BPG is committed to discovery and dissemination of knowledge
Basic Study
©The Author(s) 2022.
World J Gastroenterol. May 7, 2022; 28(17): 1781-1797
Published online May 7, 2022. doi: 10.3748/wjg.v28.i17.1781
Table 1 Oligonucleotide sequences used for real-time polymerase chain reaction
Gene name
Forward (5'→3')
Reverse (5'→3')
FOXQ1TGACTTCAACAGCGACACCCACACCCTGTTGCTGTAGCCAAA
EGFRAGACGCAGATAGTCGCCCAAAGTCCATCAGGGCACGGTAGAAG
HB-EGFCCATGTCTTCGGAAATACAAGGACCAGGATGGTTGTGTGGTCA
AktAGACGCAGATAGTCGCCCAAAGTCCATCAGGGCACGGTAGAAG
RAF1AGACGCAGATAGTCGCCCAAAGTCCATCAGGGCACGGTAGAAG
KRASGTGGACGAATATGATCCAACAATAGTGCTGTGTCGAGAATATCCAAGAG
GAPDHGGCAACGGGCTACAGCTTTAGGCACCCCACATACATAATCAA
Table 2 List of up- and down-regulated genes between DLDL-shFOXQ1 and DLD1-shControl with a fold-change ≥ 2.0 or ≤ -2.0 by using epidermal growth factor/platelet-derived growth factor SuperArray
Symbol
Gene information
Fold change (shFOXQ1/shControl)
P value
FOXQ1 binding sites (TSS: -2k_+1k)
PLATPlasminogen activator, tissue-8.010.03753
COL1A1Collagen, type I, alpha 1-5.720.01381
ELK1ELK1, member of ETS oncogene family-5.450.02281
BCAR1Breast cancer anti-estrogen resistance 1-3.970.04792
PIK3R2Phosphoinositide-3-kinase, regulatory subunit 2-3.630.01973
NCK2NCK adaptor protein 2-3.510.02376
JUNJun proto-oncogene v-jun-3.430.007712
EGR1Early growth response 1-3.360.016611
LTALymphotoxin alpha (TNF superfamily, member 1)-3.180.07963
PDGFBPlatelet-derived growth factor beta-2.910.18965
STAT3Signal transducer and activator of transcription 3 (acute-phase response factor)-2.490.00386
HB-EGFHeparin-binding EGF-like growth factor-2.190.02783
FN1Fibronectin 1-2.100.00056
FASLGFas ligand (TNF superfamily, member 6)-2.080.202617
HRASV-Ha-ras Harvey rat sarcoma viral oncogene homolog-2.060.00582
MAP2K1Mitogen-activated protein kinase kinase 1-2.020.02435
AKT3V-akt murine thymoma viral oncogene homolog 3-2.020.144011
FOSFBJ murine osteosarcoma viral oncogene homolog-2.010.04705
Table 3 Correlation between heparin binding epidermal growth factor expression and clinicopathological characteristics of colorectal cancers in cohort of human colorectal cancer tissues
Clinicopathological variablesCohort tumor HB-EGF expression
P value
Negative (n = 26)
Positive (n = 39)
Age (yr)65.72 (10.37)69.43 (7.98)
GenderFemale1123> 0.05
Male1416
Size of tumor (mm) ≤ 1057> 0.05
> 102132
Lymphatic metastasisAbsent1919> 0.05
Present720
Tumor differentiationI-II1224> 0.05
III-IV1415
TNM stageI-II118> 0.05
III-IV1531
AJCC clinical stage according to 7th issue1 and 2A1724> 0.05
3 and 3B915
Table 4 Correlation analysis of forkhead Box q1 and heparin binding epidermal growth factor expression in cohort (n = 65) colorectal cancer tissues


FOXQ1, negative (n = 31)
FOXQ1, positive (n = 34)
χ2
P value
HB-EGFNegative (n = 26)2064.116< 0.05
Positive (n = 39)1128