38] | X | X | X | ||||
| AP-2 | -38 | -27 | rs539666421 [-38] | X | X | X | ||||
| TBP | -29 | -20 | X | X | X | |||||
Table 6 Overview of conserved transcription factor binding sites predicted by multiple-sequence local alignment and visualization
| Transcription Factor | Binding sequence | Position1 | Conserved SNPs | |
| Start | End | |||
| V$CETS168_Q6 | gCTTCCTC | -115 | -108 | |
| V$ETS_Q6 | gcTTCCtc | -115 | -108 | |
| V$SP1_Q4_01 | ttccCCGCCCtcc | -51 | -39 | rs765073823 [-48]rs537401710 [-47] |
| V$SP1_Q6_01 | tcCCCGCCCt | -50 | -41 | rs765073823 [-48]rs537401710 [-47] |
| V$SP1_Q2_01 | cCCCGCCCtc | -49 | -40 | rs765073823 [-48]rs537401710 [-47] |
Table 7 Summary of the in silico predicted composite regulatory elements for the -146 to +10 region of tumor necrosis factor-alpha
| Composite element | MatrixName for a 1st element | Score, strand | Distance in between | MatrixName for a 2nd element | Score, strand | Position of CE, orientation | orientation | Composite score | P value | Sequence |
| CE00266 | V$ETS_Q6 | 0.991+ | 12 | V$AP1_Q2_01 | 0.831+ | -118 | + | 0 | 1.08e-03 | GCTTCCTCCagaTGAGCTCATGGG |
| CE00109 | V$AP1_C | 0.853- | 8 | V$NFAT_Q6 | 0.943- | -66 | - | 0.007 | 3.42e-03 | TTGAATGATTCTTTCCCCGC |
| CE00150 | V$AP1_C | 0.853- | 8 | V$NFAT_Q6 | 0.943- | -66 | - | -0.237 | 3.42e-03 | TTGAATGATTCTTTCCCCGC |
| CE00058 | V$HMGIY_Q6 | 0.955- | -5 | V$NFKB_Q6_01 | 0.759- | -78 | - | -0.09 | 6.89e-03 | GTTTTCCGCTG |
| CE00058 | V$HMGIY_Q6 | 0.955- | -4 | V$NFKB_Q6_01 | 0.662- | -78 | - | 0.005 | 9.20e-03 | GTTTTCCGCTGG |
| CE00064 | V$HNF3_Q6 | 0.780+ | 15 | V$NF1_Q6 | 0.956+ | -28 | + | -0.254 | 4.83e-02 | ACATATAAAGGCAGtTGTTGGCACACCCAGCCA |
Table 8 Allele and genotype frequencies of tumor necrosis factor-alpha-1030 polymorphism among Helicobacter pylori-infected and uninfected subjects and their contributions to Helicobacter pylori infection, n (%)
| H. pylori (+ve), n = 61 | H. pylori (-ve), n = 61 | P value | OR (95%CI) | ||
| Allele frequency | |||||
| TNF-A-1030-T | 88 (72.13) | 98 (80.33) | 0.176 | 0.63 (0.349-1.151) | |
| TNF-A-1030-C | 34 (27.87) | 24 (19.67) | |||
| Genotype frequency | |||||
| T/T | 32 (52.46) | 43 (70.49) | - | 1 (reference) | |
| T/C | 24 (39.34) | 12 (19.67) | 0.020a | 2.69 (1.17-6.17) | |
| C/C | 5 (8.20) | 6 (9.84) | 0.862 | 1.12 (0.31-3.99) | |
Table 9 Multivariate analysis of genotype frequencies of tumor necrosis factor-alpha-1030 polymorphism and sociodemographic characteristics in Helicobacter pylori infection
Table 10 Tumor necrosis factor-alpha-1030 polymorphism and gastric cancer association risk in gastric cancerous patients and subjects with benign gastric disorders, n (%)
| Gastric pathologies | OR (95%CI) | ||
| Benign disorders1 , n = 108 | Cancer, n = 14 | ||
| Allele frequency | |||
| TNF-A-1030-T | 176 (90.28) | 21 (75.00) | 1.150 (0.4627 - 2.8600) |
| TNF-A-1030-C | 51 (9.72) | 7 (25.00) | |
| P value | 0.8116 | ||
| Genotype frequency | |||
| T/T | 68 (62.96) | 7 (50.00) | 1.700 (0.5556 - 5.2020) |
| C carrier | 40 (37.04) | 7 (50.00) | |
| P value | 0.3900 | ||
- Citation: Idris AB, Idris AB, Gumaa MA, Idris MB, Elgoraish A, Mansour M, Allam D, Arbab BM, Beirag N, Ibrahim EAM, Hassan MA. Identification of functional tumor necrosis factor-alpha promoter variants associated with Helicobacter pylori infection in the Sudanese population: Computational approach. World J Gastroenterol 2022; 28(2): 242-262
- URL: https://www.wjgnet.com/1007-9327/full/v28/i2/242.htm
- DOI: https://dx.doi.org/10.3748/wjg.v28.i2.242