BPG is committed to discovery and dissemination of knowledge
Basic Study
©The Author(s) 2021.
World J Gastroenterol. Dec 14, 2021; 27(46): 7982-7994
Published online Dec 14, 2021. doi: 10.3748/wjg.v27.i46.7982
Table 1 Quantitative real time PCR primer sequences
Gene
Forward (5’-3’)
Reverse (5’-3’)
hnf1bCCCATCCTCAAAGAGCTCCAAGAGGTGGGATTGGTTCAGG
GAPDH(Mouse)ACTCCACTCACGGCAAATTCTCTCCATGGTGGTGAAGACA
miR-217-5pUACUGCAUCAGGAACUGACUGGAmRQ3' Primer (Takara, Kyoto, Japan)
U6Takara, Kyoto, Japan Takara, Kyoto, Japan
Table 2 Values of the evaluation indexes

Body weight loss on day 7 (%) (mean ± SD)
DAI on day 7 (mean ± SD)
Colon length (mean ± SD)
Macroscopic scores (mean ± SD)
Histopathological scores (mean ± SD)
n
Water + PBS125.30 ± 6.300.00 ± 0.009.70 ± 0.560.00 ± 0.000.00 ± 0.005
DSS + PBS89.11 ± 8.025.20 ± 0.456.58 ± 0.487.8 ± 1.3013.00 ± 2.555
DSS + rSj16106.00 ± 5.971.40 ± 0.898.12 ± 0.353.20 ± 0.844.4 ± 1.145