©The Author(s) 2022.
World J Gastroenterol. May 7, 2022; 28(17): 1781-1797
Published online May 7, 2022. doi: 10.3748/wjg.v28.i17.1781
Published online May 7, 2022. doi: 10.3748/wjg.v28.i17.1781
Table 1 Oligonucleotide sequences used for real-time polymerase chain reaction
| Gene name | Forward (5'→3') | Reverse (5'→3') |
| FOXQ1 | TGACTTCAACAGCGACACCCA | CACCCTGTTGCTGTAGCCAAA |
| EGFR | AGACGCAGATAGTCGCCCAAAG | TCCATCAGGGCACGGTAGAAG |
| HB-EGF | CCATGTCTTCGGAAATACAAGGA | CCAGGATGGTTGTGTGGTCA |
| Akt | AGACGCAGATAGTCGCCCAAAG | TCCATCAGGGCACGGTAGAAG |
| RAF1 | AGACGCAGATAGTCGCCCAAAG | TCCATCAGGGCACGGTAGAAG |
| KRAS | GTGGACGAATATGATCCAACAATAG | TGCTGTGTCGAGAATATCCAAGAG |
| GAPDH | GGCAACGGGCTACAGCTTTA | GGCACCCCACATACATAATCAA |
Table 2 List of up- and down-regulated genes between DLDL-shFOXQ1 and DLD1-shControl with a fold-change ≥ 2.0 or ≤ -2.0 by using epidermal growth factor/platelet-derived growth factor SuperArray
| Symbol | Gene information | Fold change (shFOXQ1/shControl) | P value | FOXQ1 binding sites (TSS: -2k_+1k) |
| PLAT | Plasminogen activator, tissue | -8.01 | 0.0375 | 3 |
| COL1A1 | Collagen, type I, alpha 1 | -5.72 | 0.0138 | 1 |
| ELK1 | ELK1, member of ETS oncogene family | -5.45 | 0.0228 | 1 |
| BCAR1 | Breast cancer anti-estrogen resistance 1 | -3.97 | 0.0479 | 2 |
| PIK3R2 | Phosphoinositide-3-kinase, regulatory subunit 2 | -3.63 | 0.0197 | 3 |
| NCK2 | NCK adaptor protein 2 | -3.51 | 0.0237 | 6 |
| JUN | Jun proto-oncogene v-jun | -3.43 | 0.0077 | 12 |
| EGR1 | Early growth response 1 | -3.36 | 0.0166 | 11 |
| LTA | Lymphotoxin alpha (TNF superfamily, member 1) | -3.18 | 0.0796 | 3 |
| PDGFB | Platelet-derived growth factor beta | -2.91 | 0.1896 | 5 |
| STAT3 | Signal transducer and activator of transcription 3 (acute-phase response factor) | -2.49 | 0.0038 | 6 |
| HB-EGF | Heparin-binding EGF-like growth factor | -2.19 | 0.0278 | 3 |
| FN1 | Fibronectin 1 | -2.10 | 0.0005 | 6 |
| FASLG | Fas ligand (TNF superfamily, member 6) | -2.08 | 0.2026 | 17 |
| HRAS | V-Ha-ras Harvey rat sarcoma viral oncogene homolog | -2.06 | 0.0058 | 2 |
| MAP2K1 | Mitogen-activated protein kinase kinase 1 | -2.02 | 0.0243 | 5 |
| AKT3 | V-akt murine thymoma viral oncogene homolog 3 | -2.02 | 0.1440 | 11 |
| FOS | FBJ murine osteosarcoma viral oncogene homolog | -2.01 | 0.0470 | 5 |
Table 3 Correlation between heparin binding epidermal growth factor expression and clinicopathological characteristics of colorectal cancers in cohort of human colorectal cancer tissues
| Clinicopathological variables | Cohort tumor HB-EGF expression | P value | ||
| Negative (n = 26) | Positive (n = 39) | |||
| Age (yr) | 65.72 (10.37) | 69.43 (7.98) | ||
| Gender | Female | 11 | 23 | > 0.05 |
| Male | 14 | 16 | ||
| Size of tumor (mm) | ≤ 10 | 5 | 7 | > 0.05 |
| > 10 | 21 | 32 | ||
| Lymphatic metastasis | Absent | 19 | 19 | > 0.05 |
| Present | 7 | 20 | ||
| Tumor differentiation | I-II | 12 | 24 | > 0.05 |
| III-IV | 14 | 15 | ||
| TNM stage | I-II | 11 | 8 | > 0.05 |
| III-IV | 15 | 31 | ||
| AJCC clinical stage according to 7th issue | 1 and 2A | 17 | 24 | > 0.05 |
| 3 and 3B | 9 | 15 | ||
Table 4 Correlation analysis of forkhead Box q1 and heparin binding epidermal growth factor expression in cohort (n = 65) colorectal cancer tissues
| FOXQ1, negative (n = 31) | FOXQ1, positive (n = 34) | P value | |||
| HB-EGF | Negative (n = 26) | 20 | 6 | 4.116 | < 0.05 |
| Positive (n = 39) | 11 | 28 |
- Citation: Zhang JJ, Cao CX, Wan LL, Zhang W, Liu ZJ, Wang JL, Guo Q, Tang H. Forkhead Box q1 promotes invasion and metastasis in colorectal cancer by activating the epidermal growth factor receptor pathway. World J Gastroenterol 2022; 28(17): 1781-1797
- URL: https://www.wjgnet.com/1007-9327/full/v28/i17/1781.htm
- DOI: https://dx.doi.org/10.3748/wjg.v28.i17.1781
